Preparation and application of diaphorina citri-derived antibacterial peptide DcAMP2

By preparing and applying the antibacterial peptide DcAMP2 from citrus psyllida, the problem of difficulty in preventing and treating citrus Huanglong disease was solved, and a significant inhibitory effect on citrus Huanglong disease and Rhizobacterium Fischer Chinese was achieved.

CN120484085APending Publication Date: 2025-08-15FUJIAN AGRI & FORESTRY UNIV
View PDF 0 Cites 1 Cited by

Patent Information

Application Number
CN202510699670.5
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-05-28
Publication Date
2025-08-15

AI Technical Summary

Technical Problem

The lack of effective antibacterial peptides in the prior art to prevent and control citrus Huanglong bacteria, especially the lack of research on microbial sources from citrus plants or soil, which makes it difficult to effectively control citrus Huanglong disease.

Method used

The antibacterial peptide DcAMP2 from citrus psyllids was prepared and used, and the antibacterial peptide gene of citrus psyllids was amplified by PCR, and the recombinant plasmid was constructed and expressed and purified in E. coli. The purified antibacterial peptide DcAMP2 was obtained, and the injection was used to control citrus trees for the prevention and treatment of citrus Huanglong bacteria.

Benefits of technology

It significantly inhibits citrus Huanglong bacteria and its close bacteria Rhizobium Fischer Chinese, reduces the bacterial titer in citrus trees, and provides an effective means of preventing and treating citrus Huanglong disease.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure FT_1
    Figure FT_1
  • Figure FT_2
    Figure FT_2
  • Figure FT_3
    Figure FT_3
Patent Text Reader

Abstract

The invention belongs to the technical field of plant disease control, and particularly relates to preparation and application of diaphorina citri sourced antibacterial peptide DcAMP2. The amino acid sequence of the antibacterial peptide DcAMP2 is SEQ ID NO. 1, and the nucleotide sequence of the gene for coding the antibacterial peptide DcAMP2 is SEQ ID NO. 2. The prokaryotic expression plasmid is adopted to construct the recombinant plasmid containing the gene encoding the antibacterial peptide DcAMP2, prokaryotic expression of the antibacterial peptide DcAMP2 is achieved, and the method is simple and easy to implement. After being purified, the antibacterial peptide DcAMP2 obtained through prokaryotic expression has an obvious antibacterial effect on a liberobacter asiaticum related bacterium sinorhizobium fredii, and the titer of the liberobacter asiaticum in a sweet orange tree with the liberobacter asiaticum can be obviously reduced.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The invention belongs to the technical field of plant disease prevention and control, and particularly relates to the preparation and application of an antimicrobial peptide DcAMP2 derived from citrus psyllid. Background Art

[0002] Citrus Huanglongbing (Huanglongbing) is one of the most devastating diseases affecting citrus production worldwide. Citrus Huanglongbing, caused by a phloem-restricted bacterium, can infect nearly all citrus varieties. In the field, Huanglongbing is primarily transmitted by the insect vector Diaphorina citri.

[0003] Antimicrobial peptides (AMPs) are widely found in plants, insects, and animals. These peptides typically have a simple amino acid composition, but their unique structure (such as repeated glycine sequences) endows them with excellent antimicrobial activity. AMPs exert their antimicrobial effects by destroying the integrity of bacterial cell membranes or interfering with bacterial metabolic processes, exhibiting broad-spectrum antimicrobial activity against a variety of pathogens (including drug-resistant bacteria). In addition, due to their low toxicity and high stability, AMPs have broad application prospects in medicine, agriculture, and food preservation. Currently, there are few reports on effective antimicrobial peptides targeting citrus Huanglongbing disease. Summary of the Invention

[0004] The purpose of the present invention is to provide a preparation and application of an antimicrobial peptide DcAMP2 derived from citrus psyllid.

[0005] To achieve the above object, the present invention adopts the following technical solutions: A first aspect of the present invention provides an antimicrobial peptide DcAMP2 derived from citrus psyllid, wherein the amino acid sequence of the antimicrobial peptide DcAMP2 is SEQ ID NO.1.

[0006] The second aspect of the present invention provides a gene encoding the antimicrobial peptide DcAMP2, the nucleotide sequence of which is SEQ ID NO.2.

[0007] The third aspect of the present invention provides a method for preparing the antimicrobial peptide DcAMP2, comprising the following steps: (1) amplifying a gene with a nucleotide sequence of SEQ ID NO. 2 from a citrus psyllid by PCR, or artificially synthesizing a gene with a nucleotide sequence of SEQ ID NO. 2; (2) inserting the gene with the nucleotide sequence of SEQ ID NO.2 into a prokaryotic expression plasmid to construct a recombinant plasmid; (3) Escherichia coli was transformed with the recombinant plasmid, and the cells containing the antimicrobial peptide DcAMP2 were collected after induction with IPTG; The nucleotide sequences of the primers for PCR amplification are: DcAMP2-F: 5'-AAATGGGTCGCGGATCCGAATTCATGAAAACTTTGCTAACGCAAGAGGATGC-3', DcAMP2-R: 5'-TGCTCGAGTGC GGCCGCAAGCTTTTTCTTTCCGTACCCATGTCCACCTCC-3'; Wherein, the prokaryotic expression plasmid is pET-28a plasmid; Wherein, the Escherichia coli is E. coli BL21 (DE3).

[0008] Furthermore, the preparation method further comprises resuspending the induced bacteria in PBS, ultrasonically disrupting the bacteria, and centrifuging to obtain a supernatant; and affinity purifying the supernatant with a nickel column to obtain the purified antimicrobial peptide DcAMP2.

[0009] The fourth aspect of the present invention provides the use of the above-mentioned antimicrobial peptide DcAMP2 in preventing and treating citrus Huanglongbing disease.

[0010] The fifth aspect of the present invention provides the use of the above-mentioned antimicrobial peptide DcAMP2 in inhibiting citrus Huanglongbing fungus.

[0011] The sixth aspect of the present invention provides the use of the above-mentioned antimicrobial peptide DcAMP2 in inhibiting Sinorhizobium freundii.

[0012] The significant advantages of the present invention are: The present invention breaks the traditional idea of ​​studying antimicrobial peptides from citrus plant sources or citrus soil microorganisms. After a series of preliminary studies, an antimicrobial peptide sequence derived from citrus psyllid was finally identified. It has been verified that the antimicrobial peptide DcAMP2 provided by the present invention has a significant inhibitory effect on citrus Huanglongbing, and the effect is very obvious. BRIEF DESCRIPTION OF THE DRAWINGS

[0013] Figure 1 Western blot identification and SDS-PAGE detection of the antimicrobial peptide DcAMP2 are shown.

[0014] Figure 2 Shown is the injection of the antimicrobial peptide DcAMP2 into sweet orange seedlings using hanging bags.

[0015] Figure 3 It is a real-time fluorescence quantitative detection of the changes in the content of citrus Huanglongbing bacteria in sweet orange seedlings before and after injection of PBS and antimicrobial peptide DcAMP2.

[0016] Figure 4 This is the result of the inhibition zone experiment of the antimicrobial peptide DcAMP2 on Sinorhizobium fredii.

[0017] Figure 5 This is the result of the inhibition zone diameter of the antimicrobial peptide DcAMP2 against Sinorhizobium favrosii. DETAILED DESCRIPTION

[0018] In order to make the contents of the present invention easier to understand, the technical solutions of the present invention are further described below in conjunction with specific implementation methods, but the present invention is not limited thereto.

[0019] Example 1: 1. Amplification of antimicrobial peptide genes of target species The amino acid sequence of the antimicrobial peptide DcAMP2 is SEQ ID NO. 1 (the complete sequence including the signal peptide is SEQ ID NO. 3), and the nucleotide sequence is SEQ ID NO. 2 (the complete sequence including the signal peptide is SEQ ID NO. 4). PCR amplification was performed using the antimicrobial peptide DcAMP2 gene of Diaphorina citri as the target gene.

[0020] ①Extract total RNA from citrus psyllids and reverse transcribe it into cDNA.

[0021] ② Using the cDNA obtained in ① as a template, perform PCR amplification with primers DcAMP2-F and DcAMP2-R. The PCR amplification system is as follows: 2 μL of cDNA template, 1 μL of 10 μM upstream primer, 1 μL of 10 μM downstream primer, 25 μL of 2× Primer STAR Mix, and 21 μL of ddH2O. The PCR amplification program is as follows: 98°C for 5 min; 36 cycles of 98°C for 20 s, 60°C for 30 s, and 72°C for 24 s; 72°C for 10 min; and storage at 12°C.

[0022] DcAMP2-F: 5'-AAATGGGTCGCGGATCCGAATTCATGAAAACTTTGCTAACGCAA GAGGATGC-3' DcAMP2-R: 5'-TGCTCGAGTGCGGCCGCAAGCTTTTTCTTTCCGTACCCATGTCCACCTC C-3' ③ Recover the target band of the PCR amplification product obtained in step ② using a gel extraction kit. The recovered product and the prokaryotic expression plasmid pET-28a were digested with EcoRI and HindIII, respectively, and then ligated with T4 DNA ligase to obtain the recombinant plasmid pET-28a-DcAMP2. Sequencing confirmed that the recombinant plasmid pET-28a-DcAMP2 was obtained by inserting the antimicrobial peptide DcAMP2 gene into the prokaryotic expression plasmid pET-28a digested with EcoRI and HindIII.

[0023] 2. Prokaryotic expression and purification of antimicrobial peptides ① The recombinant plasmid pET-28a-DcAMP2 was transformed into E. coli BL21 (DE3), and then inoculated into LB liquid medium containing 50 μg / ml kanamycin, and cultured at 37°C and 220 rpm until the OD 600 The value was in the range of 0.6 to 0.8, and the cells were placed on ice for 2 minutes. IPTG was added at a final concentration of 1 mM, and the cells were induced and shaken at 37°C and 220 rpm for 4 to 5 hours. The bacterial solution induced by IPTG was centrifuged at 4000 rpm for 10 minutes, and the bacterial precipitate was collected. The bacterial precipitate was resuspended in 0.5 times the volume of 1×PBS (pH=7.4) and moved to ice for ultrasonic disruption until the solution was clarified. The cells were centrifuged at 12000 rpm for 2 minutes, and the supernatant was collected. The protein expression was detected by SDS-PAGE gel electrophoresis, Coomassie brilliant blue staining, and Western blot. The results showed that the antimicrobial peptide DcAMP2 existed in the supernatant as a soluble protein. After fusing the pET-28a tag, the molecular weight was about 26 kDa ( Figure 1 ).

[0024] ② The supernatant obtained in ① was affinity purified using a nickel column to obtain the purified antimicrobial peptide DcAMP2. Specifically, nickel column affinity purification can be performed according to the following steps: first, equilibrate with an equilibration buffer (50 mM sodium dihydrogen phosphate, 300 mM sodium chloride, balance water; pH = 8.0); then, use a wash buffer (50 mM sodium dihydrogen phosphate, 300 mM sodium chloride, 10 mM imidazole, balance water; pH = 8.0) to elute contaminants; and finally, use a binding elution buffer (50 mM sodium dihydrogen phosphate, 300 mM sodium chloride, 250 mM imidazole, balance water; pH = 8.0) to elute the target protein.

[0025] 3. Antimicrobial Peptide Injection Experiment Preparation of antimicrobial peptide injection: The purified antimicrobial peptide DcAMP2 was prepared into a 1 mg / ml solution with 1×PBS (pH=7.4) and injected into sweet orange trees infected with Candidatus Liberibacter asiaticus by hanging bag infusion ( Figure 2): Use a scraper to scrape off the old skin 10 to 15 cm above the ground on the main trunk of the sweet orange tree, and use an electric drill to drill holes at the peeled area. The size of the infusion hole should match the diameter of the infusion plug. The drill bit should be tilted at a 45-degree angle to the ground. The drilling depth should be about 3 to 4 cm (if the trunk is too thin, the depth should be about half the diameter) to ensure that the drilling depth reaches the phloem of the plant. Use an electric drill to bring out the sawdust and control the infusion speed. The infusion should be completed in 10 to 14 days. The infusion volume for each tree is 300 to 500 mL. The control is a hanging bag infusion injection of an equal volume of 1×PBS (pH=7.4). 20 days after the injection, the main vein DNA was extracted, and the real-time fluorescence quantitative PCR method was used to detect the titer of citrus Huanglongbing disease fungus to detect the amount of bacteria on the leaves of the diseased plants and compare it with that before the injection. The results showed that the titer of citrus Huanglongbing disease fungus in the control group increased significantly, and the titer of citrus Huanglongbing disease fungus in the group treated with antimicrobial peptide DcAMP2 decreased significantly ( Figure 3 ).

[0026] The primer sequences used for real-time fluorescence quantitative PCR are: qCLas16s-F: 5'-TGAGTGCTAGCTGTTGGGTG-3' qCLas16s-R: 5'-CTGCGCGTTGCATCGAATTA-3' qCs18s-F: 5'-AATTGTTGGTCTTCAACGAGGAA-3' qCs18s-R: 5'-AAAGGGCAGGGACGTAGTCAA-3' Example 2: Detection of antimicrobial peptide antibacterial ability by inhibition zone Since the Asian species of the citrus Huanglongbing pathogen (Candidatus liberibacter asiaticus) has not yet been isolated and purified, the antimicrobial peptide DcAMP2 from its closely related bacterium, Sinorhizobium freundii, was tested for its antibacterial effect. Sinorhizobium freundii was obtained from the China General Microbiological Culture Collection Center (CGMCC), strain number ACCC 15067.

[0027] Preparation of antimicrobial peptide solution: The purified antimicrobial peptide DcAMP2 was prepared into a solution with a concentration of 2-3 mg / ml using 1×PBS (pH=7.4).

[0028] Sinorhizobium fredii was cultured in LB liquid medium without antibiotics to an OD of 600At 0.5. Use the bacterial liquid pouring plate method to inject the Chinese rhizobium freundii bacterial liquid into the LB solid culture medium that has been cooled to about 50°C, mix the bacterial liquid and culture medium evenly, pour the plate and let it stand horizontally to solidify. The filter paper is sterilized and dried, soaked in the antimicrobial peptide DcAMP2 solution for 5s (with 1×PBS (pH=7.4) and 50μg / mL kanamycin solution as a control), and then placed in the middle of the test plate (the small white disc in the middle of the plate in the figure is the filter paper), cultured at 28°C for 24h, and the size of the inhibition zone is measured. Use a ruler to measure the diameter of the inhibition zone by taking the average value using the cross-cross method, and the size of the inhibition zone is expressed as the diameter. The results are as follows Figure 4 and Figure 5 As shown, the antimicrobial peptide DcAMP2 has an inhibitory effect on Sinorhizobium favrosii.

[0029] The above description is only a preferred embodiment of the present invention. Any adjustments made according to the scope of the patent application of the present invention should fall within the scope of the present invention.

Claims

1. An antimicrobial peptide DcAMP2 derived from citrus psyllid, characterized by: The amino acid sequence of the antimicrobial peptide DcAMP2 is SEQ ID NO.

1.

2. A gene encoding the antimicrobial peptide DcAMP2 according to claim 1, characterized in that: The nucleotide sequence of the gene is SEQ ID NO.

2.

3. A method for preparing the antimicrobial peptide DcAMP2 according to claim 1, characterized in that: The following steps are involved: (1) amplifying a gene with a nucleotide sequence of SEQ ID NO. 2 from a citrus psyllid by PCR, or artificially synthesizing a gene with a nucleotide sequence of SEQ ID NO. 2; (2) inserting the gene with the nucleotide sequence of SEQ ID NO.2 into a prokaryotic expression plasmid to construct a recombinant plasmid; (3) Escherichia coli was transformed with the recombinant plasmid and the cells containing the antimicrobial peptide DcAMP2 were collected after induction with IPTG.

4. The preparation method according to claim 3, wherein: The nucleotide sequences of the primers for PCR amplification are: DcAMP2-F: 5'-AAATGGGTCGCGGATCCGAATTCATGAAAACTTTGCTAACGCAAGAGGATGC-3', DcAMP2-R: 5'-TGCTCGAGTGCGGCCGCAAGCTTTTTCTTTCCGTACCCATGTCCACCTCC-3'.

5. The preparation method according to claim 3, wherein: The prokaryotic expression plasmid is pET-28a plasmid.

6. The preparation method according to claim 3, wherein: The Escherichia coli is E. coli BL21(DE3).

7. The preparation method according to claim 3, wherein: The preparation method further comprises resuspending the induced bacteria with PBS, ultrasonically disrupting the bacteria, and then centrifuging to obtain a supernatant; and affinity-purifying the supernatant with a nickel column to obtain the purified antimicrobial peptide DcAMP2.

8. Use of the antimicrobial peptide DcAMP2 according to claim 1 in preventing and treating citrus Huanglongbing.

9. Use of the antimicrobial peptide DcAMP2 according to claim 1 in inhibiting citrus Huanglongbing fungus.

10. Use of the antimicrobial peptide DcAMP2 according to claim 1 in inhibiting Sinorhizobium freundii.

Citation Information

Cited By

  • Antibacterial small peptide CsCAPE9 and application thereof in prevention and control of citrus huanglongbing

    CN120865345A