Medicine for treating atopic dermatitis and application thereof
The NMBR antagonist BIM 23042 addresses the limitations of current atopic dermatitis treatments by reducing IL-4 and IL-13 levels and macrophage infiltration, providing a safer and more effective treatment for atopic dermatitis.
Patent Information
- Application Number
- CN202510563026.5
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-04-30
- Publication Date
- 2025-07-15
AI Technical Summary
The existing methods for treating atopic dermatitis have problems such as large side effects, strong dependence, rebound in drug discontinuation, increased risk of infection and strong liver and kidney toxicity, and have failed to effectively change the recurrent characteristics of the disease.
Intradermal injection of NMBR antagonist BIM 23042 reduces the transcriptional levels of IL-4 and IL-13 in skin tissues and reduces macrophage infiltration by inhibiting NMBR-mediated Ca2+ release and NF-κB activation.
Effectively alleviate the symptoms of atopic dermatitis, reduce skin lesions and scales, reduce IL-4 and IL-13 expression, reduce epidermal thickness and dermal inflammatory cell infiltration, reduce edema liquefaction and degeneration, and no obvious side effects were found.
Smart Images

Figure CN120305382A_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the field of pharmaceutical technology, and particularly relates to a drug for treating atopic dermatitis and its application. Background Art
[0002] Atopic dermatitis is a recurrent, chronic inflammatory skin disease, the basic features of which are eczema-like lesions, severe itching and a chronic course. In 2019, at least 171 million people worldwide suffered from atopic dermatitis, accounting for 2.23% of the world's population. In China, the prevalence of childhood atopic dermatitis is approximately between 10% and 20%, and may even be higher in some large cities (such as Beijing, Shanghai, Guangzhou, etc.). The etiology of this disease is complex, involving multiple aspects such as genetic factors, immune abnormalities and environmental triggers. In the pathogenesis of atopic dermatitis, the imbalance of the immune system is considered to be the core factor. Th2 cells are the main pathogenic cells in this pathological process. Th2 cells enhance the allergic inflammatory response of the skin by secreting cytokines such as IL-4, IL-5, and IL-13. Macrophages are important phagocytic and antigen-presenting cells in the body and infiltrate in the acute and chronic skin lesions of atopic dermatitis. Compared with healthy people, there is no obvious change in the infiltration of M1 macrophages in the skin of atopic dermatitis patients, while M2 macrophages increase significantly. IL-4 and IL-13 secreted by Th2 cells promote the polarization of macrophages into M2, causing them to accumulate in the upper dermis of the skin lesions of atopic dermatitis. The infiltrated M2 macrophages interact with Th2 cells through receptor-ligand crosstalk, exacerbating type 2 inflammation.
[0003] The treatment of atopic dermatitis usually includes topical treatment and systemic treatment. Glucocorticoid ointments and topical calcineurin inhibitors (such as tacrolimus and pimecrolimus) help to reduce skin inflammation and relieve symptoms. For moderate to severe cases, oral antihistamines, glucocorticoids, immunosuppressants (such as cyclosporine A, methotrexate), etc. can be used, which help to inhibit the immune response and control the condition. In recent years, significant progress has been made in the targeted inhibition of cytokines such as IL-4 and IL-13. Taking the application of Dupilumab as an example, it can effectively inhibit the Th2 type immune response and significantly improve symptoms; small molecule inhibitors targeting the JAK1 pathway are also increasingly widely used due to their high efficacy. Although the existing treatment regimens control the condition to a certain extent, they have not changed the characteristics of recurrent and protracted atopic dermatitis; there are still many limitations in the existing treatment methods, such as large side effects, strong dependence, rebound after drug withdrawal, increased infection risk, strong liver and kidney toxicity, etc. Therefore, the treatment targeting the neuroimmune circuit has become a new direction. Clinical studies have shown that the SCORAD score of atopic dermatitis patients treated with botulinum toxin is significantly reduced; topical application of the TRPV1 selective antagonist PAC-14028 improves the SCORAD score and itching. These studies support the effectiveness of the targeted treatment of the neuroimmune circuit and may bring potential benefits to clinical applications. The present invention aims to explore more deeply the pathogenesis of atopic dermatitis, especially in the aspect of targeting the neuroimmune system, in order to discover new treatment targets and develop more personalized, effective and less side-effect treatment methods. Summary of the Invention
[0004] The object of the present invention is to overcome the deficiencies of the prior art and provide a drug and its application: intradermal injection of the NMBR antagonist BIM 23042 can improve the skin lesions of atopic dermatitis-like mice and reduce macrophage infiltration.
[0005] In order to achieve the above object of the invention, the present invention provides the following technical solutions.
[0006] The present invention discloses the application of an NMBR antagonist in the preparation of a drug for treating atopic dermatitis.
[0007] Further, the NMBR antagonist is the somatostatin octapeptide analogue BIM 23042.
[0008] Further, the drug exerts its effect by inhibiting NMBR-mediated Ca 2+ release and NF-κB activation.
[0009] Further, the drug can reduce the transcriptional levels of IL-4 and IL-13 in skin tissues.
[0010] Further, the dosage form of the drug is a pharmaceutically acceptable dosage form.
[0011] The present invention discloses a pharmaceutical composition for treating atopic dermatitis, which is characterized in that the pharmaceutical composition contains an NMBR antagonist and its pharmaceutically acceptable salt as active ingredients, and is prepared by adding pharmaceutically acceptable excipients.
[0012] Furthermore, the use of the above-mentioned pharmaceutical composition in the preparation of a drug for treating atopic dermatitis.
[0013] Compared with the prior art, the beneficial effects of the present invention are as follows.
[0014] BIM 23042 is an octapeptide analogue of somatostatin (SS) and is a selective neuropeptide neuromedin B receptor (NMBR) antagonist. The pharmacological effect of BIM 23042 is to inhibit the Ca 2+ release induced by neuromedin B (abbreviated as NMB). Research shows that intradermal and intrathecal injection of NMB can induce acute pruritus in wild-type mice, and injection of NMB into the plantar surface of mice can cause edema and hyperalgesia. NMB / NMBR can respond to viral infection, regulate the expression of IFN-α and IL-6, and can also induce the activation of mouse macrophages, activate NF-κB, and regulate the inflammatory response. The relationship between the NMB-NMBR axis and sensory neurons and its role on macrophages are highly related to the pathogenesis of atopic dermatitis.
[0015] The present invention first discovers that intradermal injection of an NMBR antagonist can effectively relieve the chronic inflammation of atopic dermatitis patients and has a good effect on controlling the disease; no side effects such as abnormal death or infection of mice are observed in this treatment method. Brief Description of the Drawings
[0016] Figure 1 Shows the changes in the skin lesions of mice after intradermal injection of an NMBR antagonist.
[0017] Figure 2 Shows the changes in the transcriptional levels of IL4 and IL13 in the skin of mice after intradermal injection of an NMBR antagonist. Among them, Figure A shows the change in the transcriptional level of IL4; Figure B shows the change in the transcriptional level of IL13. ** represents a P value < 0.01, and * represents a P value < 0.05.
[0018] Figure 3 Shows the hematoxylin-eosin staining map of the skin tissue of mice after intradermal injection of an NMBR antagonist.
[0019] Figure 4 Shows the quantitative results of the epidermal thickness of the hematoxylin-eosin staining of the skin tissue of mice. **** represents a P value < 0.0001.
[0020] Figure 5After intradermal injection of the NMBR antagonist, the infiltration of macrophages and M1 and M2 macrophages in the skin of mice was observed. Figure A shows the main cell mass in the skin of mice; Figure B shows single cells after de-adhesion of the main cell mass; Figure C shows live cells (FVS700-); Figure D shows myeloid cells (CD11b+); Figure E shows the proportion of macrophages (F4 / 80+) in myeloid cells; Figure F shows the proportion of M1 (CD86+) and M2 (CD206+) - like macrophages in macrophages; Figure G shows the quantitative analysis of macrophage infiltration in the skin of mice; Figure H shows the quantitative analysis of M1 macrophage infiltration in the skin of mice; Figure I shows the quantitative analysis of M2 macrophage infiltration in the skin of mice. Detailed implementation mode
[0021] The present invention will be further described in detail below with specific examples. However, it should not be understood that the scope of the above - mentioned subject matter of the present invention is limited to the following examples. All technologies implemented based on the content of the present invention belong to the scope of the present invention.
[0022] Unless otherwise specified, the reagents and materials used in the present invention are all commercially available.
[0023] Example 1
[0024] 1. Experimental method
[0025] Establishment of an atopic dermatitis - like mouse model and grouping for drug administration: C57BL / 6 female mice (female, 6 - 8w, 18 - 20g; ChangSheng Biotechnology, China) were raised under specific aseptic conditions. The breeding environment temperature was 20 - 25°C, with a 12 - h day - night cycle, and sufficient food and water were provided. According to whether the NMBR antagonist and DNCB acetone - olive oil solution were given, the mice were randomly divided into 3 groups: control group, disease model group, and antagonist treatment group.
[0026] (1) The NMBR antagonist BIM23042 (MCE, China) was diluted with DMSO to a storage liquid with a concentration of 10 mM. When used, 0.84 μL of the storage liquid + 149.16 μL of PBS were configured into a working solution. Acetone (Luoyang Haohua Chemical Reagent Co., Ltd., China) and olive oil (Pinli, China) were used to configure 1% and 0.5% DNCB solutions (Sigma, USA).
[0027] (2)Five days before formal modeling, after shaving the hair on the back of the mice, the model group and the antagonist group were topically applied with 200 μL of 1% DNCB acetone olive oil solution for primary sensitization at the depilated site, and the control group was only topically applied with 200 μL of acetone olive oil solution. Starting from day 0, 200 μL of 0.5% DNCB acetone olive oil solution was topically applied to the depilated site on days 0, 2, 4, 6, 8, 10, and 12 respectively, once every other day, for a total of 7 challenges; the control group was only topically applied with 200 μL of acetone olive oil solution; the treatment group was intradermally injected with NMBR antagonist at the same time on the basis of applying DNCB. The modeling was completed on day 14, and the skin was extracted.
[0028] RNA extraction and fluorescence quantitative PCR: mRNA was collected using the miRNeasy Mini Kit (Qiagen, Germany), and then measured by ND1000 nanometer. cDNA was synthesized using the GoScript reverse transcription kit (Promega, USA). Then RT-PCR was performed using the RTSYBR Green qPCR Mastermix (Promega, USA), and then detected using the 7900HT Fast Real-Time PCR System (Applied Biosystems, USA). The reaction conditions were set as 95°C for 2 min, 95°C for 15 s and 60°C for 1 min for 40 cycles, and then the melting curve of each PCR product was calculated to confirm the synthesis specificity.
[0029] The primer sequences are as follows: Mouse IL-4 sense: TCTCGAATGTACCAGGAGCC anti-sense: TTGGCACATCCATCTCCGTG Mouse IL-13 sense: CATGGCCTCTGTAACCGCAA anti-sense: ATTTTGGTATCGGGGAGGCTG.
[0030] Hematoxylin-eosin staining: After fixing the fresh skin lesion tissue with paraformaldehyde for more than 24 h, it was paraffin-embedded and sectioned, and HE staining was performed using a hematoxylin-eosin staining kit (Beyotime, China), and observed and photographed under a microscope. 3-5 fields of view were randomly selected and photographed for each mouse sample, and the epidermal thickness was measured using Image Pro Plus.
[0031] Flow cytometry: Dermal single-cell suspensions were prepared by digesting mouse skin using collagenase (Sigma, USA), DNAse (Roche, USA) and dispase (Sigma, USA). 10 were taken from each mouse 6The cells were resuspended with FACS solution for cell viability and surface marker staining. After 30 minutes, they were washed, resuspended and mixed with PBS, and sorted and counted using a BD Fortessa flow cytometer (BD Biosciences, USA).
[0032] Statistical analysis: GraphPad Prism 10.0 software was used for analysis and graphing. Paired t-tests, Wilcoxon signed-rank tests, and one-way ANOVA were used as appropriate. The data were repeated at least three times, and P < 0.05 was considered statistically significant.
[0033] 2. Experimental results.
[0034] As Figure 1 shown, after intradermal injection of the NMBR antagonist, the skin lesions of the mice improved and the scales decreased.
[0035] As Figure 2 shown, after intradermal injection of the NMBR antagonist, the transcriptional levels of IL-4 and IL-13 in the skin of the mice were lower than those in the disease group.
[0036] As Figure 3 shown, after intradermal injection of the NMBR antagonist, the thickness of the epidermal layer of the mice decreased compared with the disease group, the infiltration of inflammatory cells in the dermis decreased, and the liquefactive degeneration of dermal edema was alleviated compared with the disease group.
[0037] As Figure 4 shown, after intradermal injection of the NMBR antagonist, the decrease in the thickness of the epidermal layer of the mice compared with the disease group was statistically significant.
[0038] As Figure 5 shown, after intradermal injection of the NMBR antagonist, the proportion of macrophages in the skin of the mice decreased compared with the disease group.
[0039] The above results indicate that by intradermally injecting the NMBR antagonist into atopic dermatitis-like mice, it was found that it could effectively relieve the skin lesions of atopic dermatitis-like mice; the expression of IL4 and IL13 in the skin decreased after treatment; the thickness of the epidermal layer of the mice decreased after treatment, the infiltration of inflammatory cells in the dermis decreased, and the liquefactive degeneration of dermal edema was alleviated; the NMBR inhibitor reduced the infiltration of macrophages and M2 macrophages. Therefore, the NMBR antagonist is expected to become a new method for treating atopic dermatitis.
[0040] The above are only the preferred embodiments of the present invention and are not used to limit the patent scope of the present invention. For those skilled in the art, various changes and modifications can be made to the present invention. Any modifications, equivalent replacements, improvements, etc. made within the spirit and principle of the present invention shall be included within the protection scope of the present invention.
Claims
1. Use of an NMBR antagonist in the preparation of a medicament for treating atopic dermatitis.
2. The application according to claim 1, wherein The NMBR antagonist is the somatostatin octapeptide analogue BIM 23042.
3. The application according to claim 1, wherein The drug exerts its effect by inhibiting NMBR-mediated Ca 2+ release and NF-κB activation.
4. The application according to claim 1, characterized in that, The medicament can reduce the transcriptional levels of IL-4 and IL-13 in skin tissues.
5. The application according to claim 1, characterized in that, The dosage form of the medicament is a pharmaceutically acceptable dosage form.
6. A pharmaceutical composition for treating atopic dermatitis, characterized in that, The pharmaceutical composition is prepared from an NMBR antagonist and its pharmaceutically acceptable salt as active ingredients, plus pharmaceutically acceptable excipients.
7. Use of the pharmaceutical composition according to claim 6 in the preparation of a medicament for treating atopic dermatitis.