A nitrogen acetylated carbazole alkaloid and a preparation method and application thereof
By constructing the DJ gene plasmid and fermenting it in Streptomyces J1074, the nitrogen-acetylated carbazole alkaloids ATC-A and ATC-B were isolated and purified, solving the problem that the N-acetylation gene of carbazole compounds had not been explored, and realizing a green and environmentally friendly preparation method with significant antithrombotic activity.
Patent Information
- Application Number
- CN202510248099.5
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-03-04
- Publication Date
- 2026-04-14
- Estimated Expiration
- 2045-03-04
AI Technical Summary
In the current technology, the gene responsible for the N-acetylation of carbazole compounds has not been discovered, which limits the preparation and application of N-acetylated carbazole alkaloids.
By constructing the plasmid pRJ331 containing the DJ gene and transforming it into Streptomyces J1074, nitrogen-acetylated carbazole alkaloids ATC-A and ATC-B were obtained through fermentation and isolation. They were then prepared using biosynthetic methods and purified by chromatography.
A green and environmentally friendly preparation method is provided, which reduces costs. Furthermore, the compound ATC-A exhibits significant antithrombotic activity in a thrombotic zebrafish model, which may be related to the downregulation of coagulation cascade-related gene expression, and has important development prospects.
Smart Images

Figure CN120271494B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the fields of chemical biology and medicinal chemistry, specifically relating to a nitrogen-acetylated carbazole alkaloid, its preparation method, and its application. Background Technology
[0002] The tricyclic carbazole structure is the core backbone of many pharmaceutically active molecules. Natural molecules containing the carbazole structure possess a variety of biological activities, such as neuroprotection, antibacterial, antitumor, antiviral, anti-inflammatory, and antimalarial activities (Chem Rev. 2012, 112, 3193-3328; 2015, 94: 405-426). The biosynthetic pathways of the carbazole natural molecules lavanduquinocin, carquinostatin A, and neocarazostatin B from Streptomyces use 3,4-carbazole-3,4-quinone as a common precursor. Figure 1 This diagram illustrates the biosynthetic pathway of carbazole natural molecules from Streptomyces. a) shows the biosynthetic pathway of tricyclic carbazole from Streptomyces; b) compares the sequence identity of biosynthetic gene clusters and key gene-encoded proteins of tricyclic carbazole alkaloids from three types of Streptomyces. Genes involved in the biosynthesis of 3,4-o-quinone carbazole are marked in gray. Figure 1 (as shown in a) 2020, 10(8):1147; 2023 Jan 20;18(1):123-133). The biosynthetic gene clusters of LDQ, CQS-A, and NZS-B are respectively BGC BGC BGC contains highly homologous genes responsible for the biosynthesis of 3,4-o-quinone carbazole. Figure 1 (As shown in b). The biosynthetic steps of 3,4-o-quinone carbazole mainly include: (1) L-tryptophan is deaminated by aminotransferase to produce indole-3-pyruvate (IPA); (2) ThDP-dependent acetolactate synthase decarboxylates and couples IPA and pyruvate to produce an unstable carbide. -hydroxy- - Keto acid; (3) decarboxylation intermediate int-1 and loaded onto ACP (acyl carrier protein) - Hydroxybutyryl condensation forms intermediate int-2; (4) Carbazole cyclase cyclizes int-2 to generate carbazole-3,4-quinone ( Figure 1 (as shown in a) 2023 Jan 20;18(1):123-133). The bacterial tricyclic carbazole biosynthesis pathway contains multiple enzymatic catalytic elements that can structurally derivatize the carbazole core, such as isopreneation, methylation, amination, and N-acetylation. 2020, 10(8):1147). Some N-acetylated carbazole alkaloids have good medicinal activity potential, such as the antioxidant activity of aniostatin A1 ( 1990, 43(10), 1337-1340). N-acetylation is commonly found in the post-modification of natural products and is generally handled by N-acetyltransferases. (2008, 9: 628-60), however, the N-acetyltransferase gene responsible for modifying the carbazole molecular backbone has not been reported.
[0003] N-acetylation is commonly found in post-modification of natural products and is generally catalyzed by a class of N-acetyltransferases. However, the gene responsible for the N-acetylation of carbazole compounds has not yet been identified. Summary of the Invention
[0004] The purpose of this invention is to provide a nitrogen-acetylated carbazole alkaloid.
[0005] Another object of the present invention is to provide a method for preparing the aforementioned nitrogen-acetylated carbazole alkaloid.
[0006] Another object of the present invention is to provide the use of the aforementioned nitrogen-acetylated carbazole alkaloid in the preparation of an antithrombotic drug.
[0007] To achieve the above objectives, the technical solution adopted by the present invention is as follows:
[0008] In a first aspect, the present invention provides a nitrogen-acetylated carbazole alkaloid or a pharmaceutical salt thereof, the structure of which is selected from one of the following structures:
[0009] .
[0010] A second aspect of the present invention provides a method for preparing the aforementioned nitrogen-acetylated carbazole alkaloid, comprising the following steps:
[0011] will contain DJ's integrative plasmid pRJ331 was transferred into Streptomyces. The strain J1074 / pRJ331 was obtained from J1074;
[0012] J1074 / pRJ331 mycelia that have been cultured for 2-5 days (preferably 4 days) on SFM plates containing abendazole were picked, inoculated into liquid TSBY medium, and cultured with shaking for the first time to obtain primary seed culture.
[0013] The primary seed culture was inoculated into TSBY liquid culture medium, followed by a second shaking culture, and the fermentation broth was collected.
[0014] The fermentation broth was extracted with an equal volume of ethyl acetate at least three times (preferably five times). The combined organic phase was concentrated under vacuum, redissolved in ethyl acetate, extracted with distilled water, and the organic phase was concentrated into an extract. The extract was subjected to VLC chromatography to obtain nine fractions Fr. A–I.
[0015] The component Fr. E was separated by MPLC chromatography using an ODS column, and the fractions were combined according to ultraviolet chromatography to finally obtain 18 sub-components Fr. E1–18.
[0016] Compound ATC-A was obtained by recrystallization from subfraction Fr. E8;
[0017] Compound ATC-B was obtained from subfraction Fr. E9 by HPLC using a semi-preparative column.
[0018] The conditions for the first shaking culture were: 30 ℃, 220 rpm shaking culture for 3 days.
[0019] The liquid culture medium TSBY consists of 3% trypsin soybean broth, 10% sucrose, 0.5% yeast extract, and 0.1% antifoaming agent.
[0020] The primary seed culture was inoculated into the liquid culture medium TSBY at a volume ratio of 1 / 10.
[0021] The conditions for the second shaking culture were: 30 ℃, 220 rpm shaking culture for 6 days.
[0022] The VLC chromatographic conditions are as follows: the VLC chromatograph is packed with 200-300 mesh silica gel, and the eluent is a mixed solvent of petroleum ether / EtOAc / MeOH, with a volume ratio from 100 / 1 / 0 to 0 / 0 / 1.
[0023] The MPLC chromatographic separation conditions were as follows: flow rate 20 mL / min, eluent 10-100% MeOH / H2O containing 0.1% formic acid, v / v, gradient elution for 5 h.
[0024] The semi-preparative column was: Waters Xbridge C18, 10 × 250 mm, 5 μm, 3 mL / min.
[0025] The HPLC conditions for the semi-preparative column were: 35% CH3CN / H2O, containing 0.1% formic acid, and isocratic elution.
[0026] The solvent used for recrystallization from the subcomponent Fr. E8 is methanol.
[0027] The preparation method of the strain J1074 / pRJ331 includes the following steps:
[0028] The first step is to construct a system containing... DJ gene plasmid
[0029] It was obtained by amplification from the genomic DNA of Streptomyces LHW2432, which produces lavanduquinocin. The D-Jgenes cassette fragment was introduced into the NdeI and EcoRV sites of the vector pIB139 to obtain pRJ331;
[0030] The second step is to transform plasmid pRJ331 into Streptomyces. J1074
[0031] Inoculation with pRJ331 / DH10B was cultured in LB medium containing apopramycin and incubated with shaking (37 °C, 220 rpm, 5 h) until the bacterial concentration reached OD500. 600 The measured value is around 1.0. The bacterial culture is centrifuged to remove the supernatant (centrifuged at 6000 rpm for 30 seconds). The bacterial cells are resuspended in LB medium and then centrifuged again to collect the bacterial cells for washing. The washing step is repeated at least 3 times to obtain the first bacterial cells.
[0032] Streptomyces J1074 was inoculated into liquid TSBY medium and cultured with shaking (30 ℃, 220 rpm shaking culture for 3 days). After centrifuging the Streptomyces culture, the supernatant was removed (centrifuged at 12000 rpm for 1 min). The mycelium was resuspended in LB medium and centrifuged again to collect the cells for washing. The washing step was repeated at least 2 times to obtain the second cell.
[0033] Containing pRJ331 / The first bacterial cell of DH10B and containing Streptomyces The second cell of J1074 was mixed in LB medium and evenly spread on SFM (2% soy flour, 2% D-mannitol, 2% agar) plates containing MgCl2. After incubation at 30 ℃ for 15 hours, the plates were covered with a covering solution (an aqueous solution containing 25 μg / mL naphthylpyrrolidone and 10 μg / mL apopramycin). After the plates dried, they were incubated at 30 ℃ for 4 days. Binding transferons were observed. Single colonies were picked and validated on SFM plates (containing antibiotics at a final concentration of 25 μg / mL naphthylpyrrolidone and 10 μg / mL apopramycin). Genomic DNA was extracted from mycelia on the validated plates as PCR templates. PCR verification was performed using primers T-331-S (SEQ ID NO. 3) and T-331-A (SEQ ID NO. 4), yielding 411 cells. The PCR product of bp was sequenced and confirmed, and strain J1074 / pRJ331 was finally obtained.
[0034] The LB medium consisted of 1% tryptone, 0.5% yeast extract, and 1% NaCl.
[0035] The first step constructs containing The method for preparing the plasmid of the DJ gene includes the following steps:
[0036] Genomic DNA of Streptomyces LHW2432 was amplified to obtain... The PCR fragment of DJ genes cassette was obtained, and the target fragment was recovered by gel electrophoresis. The primers used were Ldq-S (SEQ ID NO. 1) and Ldq-A (SEQ ID NO. 2). The vector was obtained by digesting the pIB139 plasmid with NdeI and EcoRV. Specifically, 2 μg of plasmid pIB139, 2 μL each of restriction endonucleases NdeI and EcoRV, and Q-polar water were added to a final volume of 40 μL. The digestion was carried out at 37 °C for 5 h, followed by the addition of 60 μL of ice-cold isopropanol, centrifugation at 14000 rpm for 10 min, removal of the supernatant, and washing the precipitate twice with 80% ethanol. Finally, the DNA was dissolved in 20 μL of Q-polar water. The vector pIB139 (NdeI, EcoRV) and containing... were ligated using a 2×Ezmax-Muli CloneMix Plus kit. PCR fragments from DJ genescassette; the reaction system consisted of 3 μL vector DNA (20 ng / μL), 1 μL insert fragment (60 ng / μL), and 4 μL Q-polarized water, reacted at 50 ℃ for 1 h, and the reaction solution was then subjected to calcium conversion. DH10B was ultimately confirmed by sequencing to be the target clone pRJ331 / DH10B.
[0037] A third aspect of the present invention provides the use of the aforementioned nitrogen-acetylated carbazole alkaloid or its pharmaceutical salt in the preparation of an antithrombotic drug.
[0038] This invention evaluated the bioactivity of compound ATC-A in a thrombotic zebrafish model, finding that compound ATC-A could restore cardiac erythrocyte count, exhibited dose-dependent activity in reducing venous thrombus staining area / intensity and restoring blood flow, and significantly promoted peripheral platelet circulation in thrombotic zebrafish; pretreatment with compound ATC-A significantly reversed genes associated with the coagulation cascade. , and The upregulation of transcription in the compound makes the compound of this invention a promising candidate for development as an antithrombotic agent.
[0039] By adopting the above technical solution, the present invention has the following advantages and beneficial effects:
[0040] This invention discloses a method using Streptomyces The J1074 fermentation produces nitrogen-acetylated carbazole alkaloids, and a biosynthetic preparation method is provided, which is more environmentally friendly and cost-effective than chemical synthesis. The compound ATC-A provided by this invention shows significant antithrombotic activity in a thrombotic zebrafish model, which may be related to the downregulation of gene expression related to the coagulation cascade, and has important development prospects and clinical application value. Attached Figure Description
[0041] Figure 1 This is a schematic diagram of the biosynthetic pathway of carbazole natural molecules derived from Streptomyces.
[0042] Figure 2 It is the 2D NMR (DMSO-) of compounds ATC-A and ATC-B. Correlation diagram.
[0043] Figure 3 This is a schematic diagram of the HR-ESI-MS of compound ATC-A.
[0044] Figure 4 This is a UV schematic diagram of compound ATC-A.
[0045] Figure 5 This is an IR schematic diagram of compound ATC-A.
[0046] Figure 6 It is compound ATC-A 1 Schematic diagram of H-NMR.
[0047] Figure 7 It is compound ATC-A 13Schematic diagram of C-NMR.
[0048] Figure 8 This is a schematic diagram of DEPT 135 for compound ATC-A.
[0049] Figure 9 It is compound ATC-A 1 H- 1 H COSY schematic diagram.
[0050] Figure 10 This is a schematic diagram of the HSQC of compound ATC-A.
[0051] Figure 11 This is a schematic diagram of the HMBC of compound ATC-A.
[0052] Figure 12 This is a schematic diagram of the NOESY spectrum of compound ATC-A.
[0053] Figure 13 This is a schematic diagram of the HR-ESI-MS of compound ATC-B.
[0054] Figure 14 This is a UV schematic diagram of the compound ATC-B.
[0055] Figure 15 This is an IR schematic diagram of compound ATC-B.
[0056] Figure 16 It is compound ATC-B 1 Schematic diagram of H-NMR.
[0057] Figure 17 It is compound ATC-B 13 Schematic diagram of C-NMR.
[0058] Figure 18 This is a schematic diagram of DEPT 135 for compound ATC-B.
[0059] Figure 19 It is compound ATC-B 1 H- 1 H COSY schematic diagram.
[0060] Figure 20 This is a schematic diagram of the HSQC of compound ATC-B.
[0061] Figure 21 This is a schematic diagram of the HMBC of compound ATC-B.
[0062] Figure 22 This is a schematic diagram of the NOESY spectrum of compound ATC-B.
[0063] Figure 23 This is a schematic diagram showing the results of evaluating the bioactivity of compound ATC-A in a thrombotic zebrafish model. Detailed Implementation
[0064] To more clearly illustrate the present invention, the following description, in conjunction with preferred embodiments, further clarifies the invention. Those skilled in the art should understand that the specific descriptions below are illustrative rather than restrictive, and should not be construed as limiting the scope of protection of the present invention.
[0065] Preservation instructions:
[0066] Strain name: J1074 / pRJ331;
[0067] Accession number: CCTCC M 2025142;
[0068] Category Naming: ;
[0069] Deposit date: January 15, 2025;
[0070] Depository: China Center for Type Culture Collection;
[0071] Address of the depositary institution: Wuhan University, Wuhan, China.
[0072] Example 1 Construction DJ::J1074 heterologous expression strain
[0073] will contain DJ's integrative plasmid pRJ331 was transferred into Streptomyces. J1074 (BioSample number SAMN02603310 in the National Center for Biotechnology Information database) (Zaburannyi N, et al. Insights into naturally minimised Streptomyces albus J1074 genome. BMC Genomics, 2014, 15:97) was used to obtain strain J1074 / pRJ331 for heterologous production of ATCs.
[0074] The first step is to construct a system containing... DJ gene plasmid.
[0075] The lavanduquinocin was obtained by amplification from the genomic DNA of Streptomyces LHW2432 (CGMCC No. 26633), which produces lavanduquinocin. The DJ genes cassette fragment was extracted and introduced into the NdeI and EcoRV sites of the vector pIB139 to obtain pRJ331.
[0076] The specific steps are as follows: First, amplify the genomic DNA of Streptomyces LHW2432 to obtain... The PCR fragment of DJ genescassette was obtained, and the target fragment was recovered by gel electrophoresis. The primers used were Ldq-S (CAATCGTGCCGGTTGGTAGGATCCACATATGCCCGAAAAAGTGGTTCGCAATGACG, SEQ ID NO. 1) and Ldq-A (AACAGCTATGACATGATTACGAATTCGATATCTTACGCCAAGGCCCGCAGCACCGC, SEQ ID NO. 2). The vector was obtained by digesting the pIB139 plasmid with NdeI and EcoRV. Specifically, 2 μg of plasmid pIB139, 2 μL each of restriction endonucleases NdeI and EcoRV, and Q-polar water was added to a final volume of 40 μL. The digestion was carried out at 37 °C for 5 h, followed by the addition of 60 μL of ice-cold isopropanol, centrifugation at 14000 rpm for 10 min, removal of supernatant, washing of the precipitate twice with 80% ethanol, and finally dissolution of the DNA with 20 μL of Q-polar water. The vector pIB139 (NdeI, EcoRV) was ligated using the 2×Ezmax-Muli CloneMix Plus kit (Shanghai Tulugang Biotechnology Co., Ltd.). PCR fragments from DJ genescassette. The reaction system consisted of 3 μL vector DNA (20 ng / μL), 1 μL insert fragment (60 ng / μL), and 4 μL Q-polarized water, and was incubated at 50 °C for 1 h. 10 μL of the reaction solution was then converted to calcium via calcium transfer. DH10B. The target clone pRJ331 / was finally confirmed by sequencing. DH10B.
[0077] The second step is to transform plasmid pRJ331 into Streptomyces. J1074.
[0078] Inoculation with pRJ331 / DH10B was cultured in LB medium (Luria-Bertani Medium, 1% tryptone, 0.5% yeast extract, 1% NaCl) containing a final antibiotic concentration of 50 μg / mL apopramycin. The culture conditions were 37 °C, shaker speed 220 rpm, for 5 h, until the bacterial concentration reached OD500. 600The measured value was around 1.0. 1.5 mL of bacterial culture was centrifuged at 6000 rpm for 30 s and the supernatant was removed. The bacterial cells were then resuspended in 1 mL of LB medium and centrifuged again to collect the bacterial cells for washing. The washing step was repeated 3 times to obtain the first bacterial cells.
[0079] Streptomyces J1074 was inoculated into a 100 mL Erlenmeyer flask equipped with a spring, containing 25 mL of liquid TSBY (Tryptic Soy Broth, formulated as 3% trypsin soybean broth, 10% sucrose, 0.5% yeast extract, and 0.1% antifoaming agent), and cultured at 30 °C and 220 rpm for 3 days. 0.5 mL of Streptomyces culture was centrifuged at 12000 rpm for 1 min, the supernatant was discarded, and the mycelium was resuspended in 1 mL of LB medium. The culture was then centrifuged again to collect the cells for washing. This washing process was repeated twice to obtain a second set of cells.
[0080] Containing pRJ331 / The first bacterial cell of DH10B (approximately 20 μL) and containing Streptomyces The second cell of J1074 (approximately 50 μL) was mixed in 150 μL of LB medium and evenly spread on SFM (2% soya flour, 2% D-mannitol, 2% agar) agar containing 10 mM MgCl2. After incubation at 30 °C for 15 hours, the plates were covered with a 1 mL aqueous solution containing 25 μg / mL nalidixic acid and 10 μg / mL apopramycin. After the plates were dried, they were incubated at 30 °C for 4 days. Conjugated transfer spores were observed. Single colonies were picked and plated on SFM agar (containing antibiotics at a final concentration of 25 μg / mL nalidixic acid and 10 μg / mL apopramycin) for replication. Genomic DNA was extracted from mycelia picked from the verification plate and used as a PCR template. PCR verification was performed using primers T-331-S (SEQ ID NO. 3) and T-331-A (SEQ ID NO. 4) (as shown in Table 1), and a 411 bp PCR product was obtained. The PCR product was sequenced to confirm the result, and strain J1074 / pRJ331 was finally obtained.
[0081] Table 1
[0082]
[0083] The third step involved fermentation of strain J1074 / pRJ331 and extraction and isolation of its metabolites to obtain ATCs.
[0084] J1074 / pRJ331 mycelia cultured for 4 days were picked from SFM plates (containing 10 μg / mL abramycin) and inoculated into 100 mL Erlenmeyer flasks equipped with springs, containing 25 mL of TSBY liquid medium. The flasks were incubated at 30 °C and 220 rpm for 3 days to obtain primary seed culture. The primary seed culture was then inoculated at 1 / 10 (v / v) into 500 mL Erlenmeyer flasks equipped with springs, containing 100 mL of TSBY liquid medium. The flasks were incubated at 30 °C and 220 rpm for 6 days, and 18 L of fermentation broth was collected.
[0085] The fermentation broth was extracted five times with equal volumes of ethyl acetate (EtOAc). The combined organic phases were concentrated under vacuum and then redissolved in 1 L of EtOAc. The EtOAc phase was extracted with 1 L of distilled water to remove sugars and salts, and the organic phase was then concentrated to a paste (18 g). The paste was subjected to VLC chromatography packed with 200–300 mesh silica gel, using a mixed solvent of petroleum ether / EtOAc / MeOH (from 100 / 1 / 0 to 0 / 0 / 1, v / v) as the eluent to obtain nine fractions Fr. A–I.
[0086] Fraction Fr. E (0.86 g) was separated by MPLC using an ODS column (Santai Technologies, Inc., Spherical C18, 31.2 × 257.4 mm, 15 μm, 100 Å), a flow rate of 20 mL / min, and a gradient elution of 10–100% MeOH / H2O (0.1% formic acid, v / v) for 5 h. The fractions were combined according to UV chromatography, and 18 subfractions Fr. E1–18 were finally obtained.
[0087] 4.7 mg of compound ATC-A was obtained from 256.5 mg of subfraction Fr. E8 by recrystallization (in methanol).
[0088] Compound ATC-B (10 mg, t) was obtained from 31 mg subfraction Fr. E9 by HPLC using a semi-preparative column (Waters Xbridge C18, 10 × 250 mm, 5 μm, 3 mL / min). R = 29.2 min), HPLC conditions: isocratic elution with 35% CH3CN / H2O (0.1% formic acid) at a flow rate of 3 mL / min.
[0089] Structural identification of compounds ATC-A and ATC-B:
[0090] The compounds of this invention were identified using a variety of modern spectroscopic techniques, including NMR, HR-ESI-MS, UV, and optical rotation.
[0091] The structures of compounds ATC-A (Antithromcarb-A) and ATC-B (Antithromcarb-B) are as follows:
[0092]
[0093] Compound ATC-A: Reddish-brown needle-like crystals. UV (MeOH): max (log 219 (3.92), 239 (3.85), 301 (3.63), 349 (3.19) nm; 1D and 2D NMR data are shown in Table 2 and Figures 2-12 As shown; HR-ESI-MS 297.1597 [M + H] + (calcd for C 18 H 21 N2O2 + , 297.1606). Figure 2 It is the 2D NMR (DMSO-) of compounds ATC-A and ATC-B. Correlation diagram. Figure 3 This is a schematic diagram of the HR-ESI-MS of compound ATC-A. Figure 4 This is a UV schematic diagram of compound ATC-A. Figure 5 This is an IR schematic diagram of compound ATC-A. Figure 6 It is compound ATC-A 1 Schematic diagram of H-NMR. Figure 7 It is compound ATC-A 13 Schematic diagram of C-NMR. Figure 8 This is a schematic diagram of DEPT 135 for compound ATC-A. Figure 9 It is compound ATC-A 1 H- 1 H COSY schematic diagram. Figure 10 This is a schematic diagram of the HSQC of compound ATC-A. Figure 11 This is a schematic diagram of the HMBC of compound ATC-A. Figure 12 This is a schematic diagram of the NOESY spectrum of compound ATC-A.
[0094] Compound ATC-B: Reddish-brown needle-like crystals. UV (MeOH): max (log 203 (4.16), 251 (4.13), 348 (3.80) nm; 1D and 2D NMR data are shown in Table 3 and Figures 13-22As shown, HR-ESI-MS 297.1598 [M + H] + (calcd for C 18 H 21 N2O2 + , 297.1606). Figure 13 This is a schematic diagram of the HR-ESI-MS of compound ATC-B. Figure 14 This is a UV schematic diagram of the compound ATC-B. Figure 15 This is an IR schematic diagram of compound ATC-B. Figure 16 It is compound ATC-B 1 Schematic diagram of H-NMR. Figure 17 It is compound ATC-B 13 Schematic diagram of C-NMR. Figure 18 This is a schematic diagram of DEPT135 for compound ATC-B. Figure 19 It is compound ATC-B 1 H- 1 H COSY schematic diagram. Figure 20 This is a schematic diagram of the HSQC of compound ATC-B. Figure 21 This is a schematic diagram of the HMBC of compound ATC-B. Figure 22 This is a schematic diagram of the NOESY spectrum of compound ATC-B.
[0095] Table 2. ATC-A NMR data
[0096]
[0097] Table 3. ATC-B NMR data
[0098]
[0099] Example 2
[0100] Assay for the antithrombotic activity of compound ATC-A:
[0101] Bioactivity assays using a thrombotic zebrafish model showed that compound ATC-A exhibited significant antithrombotic activity, possibly through downregulation of gene expression associated with platelet activation and the coagulation cascade.
[0102] 1. Maintenance and embryo collection of zebrafish.
[0103] The zebrafish strain (Danio rerio) used in this experiment was the AB wild-type and the transgenic zebrafish line cd41:eGFP (purchased from the Institute of Biology, Qilu University of Technology). Male and female zebrafish were maintained in an automated circulating aquarium at 28.0 ℃ ± 0.5 ℃ with a light / dark cycle of 14 / 10 hours. Embryos were obtained from natural spawning. After fertilization, the eggs were collected, washed, and sterilized with methylene blue solution, then placed in zebrafish embryo culture water containing 5.0 mM NaCl, 0.17 mM KCl, 0.4 mM CaCl2, and 0.16 mM MgSO4 in a constant temperature and light incubator at 28.0 ℃ ± 0.5 ℃. Six hours post-fertilization (hpf), 1-phenyl-2-thiourea was added to the culture medium to achieve a final concentration of 0.03 mg / mL to inhibit melanin formation. The zebrafish embryo culture water was changed every 24 hours.
[0104] 2. Chemical treatment and establishment of thrombosis model.
[0105] Zebrafish larvae at 72 hpf were selected under a microscope and transferred to 24-well culture plates. They were randomly divided into six groups: control group (Ctrl), arachidonic acid (AA) model group, aspirin (ASP) positive control group, and experimental groups (2.5 μM, 5 μM, 10 μM). Each group was repeated three times, with 10 larvae per well per replicate. Pretreatment with aspirin (ASP) (22.5 μg / mL) or the test compound for 6 h was performed. The solution was then aspirated, and the control group was treated with fish culture water. The remaining groups were modeled with 80 μM AA. The plates were incubated at 28 ± 0.5 °C for 1 h. At the end of treatment, the solution was pipetted out, and the zebrafish larvae were stained with 1.0 mg / mL O-dianisidine dye liquor in the dark for 10 min. After washing three times with zebrafish embryo culture water, each zebrafish was fixed with 4% paraformaldehyde.
[0106] 3. Screening for antithrombin activity by measuring red blood cells in the heart of zebrafish.
[0107] Images of zebrafish heart and tail thrombi were captured using a fluorescence microscope (AXIO-V16, Zeiss, Germany). The staining area and intensity of erythrocytes in the zebrafish heart and tail thrombi were quantified using Image Pro Plus software (MediaCybernetics, Bethesda, USA).
[0108] 4. Quantification of caudal artery thrombosis and blood flow.
[0109] Zebrafish larvae of strain AB, aged 72 hpf, were grouped and treated using the method described above. The experimental groups were pretreated with compound ATC-A at concentrations of 2.5, 5, and 10 μM, respectively. Images of cardiac erythrocytes and tail thrombi were captured using a fluorescence microscope. Seven zebrafish were randomly selected from each group for measuring blood flow velocity in the tail artery. Dynamic blood flow was recorded for 15 seconds using the Zebralab blood flow system (ViewPoint, Lyon, France). For video analysis, the key measurement areas of the tail artery were manually located. The number of all passing erythrocytes was automatically calculated, and hemodynamic images were obtained using MicroZebraLab Blood Flow v.3.4.6.
[0110] 5. Real-time quantitative PCR (RT-qPCR) analysis.
[0111] At 79.5 hpf post-treatment, 30 healthy zebrafish larvae were collected from each group, and RNA was extracted according to the Fast Pure Cell / Tissue Total RNA Isolation Kit-BOX2 instructions. RNA was transcribed into cDNA using HiScript III RTSuperMix for qPCR. qPCR analysis was performed using a LightCycler 96 instrument according to the ChamQ Universal SYBR qPCR premix instructions. Each group underwent three RT-qPCR tests, and housekeeping genes were used. Standardized analysis was performed as a control. Methods for quantifying coagulation cascade reaction factors ( , and The relative expression levels of related genes. Primers used for RT-qPCR are... (forward:TCTGGAGGACTGTAAGAGGTATGC (SEQ ID NO. 5); reverse: AGACGCACAATCTTGAGAGCAG (SEQ ID NO. 6)), (forward: TCAGTCCAGCGTGCCTTATG (SEQ ID NO. 7); reverse:GCGTATGTCAAGCGGTAAGC (SEQ ID NO. 8)), (forward: TCATCGTCCGCCTTGGAAAA (SEQ ID NO. 9); reverse: TCGGTTCAGGTTTTCCTTCCA (SEQ ID NO. 10)), and (forward: TCAGAGAGCCAAGTGCCAAG (SEQ ID NO. 11); reverse: ACATCTGCGAGTCCTCTCCT (SEQ ID NO. 12)).
[0112] in conclusion: Figure 23 This is a schematic diagram illustrating the bioactivity evaluation results of compound ATC-A in a thrombotic zebrafish model. Specifically, a) shows the staining area / intensity of cardiac erythrocytes by compound ATC-A; b) shows the staining area and intensity of erythrocytes in the tail artery; c) shows the blood flow velocity in the tail artery; and d) shows the relative mRNA levels of thrombosis-related genes. #### < 0.0001 vs Ctrl;* < 0.05,** < 0.01, *** < 0.001, **** <0.0001 vs AA. GraphPad Prism v.9.0 is used for statistical analysis of one-way ANOVA and Dunnett's multiple comparison test. <0.05 is considered significant.
[0113] After a thrombus forms, the number of red blood cells in the heart decreases, while the number of red blood cells in the tail increases. Figure 23 The results in Figure a show that, compared with the control group, the AA model group exhibited significantly reduced cardiac erythrocyte staining area and intensity, indicating that AA successfully induced thrombosis in zebrafish. Compared with the model group, the positive control Asp showed significantly increased cardiac erythrocyte staining area and intensity, indicating that Asp significantly improved AA-induced thrombosis. Furthermore, compared with the model group, the experimental groups (2.5 μM, 5 μM, 10 μM) of zebrafish hearts showed increased erythrocyte staining area and intensity, indicating that compound ATC-A has a therapeutic effect on AA-induced zebrafish thrombosis. Among the three concentrations of compound ATC-A, the 2.5 μM concentration of compound ATC-A was comparable in activity to the positive control drug aspirin (ASP).
[0114] Figure 23Figure b shows that, compared with the control group, the AA model group exhibited a significant increase in the area and intensity of erythrocyte staining in the tail of zebrafish. Compared with the model group, the positive control Asp group showed a decrease in the area and intensity of erythrocyte staining in the tail, indicating that Asp improved AA-induced thrombosis. Furthermore, compared with the model group, the experimental groups (2.5 μM, 5 μM, 10 μM) showed a decrease in the area and intensity of erythrocyte staining in the tail of zebrafish, indicating that compound ATC-A has a therapeutic effect on AA-induced thrombosis in zebrafish and exhibits dose-dependent activity in reducing the area / intensity of thrombus staining in the tail. Figure 23 The results showed that, compared with the control group, the blood flow velocity and heart rate in the tail vessels of zebrafish in the AA model group were significantly slowed. Compared with the model group, Asp and compound ATC-A significantly improved blood flow velocity and heart rate, and pretreatment with compound ATC-A showed dose-dependent restoration of blood flow, thereby significantly promoting peripheral platelet circulation in thrombotic zebrafish. Thrombin Fibrinogen, a key protein in the coagulation cascade and Significantly elevated levels can lead to a hypercoagulable state and thrombosis. 2023, 314,116397). Figure 23 The data in the middle section showed that, compared with the control group, the AA model group , and Expression was upregulated. Compared with the model group, the positive control Asp and compound ATC-A significantly reversed the expression. , and The upregulation of expression indicates that compound ATC-A performs its antithrombotic function by inhibiting platelet activation and the coagulation cascade.
[0115] This invention evaluated the bioactivity of compound ATC-A in a thrombotic zebrafish model, finding that compound ATC-A could restore cardiac erythrocyte count, exhibited dose-dependent activity in reducing venous thrombus staining area / intensity and restoring blood flow, and significantly promoted peripheral platelet circulation in thrombotic zebrafish; pretreatment with compound ATC-A significantly reversed genes associated with the coagulation cascade. , and The upregulation of transcription in the compound makes the compound of this invention a promising candidate for development as an antithrombotic agent.
[0116] The above description is merely a preferred embodiment of the present invention and is not intended to limit the present invention in any way. Although the present invention has been disclosed above with reference to preferred embodiments, it is not intended to limit the present invention. Any person skilled in the art can make some modifications or alterations to the above-described technical content to create equivalent embodiments without departing from the scope of the present invention. Any simple modifications, equivalent changes, and alterations made to the above embodiments based on the technical essence of the present invention without departing from the scope of the present invention shall still fall within the scope of the present invention.
Claims
1. A nitrogen-acetylated carbazole alkaloid or its pharmaceutical salt, characterized in that, The structure is selected from one of the following: 。 2. The use of the nitrogen-acetylated carbazole alkaloid of claim 1 or its pharmaceutical salt in the preparation of an antithrombotic drug.
Citation Information
Patent Citations
Carbazole alkaloid compound as well as preparation method and application thereof
CN116444540A
Indole alkaloid derivative as well as preparation method and application thereof
CN116555082A