Regulatory elements and applications of RXFP2, a target gene for hornless goats.

By targeting and knocking out specific expression regulatory elements of the goat RXFP2 gene using the CRISPR-Cas9 system, the problems of goat horn-related injuries and management difficulties have been solved, enabling high-welfare breeding of hornless goats and improving economic benefits and genetic optimization.

CN120464625BActive Publication Date: 2026-04-07NORTHWEST A & F UNIV
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202510620087.0
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-05-14
Publication Date
2026-04-07
Estimated Expiration
2045-05-14

AI Technical Summary

Technical Problem

Existing technologies are insufficient to effectively remove goat horns, leading to animal injury, management difficulties, and high medical costs, while there is a lack of high-welfare breeding programs for hornless goats.

Method used

By injecting Cas9 protein and sgRNA into goat zygotes using the CRISPR-Cas9 system, the specific expression regulatory element of the RXFP2 gene was knocked out. The sequence of the regulatory element is SEQ ID No.1, which specifically knocked out the expression of the RXFP2 gene in the horn tissue.

Benefits of technology

Successfully preparing hornless goat embryos enables non-surgical, low-cost hornless breeding, improving animal welfare and economic benefits, optimizing genetic characteristics, and promoting precision and sustainable development in animal husbandry.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure HDA0005402251780000011
    Figure HDA0005402251780000011
  • Figure HDA0005402251780000012
    Figure HDA0005402251780000012
  • Figure HDA0005402251780000021
    Figure HDA0005402251780000021
Patent Text Reader

Abstract

This invention discloses a specific expression regulatory element for the hornless target gene RXFP2 in goats and its application. The sequence of the regulatory element is SEQ ID No. 1. Through single-cell gene expression and chromatin accessibility analysis of fetal bovine horn bud tissue, this invention discovered a specific, open regulatory element (chr12:29279059-29279559) upstream of RXFP2 in horn bud tissue. This element possesses a binding motif for RUNX2, a core transcription factor promoting osteoprogenitor cell differentiation, and is highly conserved in horned animals. Its location in the goat genome is chr12:57440948-57441449. Dual-luciferase assays verified that this regulatory element mediates the interaction between transcription factors RUNX2 and RXFP2, achieving specific high expression of RXFP2 in horn bud tissue. By knocking out the regulatory element region (chr12:57440800-57441678) in goat embryos using CRISPR-Cas9, goat embryos with gene-edited knockout of the hornless target gene RXFP2 specifically expressing regulatory elements were successfully prepared. This invention further elucidates the origin, evolution, and skin ossification mechanisms of horn organs, providing new targets for hornless livestock breeding.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The application belongs to the field of genetic engineering, and particularly relates to a specific expression regulatory element of a goat hornless target gene RXFP2 and application. BACKGROUND

[0002] Horns are a unique feature of bovids (such as cattle, sheep, deer, etc.), which are formed by the fusion of skin, bone, and nerve tissues. The evolution of horns may be related to defense, mating competition, or territory disputes, giving animals an advantage in survival in specific environments. However, in modern farming industries, the horn tissue of goats poses a problem for large-scale breeding. The injuries caused by horn fighting pose a risk of group fighting. At the same time, the goat horns may get stuck in equipment or enclosures, increasing the difficulty of daily management and transportation operations, and the rate of accidental incidents is relatively high. Therefore, many farms surgically remove the horns of goats. Hornless goats have a lower injury rate, reduced medical expenses, and lower breeding costs, which can bring higher economic benefits. From the perspective of animal welfare, the significance of breeding hornless goats lies in their avoidance of the pain of horn removal surgery, which meets the ethical requirements of modern animal husbandry for animal welfare. By breeding hornless goats, genetic characteristics can be optimized, production performance and adaptability of the population can be improved, and support can be provided for the sustainable development of animal husbandry. With the development of genomics, the mining of candidate genes for hornlessness traits has attracted attention, and the application in the field of hornless livestock breeding needs to be explored and broken through.

[0003] In the origin of new organs, existing genes may be "recruited" from the original functional region to the new development process. For example, RXFP2 is recruited from testicular tissue to horns and antlers, and is highly expressed in the horn bud tissue of fetal sheep. There are hornless sheep variants in sheep, and through whole genome analysis of hornless sheep variants, it is found that RXFP2 is a key gene for regulating the development of sheep horns, and genetic variations in the 3'UTR region are closely related to the horn phenotype. A SNP site related to the hornless trait is identified in the 3'UTR region of the RXFP2 gene, and it is found that hornless sheep have a specific 1833bp insertion mutation in this region, which shows a stable genotype-phenotype correlation in different sheep breeds. Re-sequencing of 89 Chinese sheep individuals combined with gene expression analysis confirms that the RXFP2 gene also controls the horn type and size of sheep. Therefore, RXFP2 gene regulates the presence or absence of sheep horns, horn size, and horn type, which indicates that RXFP2 plays an extremely important role in the regulation of horn development.

[0004] The role of RXFP2 in bone metabolism is closely related to its ability to regulate osteoblast differentiation, which enhances the expression of the key transcription factor RUNX2 in osteoblasts. As a core regulator of osteogenic differentiation, RUNX2 can induce the expression of osteogenic markers such as alkaline phosphatase and osteocalcin, and promote collagen deposition to provide a matrix for hydroxyapatite crystallization, ultimately driving the formation of mineralized nodules. Overexpression of RXFP2 in a mouse preosteoblast cell line can increase the level of RUNX2 mRNA by 2.1 times, and significantly increase the number of mineralized nodules; while knockdown of RXFP2 can reduce the mineralized area to 30% of the control group. The above studies show that RXFP2-RUNX2 interacts during osteogenesis, but the specific regulatory mechanism is not clear. The study of the RXFP2-RUNX2 regulatory network can not only reveal the molecular driving mechanism of natural selection for bone morphological diversity, but also show transformation potential in multidisciplinary intersection, which will open up new paths for bone disease treatment and biomaterial innovation. SUMMARY

[0005] Based on the above reasons, the present application provides a goat hornless target gene RXFP2 specific expression regulatory element and its application. Specifically, in order to achieve the purpose of the present application, the present application adopts the following technical solutions:

[0006] One aspect of the present application relates to a goat hornless target gene RXFP2 specific expression regulatory element, the sequence of which is SEQ ID No. 1, specifically:

[0007] ATGGATGCCTTGCTCACGAGTCTGTGGGTCATGTGTGGCTCTTCTGGGCTCAGCTGGGCTCAGGTTCAAGCCTGCTGCACGTGGCTCTCACTCTGGCTAAGGAGTGGGGAAGCCAAGCCACACCACACAAGACATTTAAAGCCTCTCCTGGAATGCGGCACATGCTACTTCTGGTCACATTTTATTGGTCAAGAGGCAAAAATCAGTGCAGCAGAGAAATACACACTCACTATGAGAGGTTCTGCCAAGTCACATGGCAAAATGTGGAACTGAGTGCATAATCCTTTTGCAGACAGTGGAATAATTGGTAATGCTAATCTGATGTACCATAATATCTCTCATATGCGTCTTTTTGGTCTGGCCATGTATGCGTGGCCAGGAGTCTCTCAGTTTCACTCGGGTACAAGAATCAGGTTTACTTTCTTCTGCCATCAGCCTGACTGTGTACTTAGTTGCTCCGCACCATGACATGACTTCTTAATCTCTCAGTTTGTTCTATTCA.

[0008] In another aspect of the present application, the application relates to a method for improving the expression of RXFP2 gene by using the specific expression regulatory element of the goat hornless target gene RXFP2.

[0009] In a preferred embodiment of the present application, the improvement of the expression of RXFP2 gene refers to the improvement of the expression of RXFP2 gene in horn tissue.

[0010] In another aspect of the present application, the application relates to a method for knocking out the specific expression regulatory element of the goat hornless target gene RXFP2 by microinjection of sgRNA and Cas9 protein.

[0011] In a preferred embodiment of the present application, the sequence of the sgRNA is 5'-AGGACGAAAACTAAGGATAT-3' and 5'-GGACTTCTCAACAACAATGA-3'.

[0012] The beneficial effects of the present application are: the present application finds that a kind of horn bud tissue exists in the horn progenitor cell of cattle, which highly coexpresses RXFP2 and RUNX2;Through single cell chromatin accessibility analysis, it is found that there is a potential cis-regulatory element (Cis-Regulatory Element, CRE) upstream of RXFP2. Through transcription factor prediction analysis, it is found that the regulatory element and the upstream and downstream 100bp range contain multiple RUNX2 binding motifs. Double luciferase reporter system verification, the CRE can mediate the spatial interaction of transcription factor RUNX2 and RXFP2 gene, and enhance the transcriptional activity of RXFP2. The CRE is specifically opened in the horn bud tissue, but not in the adjacent skin and testis tissue, and the sequence is highly conserved in horned ruminants such as cattle and sheep, and the sequence comparison goat genome position is chr12:57440948-57441449. Based on this, using CRISPR-Cas9 system, Cas9 protein and sgRNA (upstream 5'-AGGACGAAAACTAAGGATAT-3'(reverse strand);Downstream 5'-GGACTTCTCAACAACAATGA-3'(reverse strand), located in chr12) are directly injected into goat zygote to knockout the regulatory element, and the goat embryo with RXFP2 horn-specific expression CRE (chr12:57440834-57441679) is successfully prepared. The present application not only analyzes the molecular mechanism of the origin and evolution of horn organ, but also through the gene editing technology of targeted regulatory element, converts the theoretical discovery into "non-surgery, high welfare and low cost" molecular breeding scheme of hornless animals, and promotes the transformation of livestock industry to precision and sustainable development. BRIEF DESCRIPTION OF DRAWINGS

[0013] Figure 1 is the identification result of RXFP2 horn-specific expression regulatory element (chr12:29279059-29279559) in fetal cattle horn bud tissue;

[0014] Figure 2 : schematic diagram of fluorescence reporter vector;

[0015] Figure 3 is the double luciferase reporter experiment result for verifying the transcriptional regulation level of RXFP2 horn-specific expression regulatory element;

[0016] Figure 4 : schematic diagram of targeting site;

[0017] Figure 5 : schematic diagram of Cas9 eukaryotic expression vector;SgRNA cloning to expression vector schematic diagram;

[0018] Figure 6 : is the experimental results of sgRNA targeting efficiency of double fluorescence detection knockout goat RXFP2 horn-specific expression regulatory element;

[0019] Figure 7 : SSA reporter vector schematic diagram; detection of Cas9 cleavage efficiency at target site schematic diagram;

[0020] Figure 8 is the preparation and identification results of goat embryos with CRE (chr12: 57440800-57441678) knockout. DETAILED DESCRIPTION

[0021] In order to further understand the present application, the technical solutions in the embodiments of the present application will be described clearly and completely below in combination with the embodiments of the present application. Obviously, the described embodiments are only part of the embodiments of the present application, rather than all the embodiments. Based on the embodiments in the present application, all other embodiments obtained by those of ordinary skill in the art without creative labor fall within the scope of protection of the present application.

[0022] Unless otherwise specified, the reagents involved in the embodiments of the present application are all commercially available and can be purchased through commercial channels.

[0023] (I) Identification of RXFP2 horn-specific expression regulatory element

[0024] 1.100, 150, 200 days three periods of fetal bovine horn bud snATAC-seq and snRNA-seq data pairing

[0025] The R package scMEGA was used to integrate snRNA-seq and snATAC-seq data from horn bud (D100, D150, D200) and the corresponding period. By performing cell pairing, a one-to-one match between snRNA-seq and snATAC-seq data was obtained. This study created a pseudo-panomic dataset to characterize each cell by its gene expression and chromatin accessibility. After that, these cells were reduced dimensionally clustered and cell types were determined.

[0026] 2. Sub-cluster analysis, cell trajectory construction and cell regulatory network construction

[0027] Sub-clustering analysis was performed on all nerve cells and fibroblasts, and their subpopulation time-tracking trajectories were plotted using the AddTrajectory function. scMEGA used chromVAR based on predicted binding sites and chromatin accessibility spectra to estimate the binding activity of each TF and cell along the time-tracking trajectory. “SelectTF” was used to identify functionally relevant TFs in biological processes, and “SelectGenes” was used to identify highly variable genes along the trajectory. scMEGA then predicted enhancer-promoter connections by calculating the correlation between enhancer chromatin accessibility and the expression of nearby genes. Genes significantly associated with at least one enhancer were retained as targets. Finally, a gene regulatory network was constructed by integrating enhancer-promoter connections, predicted transcription factor binding sites, and the correlation between transcription factor activity and target gene expression.

[0028] 3. Peak identification and TF motif analysis of differential peaks

[0029] Peak discovery was performed using MACS2 (version 2.2.7). All peaks were merged into a joint peak set. A counting matrix was constructed using the "addPeakMatrix" function. Peaks could be linked to genes using the addPeak2GeneLinks function, and finally, the JASPAR2020 database was used to enrich the TF motifs of the peaks. Furthermore, identifying commonly accessible peaks in a single cell can be used to infer chromatin spatial organization and interaction patterns. Peak co-accessibility analysis uses peak identification algorithms, such as MACS2, to locate and identify peaks in the chromatin accessibility data for each cell. The location information of these peaks is used to calculate the degree of overlap between peaks to determine peak pairs with co-accessibility in a single cell. A common method is to compare the overlap of peak regions by setting a threshold to determine whether peaks are co-accessible. Finally, analysis can infer chromatin spatial organization and interaction patterns, providing important information for further gene function annotation and regulatory network research. The identification results are as follows: Figure 1 As shown, where, Figure 1 The image above shows the scanning results of the RXFP2 gene's specifically open chromatin regions and binding motifs in keratinogenic progenitor cells. Red markers indicate peaks specifically open in keratinogenic progenitor cells. Four CREs that significantly enhance chromatin accessibility in keratin were identified. The most significant CRE (chr12:29279059-29279559) contains the RUNX2 binding motif. RUNX2 is a core osteogenic regulator in the osteogenic progenitor cell gene regulatory network, and this CRE is inactivated in testicular tissue. Figure 1The following figure is a specific sequence alignment of the RUNX2 binding motif region. Sequence conservation analysis shows that the CRE is specifically conserved in ruminants with head appendages. The above results show that the CRE can mediate the specific expression of RXFP2 in the corneal bone progenitor cells.

[0030] (II) Verification of RXFP2 cornea-specific expression regulatory element

[0031] 1. Construction of regulatory element fluorescence reporter vector

[0032] The sequence chr12:57440448-5744949, chr12:57440948-57441449 (CRE), chr12:57441449-57441949, and the 1000 bp gene fragment upstream of the RXFP2 transcription start site were synthesized based on the goat whole genome sequence published by the database website NCBI as the standard sequence, and then connected to the vector pGL4.10 (Shanghai Shengong Bioengineering Co., Ltd.).

[0033] The recombinant regulatory element fluorescence reporter vector was named RXFP2-enhancer and RXFP2-del-enhancer, respectively. The schematic diagram of the construction of the fluorescence reporter vector is shown in Figure 2 .

[0034] 2. Double fluorescence detection of regulatory element function

[0035] HEK-293T cells (Shanghai Sxyn Biotech Co., Ltd.) and bovine mammary epithelial cells MAC-T (Shanghai Sxyn Biotech Co., Ltd.) were transferred to a 24-well plate at 5 x 10 5 cells per well, and cultured in DMEM medium (Gibco) containing 10% fetal bovine serum (FBS, Gibco). When the cell confluence reached 70%, Lipofectamine 2000 (Invitrogen) was used to transfect the cells with the RXFP2-enhancer and RXFP2-del-enhancer vectors. TM3000Transfection Reagent, Thermo Fisher Scientific) for transfection, the amount of plasmid was pGL4.10 plasmid 0.4 μg per well, pRL-TK (Renilla luciferase reporter vector, Promega) plasmid 0.1 μg per well, RUNX2-pcDNA3.1 plasmid 0.4 μg per well. Group distribution was negative control group for pGL4.10 empty vector and pRL-TK plasmid transfection; positive control group RXFP2-del-enhancer for plasmid RXFP2-del-enhancer and pRL-TK transfection; experimental group RXFP2-enhancer for plasmid RXFP2-enhancer and pRL-TK transfection; positive control group RXFP2-del-enhancer+RUNX2 for plasmid RXFP2-del-enhancer, pRL-TK and RUNX2-pcDNA3.1 transfection; experimental group RXFP2-enhancer for plasmid RXFP2-enhancer, pRL-TK and RUNX2-pcDNA3.1 transfection. Incubate at room temperature for 10 min, change the liquid after 8 h, lyse and collect samples after 48 h, and use the dual luciferase reporter assay kit (TransDetect Double-Luciferase Reporter Assay Kit, Beijing Quanshi Gold Biological Company) for luciferase activity identification. The results are shown in Figure 3 Figure 6, the experimental results show that the transcriptional regulation potential of the CRE is evaluated using a dual luciferase reporter gene detection system in two different cell models (HEK-293T and MAC-T cell lines), and the results show that the luciferase activity of the experimental group RXFP2-enhance is significantly enhanced compared with the positive control group RXFP2-del-enhancer; the luciferase activity of the experimental group RXFP2-enhance+RUNX2 is significantly enhanced compared with the positive control group RXFP2-del-enhancer+RUNX2; the luciferase activity of the experimental group RXFP2-enhance+RUNX2 is significantly enhanced compared with the experimental group RXFP2-enhancer. The above results show that the CRE has significant enhancer activity, mediates the interaction of RUNX2 and RXFP2, and enhances the expression level of RXFP2.

[0036] 1. Target site screening and off-target site prediction

[0037] The specific targeting sequence of the RXFP2 angle-specific expression regulatory element was determined to be chr12:57440948-57441449. Considering that there are still RUNX2 binding motifs upstream and downstream, we screened the targeting sites within 250bp upstream and downstream. The sgRNA was designed using the website CRISPOR (http: / / crispor.tefor.net / ). The sgRNA design of this website is suitable for multiple species genomes, and the off-target effect prediction has MIT score and CFD score. The former is the same as the formula used by the website of statistical Hsu-Zhang score (Concordet et al. 2018; Haeussler et al. 2016), so the MIT score was finally selected for sgRNA screening. Enter the target sequence on the CRISPOR page, select the genome "Capra hircus-goat-RefSeq ARS1", and select the PAM "20bp-NGG-Sp Cas9, SpCas9-HF1, eSpCas91.1". All available targeting sites are obtained. By comparing the targeting efficiency and off-target effect of each sgRNA, the targeting site is screened, such as Figure 4 Figure 1.

[0038] 2. Construction of Cas9 targeting vector and SSA reporter vector

[0039] The full-length of eukaryotic expression vector pSpCas9(BB)-2A-GFP (Cas9 expression vector, Addgene website) is 9289bp. Different sgRNAs can be inserted into the U6 promoter and scaffold structure using BbsI enzyme cutting sites. The specific vector map and the principle of cloning different sgRNAs into the expression vector using BbsI are as follows Figure 5 Figure 2.

[0040] First, synthesize the upstream and downstream sequences of each sgRNA, respectively. After annealing and connecting, different sgRNAs corresponding to different targeting sites are connected to the linear vector using BbsI enzyme cutting sites and DNA ligase Solution I to obtain positive recombinants, which are named pCas9-360 / -353 / -386 / -389 / -1204 / -1083 / -1233 / -1092, respectively.

[0041] The vector pSSA-1-3 (single-stranded annealing reporter vector, Addgene website), 6162 bp in length, is a modified version of pGL3-Control (luciferase reporter vector) used to verify the single-stranded annealing (SSA) mechanism induced after DSB generation. The sequence between the first stop codon and EcoRI is replaced with sgRNA, allowing it to be recognized and cleaved by Cas9, resulting in a double-strand break. Cells then recover luciferase gene expression through the single-stranded annealing repair mechanism, enabling the vector to catalyze the substrate reaction and generate fluorescence. Higher Cas9 protein cleavage efficiency at different target sites and more frequent SSA repairs result in stronger cell fluorescence. The cleavage efficiency of the sgRNA relative to the corresponding Cas9 protein can be estimated by detecting the final fluorescence intensity. The vector map of the SSA reporter vector and the experimental principle of using the SSA reporter vector to detect the cleavage efficiency of Cas9 protein at different target sites are as follows. Figure 4 As shown.

[0042] Primers were designed, with the universal primer RvP3 for the pSSA-1-3 vector as the upstream primer and the sgRNA and PAM sequences as the downstream primers. The luciferase reporter vector pGL3-Control was used as a template, and the gene was cloned using a premixed enzyme (PrimeSTAR DNA Polymerase, Takara) and ligated into the backbone vector pSSA-1-3, named pSSA-360 / -353 / -386 / -389 / -1204 / -1083 / -1233 / -1092.

[0043] The specific sequences of the amplification primers are as follows:

[0044] LucRep-Forward(5'-CGAAGGTTGTGGATCTGGATACC-3')

[0045] LucRep-Reverse(5'-TAGCTGATGTAGTCTCAGTGAGC-3')

[0046] 3. Dual fluorescence detection of sgRNA targeting efficiency

[0047] Dairy goat mammary epithelial cells were transferred to 24-well plates at a rate of 5 × 10⁵ cells per well. Cell confluence was increased to 70% before being transferred to liposomes (Lipofectamine). TM3000Transfection Reagent, Thermo Fisher Scientific) for transfection, 0.6 μg Cas9 plasmid, 0.2 μg pSSA plasmid, 0.1 μg pRL-SV40 plasmid per well. Incubate at room temperature for 10 min, change the solution after 8 h of treatment, and collect samples after 48 h of lysis. Luciferase activity was identified using a dual luciferase reporter assay kit (TransDetect Double-Luciferase Reporter Assay Kit, Beijing Quanshi Gold Biological Company). The experimental results are shown in Figure 6 Fig. 1, by co-transfecting the SSA reporter vector containing the targeting site and the Cas9 expression vector into cells, the Cas9 nuclease cleaves the targeting site to be evaluated on the reporter vector to produce double-strand breaks (DSBs). The repeated sequences upstream and downstream of the DSB are repaired by the SSA pathway to produce large fragment deletion and repair the firefly luciferase gene. The vector pRL-SV40 containing the renilla luciferase reporter gene is used as an internal reference to indicate the transfection efficiency. The expression of firefly luciferase gene and renilla luciferase reporter gene was detected by using a dual luciferase reporter system analysis kit, and the cleavage efficiency of Cas9 nuclease at the targeting site was evaluated. The results show that in the dairy goat mammary epithelial cells, Cas-sgRNA2-353 and Cas-sgRNA3-1233 have stronger luciferase activity on the corresponding reporter vector than other vectors, so it is determined that 5'-AGGACGAAAACTAAGGATAT-3' (reverse strand), located in chr12 and 5'-GGACTTCTCAACAACAATGA-3' (reverse strand), located in chr12 are the upstream and downstream targeting sites of the CRE, respectively.

[0048] (Four) Preparation and identification of goat embryos with RXFP2 angle-specific expression regulatory elements knocked out

[0049] 1. Collection and maturation culture of oocytes

[0050] Ovaries collected from the slaughterhouse were placed in physiological saline supplemented with penicillin-streptomycin (PS, Gibco) at a temperature of 20–23°C and transported to the laboratory within 4 hours. The ovaries were washed in preheated PBS (Gibco), and cumulus-oocyte complexes (COCs) were collected under a stereomicroscope and transferred to oocyte-collecting PBS. The COCs were repeatedly washed in PBS to remove impurities surrounding them. COCs with uniform cytoplasm and intact granulosa cells were selected and transferred to oocyte maturation medium (OM). The cells were cultured at 38.5°C in a cell culture incubator with 5% CO2 saturated humidity for 20–22 hours, with 50 COCs cultured per 500 μL of OM.

[0051] 2. In vitro fertilization

[0052] Frozen sperm was thawed in 37°C warm water. After cutting the incision, the semen flowed into PureSperm medium. Cocci cultured for 20 hours were then sequentially transferred into HEPES-TALP and BO-IVF fertilization media. Residual OM culture medium and detached granulocytes around the cocci were gently washed away. The cocci were then transferred into fertilization droplets, with each droplet containing 30 cocci. The sperm density was adjusted to 1×10⁻⁶. 6 Sperm / mL. Gently mix the sperm suspension, add 10 μL of the sperm suspension to a drop of fertilization fluid containing COCs, and incubate in a cell culture incubator for 12 h.

[0053] 3. Injection of fertilized eggs

[0054] Two hours before injection, prepare the operating droplets (SCNT nucleus-free solution), 80 μL each, and cap with mineral oil. The number of droplets is determined based on the experimental group being injected, with two droplets required per group. Equilibrate on a 38.5℃ hot plate. Pre-cool the mixture in a 4℃ centrifuge for 20 min beforehand, and centrifuge the sgRNA and Cas9 protein at 16000g for 30 min at 4℃. Mix the sgRNA and Cas9 protein and adjust their final concentrations to 100 ng / μL with buffer, then incubate at room temperature for 30 min. Prepare the fixation needle and injection needle using a needle grinding and calcining apparatus. The fixation needle has an orifice diameter of approximately 100 μm and is bent at 30°, while the injection needle has a diameter of 5–7 μm and is bent at 25°. After incubation for 10 hours, fertilized eggs were treated with hyaluronidase to remove encapsulated granulosa cells and adherent sperm. The eggs were then washed twice with HEPES-TALP. Eggs with clearly defined polar bodies and uniform cytoplasm were selected and placed in the manipulation solution. A small amount (4–5 μL) of RNP solution was drawn using a micro-sampler and added to the injection needle. The positions of the fixation needle and injection needle were adjusted to secure the fertilized eggs. The injection needle was then used to strike the incision site and smooth the cut surface. Injection was performed using a microinjector. Approximately 50 fertilized eggs were injected each time, with each egg receiving approximately 5 μL of RNP solution.

[0055] 4. In vitro culture

[0056] The injected zygotes were washed 3 times in sof solution (BO-IVC can also be used), placed in BO-IVC droplets and recovered in the incubator for 10 min, and the dead zygotes were discarded. The remaining zygotes were transferred to new BO-IVC droplets and placed in the incubator for continuous culture, the development rate was counted and the editing efficiency was detected, primers were designed at 500 bp upstream and downstream of the knockout fragment, and the goat embryo after knockout and the goat embryo without knockout (control group) were used as templates for gene amplification, respectively, agarose gel electrophoresis was used to observe the band size, the unknocked out fragment should be about 1700 bp, and the knockout fragment should be about 1000 bp, the 1000 bp band was recovered, and the sequencing result was compared with the target sequence. The experimental results are shown in Figure 8 Figure A is the blastocyst development rate after direct injection of sgRNA into goat zygotes, of which 6 out of 36 zygotes developed normally into blastocysts. Figure B is the design of primers at 500 bp upstream and downstream of the target fragment (chr12:57440800-57441678), the control group uses the genomic template extracted from the blood tissue of the blue goat for gene amplification, and the resulting gene fragment should be 1878 bp, and the experimental group uses the zygote after injection of sgRNA as a template for gene amplification, and the resulting gene fragment should be 878 bp. The agarose gel electrophoresis results in the figure show that the control group only has a band of about 1800 bp, and the experimental group has two bands of 1800 bp and 800 bp, proving that it is a heterozygous knockout embryo.

[0057] The above describes the preferred embodiments of the present application, but it is not intended to limit the present application. Those skilled in the art can make improvements and changes to the embodiments disclosed herein without departing from the scope and spirit of the present application.

Claims

1. A specific expression regulatory element of the goat hornless target gene RXFP2, the sequence of which is SEQ ID No.

1.

2. A method for knocking out the specific expression regulatory element of the goat hornless target gene RXFP2 as described in claim 1, wherein gene knockout is performed by microinjection of sgRNA and Cas9 protein, wherein the sequences of the sgRNA are: 5'-AGGACGAAAACTAAGGATAT-3' and 5'-GGACTTCTCAACAACAATGA-3'; the method is not a treatment method.

Citation Information

Patent Citations

  • RXDP2 gene SNP marking composition related to sheep horn phenotype and application thereof

    CN105483125A

  • ShRNA (short hairpin ribonucleic acid) and lentivirus for inhibiting yak RXFP2 gene expression, and construction method and use thereof

    CN109136225A