Use of pinus massoniana pmvns2 gene

By cloning the PmVNS2 gene of Masson pine and constructing the plant expression vector 35S::PmVNS2, poplar trees were transformed, which solved the problem of the lack of a genetic transformation system for Masson pine, significantly improved the growth traits and wood quality of poplar trees, and enhanced the efficiency of forest tree breeding.

CN120574880BActive Publication Date: 2026-05-26NANJING FORESTRY UNIV
View PDF 2 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
NANJING FORESTRY UNIV
Filing Date
2025-06-04
Publication Date
2026-05-26

AI Technical Summary

Technical Problem

The lack of a genetic transformation system for Masson pine leads to insufficient verification of the function of its VNS homologous genes and inadequate analysis of its regulatory network, affecting the efficiency of forest tree breeding. Furthermore, the wood traits are easily affected by environmental disturbances, resulting in low efficiency of traditional breeding methods.

Method used

The PmVNS2 gene of Masson pine was cloned, and the plant expression vector 35S::PmVNS2 was constructed. This vector was then transformed into poplar tissues or cells to cultivate transgenic poplar plants with thickened secondary walls. This process increased the expression of genes related to lignin and cellulose synthesis and decreased the expression of genes related to xylan synthesis.

Benefits of technology

It significantly improves the growth traits of poplar, such as tree height, number of roots and secondary cell wall thickness, enhances lignin and cellulose synthesis, improves the growth traits of poplar, provides molecular tools for forest tree breeding, and enhances breeding efficiency.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120574880B_ABST
    Figure CN120574880B_ABST
Patent Text Reader

Abstract

This invention discloses the application of the Masson pine PmVNS2 gene, belonging to the field of plant genetic engineering technology. The invention obtains the Masson pine PmVNS2 gene through cloning, its nucleotide sequence is shown in SEQ ID NO.1, and its expressed protein sequence is shown in SEQ ID NO.2. The invention constructs a plant expression vector 35S::PmVNS2 and transforms it into poplar leaves, cultivating and screening to obtain poplar PmVNS2 transgenic plants. Compared with control plants, the number of roots, plant height, and ground diameter are significantly increased. Real-time quantitative PCR revealed that PmVNS2 significantly promotes the upregulation of expression levels of most key enzyme genes and transcription factor encoding genes in the secondary xylem synthesis of poplar; further scanning electron microscopy results show that the number of secondary xylem cell layers and the cell wall thickness in heterologously expressed transgenic poplar are significantly increased. This invention provides an effective molecular tool and method for improving poplar traits and has broad application prospects.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of plant genetic engineering technology, and more specifically, relates to the application of the PmVNS2 gene of Masson pine. Background Technology

[0002] Masson pine (Pinus massoniana) is a perennial evergreen coniferous tree belonging to the genus Pinus in the family Pinaceae. It is widely distributed in southern my country, including Jiangsu, Anhui, Zhejiang, Hunan, Jiangxi, Fujian, Yunnan, Guizhou, and Guangdong. It is characterized by rapid growth, straight trunk, and tolerance to poor soil, making it a core tree species for afforestation of barren hills and industrial timber production in southern my country. According to the Ninth National Forest Resources Inventory (2014-2018), Masson pine forests cover 8.043 million hectares, with a stock volume of 626 million cubic meters, accounting for 4.47% and 3.67% of the dominant tree species in China's arbor forests, respectively. It ranks sixth in the country in both area and stock volume, providing crucial raw material support for industries such as timber processing, pulp and paper making, and resin extraction. Its wood is widely used in building pile foundations, mine props, wood fiber production and underwater engineering due to its straight grain, long fibers, high hardness and water resistance; by-products such as rosin, tannin and Poria cocos cultivation also have high added value in the pharmaceutical and chemical fields.

[0003] As a typical gymnosperm species, the anatomical structure of Masson pine and the composition of its secondary cell walls (SCWs) and the molecular regulatory mechanisms of their formation are significantly different from those of angiosperm species (such as poplar): (1) At the anatomical level, in the xylem, the main component of wood, Masson pine lacks the characteristic vascular tissue of broad-leaved trees. Water transport and mechanical support functions are undertaken by tracheids, which also have the ability to conduct water, and its fiber length is significantly better than that of broad-leaved trees; (2) At the SCW composition level, the lignin of coniferous wood is mainly composed of guaiacyl (G-type) monomers, while that of broad-leaved wood contains syringyl (S-type) monomers, and there is also significant differentiation in the arrangement pattern of cellulose microfibrils and the type of hemicellulose; (3) At the molecular regulatory level, although both are composed of a two-level master switch system consisting of NAC and MYB family transcription factors, which constitute the core regulatory hub of SCW synthesis. Angiosperms form highly specialized VND-NST / SND-MYB regulatory axes, in which the VND subfamily (e.g., VND7) drives vessel differentiation and PCD, while the NST / SND subfamily regulates fiber thickening and synergistically activates the S-type lignin pathway with MYB58 / 63. However, gymnosperm secondary cell wall synthesis relies on a simplified NAC-MYB regulatory cascade and lacks key enzyme genes for S-type lignin synthesis. Furthermore, the large size of gymnosperm genomes (approximately 25 Gb for the Masson pine genome) and the lack of genetic transformation systems have resulted in insufficient functional validation of VNS homologs and slow progress in elucidating their regulatory networks.

[0004] As a renewable resource, timber, with its cellulose and lignin components, is not only the raw material base for traditional papermaking, construction, and furniture industries, but is also considered an ideal alternative to new biofuels. However, the contradiction between the long growth cycle of trees and the surging demand for industrial raw materials is becoming increasingly prominent, urgently requiring the cultivation of fast-growing, high-quality varieties through genetic breeding. Although Masson pine is a superior timber species, its phenotypic traits are easily affected by the environment, limiting the efficiency of traditional breeding methods. Analyzing the genetic regulation mechanisms of wood traits at the molecular level can significantly improve the efficiency of cultivating high-quality timber species. Summary of the Invention

[0005] In view of the above-mentioned problems in the existing technology, the technical problem to be solved by the present invention is to provide the application of the Masson pine PmVNS2 gene, specifically for the genetic improvement and breeding of poplar.

[0006] To solve the above-mentioned technical problems, the technical solution adopted by the present invention is as follows:

[0007] Application of the Masson pine PmVNS2 gene in promoting secondary cell wall formation in poplar, the nucleotide sequence of the Masson pine PmVNS2 gene is shown in SEQ ID NO.1.

[0008] In some embodiments, the application includes the following steps:

[0009] (1) Construct a vector for the PmVNS2 gene;

[0010] (2) Transform the vector of the PmVNS2 gene into poplar tissues or cells;

[0011] (3) Transgenic poplar plants with thickened secondary walls were obtained through cultivation and screening.

[0012] In some embodiments, the vector is a plant expression vector.

[0013] In some embodiments, the plant expression vector is 35S::PmVNS2.

[0014] The application of the Masson pine PmVNS2 gene in increasing the number of roots, plant height or diameter at ground level in poplar trees, the nucleotide sequence of the Masson pine PmVNS2 gene is shown in SEQ ID NO.1.

[0015] Application of the Masson pine PmVNS2 gene in increasing the number of secondary xylem cell layers in poplar, the nucleotide sequence of the Masson pine PmVNS2 gene is shown in SEQ ID NO.1.

[0016] The application of the Masson pine PmVNS2 gene in increasing the expression levels of MYB transcription factors related to poplar lignite synthesis, cellulose synthesis, or secondary wall formation, wherein the nucleotide sequence of the Masson pine PmVNS2 gene is shown in SEQ ID NO.1.

[0017] In some embodiments, the poplar protoplasm synthesis-related genes are PAL4, C4H2, 4CL5, HCT1, C3H3, CCOAOMT1, CCR2, COMT2, or CAD1; the poplar cellulose synthesis-related genes are CesA2B or CesA3A; and the poplar MYB transcription factors are MYB002, MYB003, MYB020, MYB021, MYB090, MYB128, or MYB158.

[0018] The application of the Masson pine PmVNS2 gene in reducing the expression of genes related to poplar fibrous sugar synthesis, the nucleotide sequence of the PmVNS2 gene is shown in SEQ ID NO.1.

[0019] In some embodiments, the poplar genus polysaccharide synthesis-related gene is GT43B or GT43D.

[0020] Compared with the prior art, the beneficial effects of the present invention are as follows:

[0021] This invention cloned the PmVNS2 gene from Masson pine, used poplar tissue culture seedlings as material, and constructed a plant expression vector 35S::PmVNS2, which was then transferred into poplar leaves. Transgenic poplar PmVNS2 plants were cultivated and screened. Examination revealed that the transgenic plants were significantly taller than the control (CK) plants; the number of roots in the 40-day-old transgenic plants was significantly greater than that in the CK plants; the ground diameter (1 cm above the root) of the 100-day-old transgenic plants was greater than that of the CK plants; the number of secondary xylem cell layers in the 40-day-old transgenic plants was 1.5 times that of the CK plants, and the secondary xylem wall thickness (3.45±0.27 μm) was significantly greater (1.91±0.18 μm) than that of the CK plants; the expression levels of lignin and cellulose synthesis-related genes in the transgenic plants were 2-5 times higher than those in the CK plants, while the expression levels of xylan synthesis-related genes were significantly lower than those in the CK plants, and the expression levels of downstream MYB transcription factors were 2-8 times higher than those in the CK plants. Experiments show that the heterologous expression of the Masson pine PmVNS2 gene provided by this invention in poplar promotes the improvement of poplar growth traits, providing an effective molecular tool and method for improving poplar growth traits, and has broad application prospects. Attached Figure Description

[0022] Figure 1 A diagram showing the expression pattern of the PmVNS2 gene in different tissues of Pinus massoniana;

[0023] Figure 2 This is a graph showing the expression level of the PmVNS2 gene in Masson pine after drought stress.

[0024] Figure 3 Subcellular localization map of the PmVNS2 gene;

[0025] Figure 4 Molecular detection diagram of PmVNS2 transgenic poplar;

[0026] Figure 5 PmVNS2 expression levels in transgenic and CK lines;

[0027] Figure 6 Figures showing plant height and rooting results for the PmVNS2 transgenic line and the CK line;

[0028] Figure 7 Statistical graphs of plant height (a), number of adventitious roots (b), and total root length (c) of PmVNS2 transgenic lines after 40 days;

[0029] Figure 8 Phenotypic diagram of PmVNS2 transgenic lines after transplanting tissue culture seedlings (40 days) for 60 days;

[0030] Figure 9 A statistical chart showing the plant height and ground diameter of the PmVNS2 transgenic line after 60 days of growth following transplanting of tissue culture seedlings (40 days).

[0031] Figure 10 Phenotypic image of paraffin section of stem segment 10-11 of PmVNS2 transgenic line;

[0032] Figure 11 Phenotypic images of the 10th-11th stem segments of the PmVNS2 transgenic line (SEM section).

[0033] Figure 12 This is a graph showing the expression levels of genes related to lignin, cellulose, and xylan biosynthesis in the PmVNS2 transgenic line.

[0034] Figure 13 This is a graph showing the expression levels of the downstream MYB transcription factor in the PmVNS2 transgenic line. Detailed Implementation

[0035] To make the objectives, technical solutions, and advantages of this invention clearer, the invention will be further described below with reference to specific embodiments. Unless otherwise specified, the technical means used in the following embodiments are all conventional means well known to those skilled in the art.

[0036] The plant material used in this invention is poplar tissue culture seedlings, which are grown on WPM rooting medium under the following conditions: 16 hours of light, 8 hours of darkness, and 70% humidity.

[0037] Zero Cloning Kit cloning vector and Trans1-T1 Escherichia coli competent cells were purchased from TransGen Biotech (Beijing) Co., Ltd.

[0038] Agrobacterium strain EHA105 was purchased from Qingke (Beijing) Biotechnology Co., Ltd.

[0039] The overexpression vector pH35GS was stored in the laboratory of Nanjing Forestry University.

[0040] RNAprep Pure Polysaccharide and Polyphenol Plant Total RNA Extraction Kit and Polysaccharide and Polyphenol Plant Genomic DNA Extraction Kit were purchased from Tiangen Biotech (Beijing) Co., Ltd.; AxyPrep TM The DNA Gel Extraction Kit was purchased from AXYGEN (USA); Prime STAR Max DNA Polymerase and Prime Script were also used. TM RTMaster Mix reverse transcription reagent, Power UP TM SYBR Green Master Mix quantitative reagent was purchased from Thermo Fisher Scientific (USA); TIAN pure Midi Plasmid Kit (centrifuge column type) was purchased from Tiangen Biotech (Beijing) Co., Ltd.; One Step Cloning Kit was purchased from Novizan Biotech (Nanjing) Co., Ltd.; XhoI and KpnI-HF enzymes, T4 DNA ligase, and BsaI-HF enzyme were purchased from TaKaRa Biotech (Beijing) Co., Ltd.; other commonly used reagents for molecular experiments.

[0041] Example 1

[0042] 1. Extraction of total RNA

[0043] RNA was extracted from the xylem of developing Pinus massoniana using a polysaccharide and polyphenol plant total RNA extraction kit.

[0044] The experimental steps are as follows:

[0045] Before use, dissolve 1500U of DNase I dry powder in 550μL of RNase-Free ddH2O. Aliquot 10μL of DNase into each tube, mix gently, and store at -20℃. Grind plant tissue into powder rapidly in liquid nitrogen. Add 475μL of lysis buffer SL and 25μL of β-mercaptoethanol, and immediately vortex. Centrifuge at 12000rpm for 2min. Transfer the supernatant to a CS filter column and centrifuge at 12000rpm for 2min. Carefully transfer the supernatant from the collection tube to a new RNase-Free centrifuge tube, avoiding aspirating cell debris. Slowly add 200μL of anhydrous ethanol to the RNase-Free centrifuge tube containing the supernatant and mix thoroughly. Transfer the mixture to an adsorption column CR3, centrifuge at 12000rpm for 15sec, discard the waste liquid, and return the adsorption column CR3 to the collection tube. Add 350 μL of protein-removing buffer RW1 to the adsorption column, centrifuge at 12000 rpm for 15 seconds, discard the waste liquid, and return the adsorption column CR3 to the collection tube. Take 10 μL of DNase I stock solution and put it into a new RNase-free centrifuge tube, add 70 μL of LDD buffer, and mix gently. Add 80 μL of DNase I working solution to the center of the adsorption column CR3 and let it stand at room temperature for 15 min. Add 350 μL of protein-removing buffer RW1 directly to the adsorption column CR3, centrifuge at 12000 rpm for 15 seconds, and discard the waste liquid. Continue to add 500 μL of wash buffer RW (with anhydrous ethanol added), centrifuge at 12000 rpm for 15 seconds, discard the waste liquid, and return the adsorption column CR3 to the collection tube. Repeat the above steps. Centrifuge at 12000 rpm for 2 min, transfer the adsorption column CR3 into a new RNase-Free centrifuge tube, open the cap and let it air dry for 2 min. Then, add 35 μL of RNase-Free ddH2O dropwise to the center of the adsorption membrane and incubate at room temperature for 3 min. (This step is performed on ice.) Centrifuge at 12000 rpm for 1 min and collect the solution into a centrifuge tube. Re-aspirate the solution into the adsorption column CR3, incubate at room temperature for 2 min, and centrifuge at 12000 rpm for 1 min to obtain total RNA.

[0046] Total RNA quality assessment: The concentration and OD of the extracted total RNA were determined using a NanoDrop 2000 spectrophotometer. 260 / OD 280 and OD 260 / OD 230 RNA integrity was determined using 1% agarose gel electrophoresis.

[0047] 2. cDNA synthesis

[0048] Plant total RNA was reverse transcribed into cDNA using the Prime Script RT Master Mix kit.

[0049] The reaction system consisted of: Prime Script RT Master Mix 4 μL, Total RNA (1000 ng) X μL, and RNase-Free ddH2O to a final volume of 20 μL.

[0050] The PCR reaction program was as follows: 37℃ for 15 min; 85℃ for 5 sec. After the reaction, the cDNA product was diluted according to specific requirements and stored at 4℃.

[0051] 3. Primer design

[0052] Specific amplification primers were designed for the PmVNS2 gene sequence in the xylem RNA-seq data of Masson pine. Oligo7 primers were used, with a length of 23-28 nt, GC content of 40%-70%, and an annealing temperature Tm ≥ 60℃. The primer sequences are shown below.

[0053] PmVNS2-F: 5'-ATGAACACGCTATCTCGCGTTCCTC-3',

[0054] PmVNS2-R: 5'-TCATTTTCCTGCAAAGCTCCAGAG-3'.

[0055] 4. Amplification of the target fragment

[0056] Using cDNA from the xylem of Pinus massoniana as a template, the target fragment was amplified using the high-fidelity enzyme Prime STAR Max DNA Polymerase.

[0057] The reaction system is as follows:

[0058] Prime STAR Max pre mix (2×) 25μL PmVNS2-F 1μL PmVNS2-R 1μL cDNA / DNA 1μL <![CDATA[ddH2O]]> 22μL Total volume 50μL

[0059] The reaction procedure is as follows:

[0060]

[0061] PCR amplification products were detected using 1% agarose gel electrophoresis, and single, clear gel bands were recovered for purification.

[0062] 5. Purification and ligation of the target fragment

[0063] Using the gel recovery kit AxyPrep TM The DNA Gel Extraction Kit is used to recover and purify the target fragment. The experimental steps are as follows:

[0064] Add 600 μL of Buffer DE-A to the centrifuge tube containing the gel, mix well, and heat at 75°C, mixing intermittently every 2-3 minutes until the gel block is completely melted. Add 300 μL of Buffer DE-B and 200 μL of isopropanol and mix well. Absorb the mixture and transfer it to a 2 mL centrifuge tube for DNA preparation. Centrifuge at 12000 rpm for 1 minute. Discard the filtrate. Add 500 μL of Buffer W1 and centrifuge at 12000 rpm for 1 minute. Discard the filtrate. Place the preparation tube back into the centrifuge tube, add 700 μL of Buffer W2 (previously mixed with anhydrous ethanol), let stand at room temperature for 3 minutes, centrifuge at 12000 rpm for 1 minute, and discard the filtrate. Repeat the above steps. Place the preparation tube back into the 2 mL centrifuge tube and centrifuge at 12000 rpm for 2 minutes. Place the preparation tube in a brand new 1.5 mL centrifuge tube, open the cap and let it air dry at room temperature for 5 minutes. Add 20 μL of ddH2O to the center of the membrane and let it stand at room temperature for 2 minutes. Centrifuge at 12000 rpm for 1 min. Transfer the centrifuged solution back into the preparation tube and allow to stand at room temperature for 2 min. Centrifuge again at 12000 rpm for 1 min to obtain the purified solution of the target fragment.

[0065] The concentration and purity of the recovered DNA were determined using a NanoDrop 2000c instrument, and then ligated into... For Zero cloning vectors, when the concentration is high, ddH2O can be added to make up the difference. The reaction system is as follows:

[0066]

[0067] The PCR reaction procedure was: 25℃, 15 min. The ligation product was stored at 4℃ for later use.

[0068] Add 5 μL of the ligation product obtained in the previous step to 50 μL of Trans1-T1 competent cells (competent cells have been completely thawed), gently stir to mix, and incubate on ice for 30 min. Heat shock at 42℃ for 1 min, incubate on ice for 2 min, and add to 800 μL of LB liquid medium. Recover at 37℃ and 150 rpm for 60 min. Remove the recovered bacterial culture and centrifuge at 4000 rpm for 5 min. In a clean bench, aspirate 600 μL of the supernatant from the centrifuged bacterial culture. Use a pipette to mix the remaining 200 μL of bacterial culture and add it to LB solid medium resistant to ampicillin (Amp). Spread evenly with a spreader. Invert the container and incubate at 37℃ for 12 h.

[0069] Select appropriately sized single colonies from LB agar plates, and inoculate each colony into 800 μL of Amp-resistant LB liquid medium. Incubate on a temperature-controlled shaker at 250 rpm and 37°C for 4–6 hours. Then, perform bacterial culture analysis.

[0070] The reaction system is as follows;

[0071] 2×Rapid Taq Master Mix 5μL M13F Forward Primer (10μM) 0.5μL M13R Reverse Primer (10μM) 0.5μL bacterial solution 1μL <![CDATA[ddH2O]]> 6μL Total volume 10μL

[0072] The reaction procedure is as follows:

[0073]

[0074] The fragment size of the PCR products was initially determined using 1% agarose gel electrophoresis. Positive bacterial cultures with band positions matching the target fragment were sent to a biotechnology company for sequencing. Based on the sequencing results, the sequence of the target gene was determined as shown in SEQ ID NO.1, with a length of 1062 bp, and named PmVNS2. The protein sequence it expresses is shown in SEQ ID NO.2.

[0075] Example 2

[0076] 1. RNA was extracted from the roots, young stems, needles, megasporophyll cones, microsporophyll cones, cones, and xylem of *Pinus massoniana* using the polysaccharide-polyphenol plant total RNA extraction kit as described in Example 1, and then reverse transcribed into cDNA, as shown in Example 1. Real-time quantitative PCR (RT-qPCR) was used to detect the specific expression of the PmVNS2 gene in different tissues. Each reaction was performed in triplicate, with DDI1 as the internal reference gene. -ΔΔCt The relative expression level was calculated using the following primer sequence:

[0077] qRTPmVNS2-F: 5'-TCCGCAGCTGGAGAGTCCAA-3',

[0078] qRTPmVNS2-R: 5'-AGCTGCTGACTGTGGATTGGC-3'.

[0079] qRTDDI1-F: 5'-GCTGTCTAATATGCGTTCT-3',

[0080] qRTDDI1-R: 5'-GCTTCCTCCAGAGTCAT-3'.

[0081] The qRT-PCR reaction system is as follows:

[0082] PowerUPTM SYBR Green Master mix 5.0μL PCR Forward Primer (10 μM) 0.5μL PCR Reverse Primer (10μM) 0.5μL cDNA 1.0μL <![CDATA[ddH2O]]> 3.0μL Total volume 10μL

[0083] The reaction procedure is as follows:

[0084]

[0085] The results are as follows Figure 1As shown, the PmVNS2 gene is expressed in roots, microsporidioidomycetes, megasporidioidomycetes, young stems, needles, cones, and xylem, with the expression level in roots set as the reference value of 1. The expression level in the xylem is significantly higher than in other tissues, with a relative expression level 6.1 times that in roots; followed by young stems, where the expression level is 3.5 times that in roots. This suggests that this gene likely plays a role in the formation of xylem in Masson pine.

[0086] 2. Thoroughly irrigate 30-day-old *Pinus massoniana* seedlings grown in soil with a 300mM mannitol solution. Collect leaves at 0h, 6h, 12h, 24h, 48h, and 72h, extract RNA, and reverse-engineer it into cDNA. Perform qRT-PCR detection on PmVNS2; primer sequences are shown below:

[0087] qRTPmVNS2-F: 5'-TCCGCAGCTGGAGAGTCCAA-3',

[0088] qRTPmVNS2-R: 5'-AGCTGCTGACTGTGGATTGGC-3'.

[0089] qRTDDI1-F: 5'-GCTGTCTAATATGCGTTCT-3',

[0090] qRTDDI1-R: 5'-GCTTCCTCCAGAGTCAT-3'.

[0091] The qRT-PCR reaction system is as follows:

[0092] PowerUPTM SYBR Green Master mix 5.0μL PCR Forward Primer (10 μM) 0.5μL PCR Reverse Primer (10μM) 0.5μL cDNA 1.0μL <![CDATA[ddH2O]]> 3.0μL Total volume 10μL

[0093] The reaction procedure is as follows:

[0094]

[0095] The results are as follows Figure 2 As shown, the expression level of PmVNS2 continuously increased from 0 to 12 h under drought stress treatment, reaching a peak at 12 h, at which point the expression level of PmVNS2 was 9.46 times that of CK. Subsequently, the expression level began to decline, reaching its lowest value after 72 h of drought treatment, which was 2.11 times that of CK. The results indicate that drought stress can induce the expression of the PmVNS2 gene, suggesting that the PmVNS2 gene may be involved in the response of Masson pine to abiotic stress.

[0096] 3. Using nimble cloning (NC) technology, a fusion expression vector (35S::PmVNS2-GFP) was constructed by combining green fluorescent protein (GFP) carrying the 35S cauliflower mosaic virus (35SCaMV) promoter with PmVNS2 protein. 20bp universal adapters (with stop codons removed) were added to both ends of the specific primers for the PmVNS2 gene. The upstream universal adapter is: agtggtctctgtccagtcct; the downstream universal adapter is: ggtctcagcagaccacaagt. PCR amplification was then performed, and the amplified products were purified using the AxyPrep™ DNA Gel Extraction Kit for further experiments. The primer sequences are shown below:

[0097] qRTPmVNS2-F: 5'-AGTGGTCTCTGTCCAGTCCTATGAACACGCTATCTC GCGTTCCTC-3',

[0098] qRTPmVNS2-R: 5'-GGTCTCAGCAGACCACAAGTTTTTCCTGCAAAGCT CCAGAG-3'.

[0099] The Nimble Cloning reaction is as follows:

[0100] Nimble Cloning system expression vector (20-100)ng Nimble Mix 5μL PCR products (10-50)ng <![CDATA[ddH2O]]> Add to 10 μL Total volume 10μL

[0101] Reaction procedure: 50℃, 1h.

[0102] Transformed into competent Escherichia coli strain Trans1-T1, plated on LB agar containing Amp resistance, and incubated at 37°C for 12 h. Positive colonies were selected for PCR identification and sequencing verification.

[0103] The transient transformation system of *Pinus massoniana* protoplasts, which has been established in the laboratory of Nanjing Forestry University, was adopted. The specific transformation steps are as follows:

[0104] Protoplast isolation: Healthy pine needles grown for approximately 15 days were cut into 0.5-1.0 mm fine strands and immediately transferred to freshly prepared enzymatic hydrolysis solution. Enzymatic hydrolysis was performed at 28°C in the dark for 4-6 hours. The reaction was terminated by adding an equal volume of W5 solution (2 mM MES pH 5.7, 154 mM NaCl, 125 mM CaCl2, 5 mM KCl). The protoplasts were filtered through a 0.75 mm nylon mesh into round-bottom centrifuge tubes using W5 solution and centrifuged at 100 g for 8 min to collect the precipitate. After washing once with W5, the protoplasts were resuspended in MMG solution (4 mM MES pH 5.7, 0.4 M mannitol, 15 mM MgCl2) to a final volume of 8 × 10⁻⁶. 5cells / mL. In the transient transformation experiment, 10 μg of plasmid DNA was added to 100 μL of protoplast suspension, followed by an equal volume of freshly prepared PEG solution (0.2 M mannitol, 100 mM CaCl2, and different concentrations of PEG4000 (20%, 30%, 40%, W / V)). After incubation at room temperature for 30 min, 1 mL of W5 was slowly added to terminate the reaction, and the protoplasts were collected by centrifugation at 150 g for 5 min. The protoplasts were gently resuspended in 100 μL of WI solution (4 mM MES pH 5.7, 0.6 M mannitol, 20 mM KCl) and transferred to a 24-well plate (Falcon) and incubated in the dark at 25 °C for 12–18 h. The results were observed using a Lumen Dynamic Connections fluorescence microscope. The experiment was repeated three times to ensure accuracy.

[0105] The results are as follows Figure 3 As shown, PmVNS2 protein is transiently expressed in the protoplasts of Pinus massoniana needles. The PmVNS2-GFP signal is expressed only in the nucleus, while the control 35S::GFP signal is expressed in the cytoplasm, cell membrane, and nucleus, indicating that PmVNS2 is a nuclear localized protein.

[0106] Example 3

[0107] 1. Construction of overexpression vectors

[0108] The ORF sequence of PmVNS2 was constructed into the overexpression vector pH35GS using a One Step Cloning Kit, resulting in the plant overexpression vector 35S::PmVNS2. The specific steps are as follows: A sterile inoculating loop was used to pick up the pH35GS overexpression vector culture and streak it onto an LB agar plate containing spectinomycin (Spc); the plate was incubated upside down at 37°C for approximately 12 hours, and single colonies were picked, shaken, and then tested for bacterial concentration; positive bacterial cultures were propagated and plasmids were extracted, and the purity and concentration of the plasmids were verified for future use; the pH35GS vector plasmid was linearized using XhoI and KpnI-HF restriction enzymes, and the reaction system is as follows:

[0109] purified pH35GS vector 1μg CutSmart (buffer) 5μL XhoI 2μL KpnI-HF 2μL <![CDATA[ddH2O]]> up to 50μL Total volume 50μL

[0110] The reaction program was: 37℃, 60 min, 65℃, 25 min.

[0111] The enzyme digestion products were detected by electrophoresis on a 1% agarose gel, and then purified using the AxyPrep™ DNAGelExtraction Kit.

[0112] Homologous sequences from both ends of the linearized vector were introduced into the 5' ends of the forward and reverse amplification primers for the target fragment, resulting in amplified samples containing homologous sequences corresponding to the ends of the linearized cloning vector. The primers with adapters added were KpnI-PmVNS2-F and XhoI-PmVNS2-R, with the primer sequences shown below:

[0113] KpnI-PmVNS2-F: 5'-GGGGACTCTAGAATAGGTACCATGAACACGCTATCT CGCGTTCCTC-3',

[0114] XhoI-PmVNS2-R: 5'-CCTCAGCTACTTAAGCTCGAGTCATTTTCCTGCAAA GCTCCAGAG-3'.

[0115] Using PmVNS2 plasmid as a template, the target fragment was amplified with KpnI-PmVNS2-F and XhoI-PmVNS2-R primers and the high-fidelity enzyme PrimeSTAR Max DNAPolymerase, and the amplified product was recovered and purified using the AxyPrep™ DNAGel Extraction Kit.

[0116] The reaction system is as follows:

[0117] PrimeSTAR Max pre mix (2×) 25μL KpnI-PmVNS2-F 1μL XhoI-PmVNS2-R 1μL cDNA / DNA 1μL <![CDATA[ddH2O]]> 22μL Total volume 50μL

[0118] The reaction procedure is as follows:

[0119]

[0120] according to II. For the recombinant reaction, it is recommended to select the optimal amount of the insert fragment. The reaction system is as follows:

[0121] Linearized carrier 200ng Target fragment 30ng 5×CE II Buffer 4μL Exnase II 2μL <![CDATA[ddH2O]]> Up to 20μL Total volume 20μL

[0122] The reaction procedure was as follows: react at 37℃ for 30 min, and immediately place on ice after the reaction. The recombinant plasmid was transformed into competent E. coli strain Trans1-T1, following the specific method described in Example 1. Single clones were selected for bacterial culture testing. Finally, after sequencing verification, positive bacterial cultures of the overexpression recombinant vector with correct insertion direction and sequence were obtained, and the plasmid was extracted for later use. The remaining bacterial culture was stored at -80℃ for later use.

[0123] 2. Transformation of Agrobacterium

[0124] Thaw EHA105 competent cells from a -80°C freezer beforehand, and add at least 100 ng of the recovered and purified 35S::PmVNS2 plasmid. Gently mix and place on ice for 30 min. Quickly freeze in liquid nitrogen for 1 min. Heat shock in a 37°C water bath for 3 min, then quickly place on ice for 1-2 min. Add 800 μL of LB liquid medium. Recover on a temperature-controlled shaker at 28°C and 100 rpm for 3-4 h. Centrifuge at 3000 rpm for 3 min. Aspirate 600 μL of supernatant, mix the remaining bacterial culture by pipetting, and spread evenly on LB solid medium containing kanamycin (Kan, 50 mg / L) + streptomycin (Str, 30 mg / L) using a spreader. Incubate upside down in a 28°C incubator for 30-48 h. Single colonies were picked and placed in 800 μL of LB liquid medium containing Kan (50 mg / L) + Str (30 mg / L), and the bacterial culture was propagated on a temperature-controlled shaker at 28℃ and 250 rpm for 22-24 h. PCR detection of the bacterial culture showed a positive result, and the resulting positive bacterial culture was used as the target seed culture for the genetic transformation experiment.

[0125] 3. Leaf disc method for converting poplar trees

[0126] Take 800 μL of positive bacterial culture and inoculate it into 5 mL of LB liquid medium containing Kan (50 mg / L) + Str (30 mg / L). Propagate on a temperature-controlled shaker at 28℃ and 250 rpm for approximately 12 hours to obtain the seed culture. Add 1 mL of the seed culture to a bottle, add 50 mL of LB liquid medium containing Kan + Str, and propagate the bacterial culture at 28℃ and 250 rpm for approximately 6 hours. In a clean bench, take 100 μL of the bacterial culture to measure the OD600 value; an OD600 of 0.5 is optimal. Aliquot the bacterial culture into 50 mL centrifuge tubes, centrifuge at 5000 rpm and 4℃ for 10 min, discard the supernatant, and collect the bacterial precipitate. Resuspend the bacterial cells in an equal volume (50 mL) of sugar-free MS liquid medium and mix well. Add acetylsuccine (20 μL / mol), and gently shake at 28℃ and 90 rpm for 30-60 min. Poplar tissue culture seedlings with good growth (35-45 days old) were collected. Fully expanded leaves were taken, and wounds were cut along the leaf edges. Some leaves were directly placed into differentiation medium as a positive control group. The remaining leaves were placed in a mixture of bacterial cells and incubated at 28℃ and 90 rpm for 20-30 minutes on a shaker. The leaf trays were removed, and residual bacterial solution was blotted dry with sterile filter paper. The leaves were then transferred to antibiotic-free differentiation medium and incubated together with the positive control group at 28℃ in the dark for 48 hours. The leaf trays were washed three times with sugar-free MS liquid medium containing termetidine (100 mg / L), which inhibits the growth of Agrobacterium. Afterward, the trays were placed in differentiation medium containing 100 mg / L termetidine and cultured under light for 7 days. After 7 days, the medium was replaced with differentiation medium containing 50 mg / L Kan and 100 mg / L termetidine for positive line selection. When resistant adventitious buds emerge from the leaf rosette, these buds are cut off and placed in a seedling growth medium containing Kan (50 mg / L) + Tim (100 mg / L) to promote stem elongation. When the resistant adventitious buds have elongated to about 1 cm, the terminal buds are cut off and transferred to a rooting medium containing Kan (50 mg / L) + Tim (100 mg / L) for selection of resistant plants. All of the above operations are performed in a clean bench.

[0127] 4. Screening of positive plants

[0128] DNA was extracted from transgenic and wild-type (CK) plants using a polysaccharide-polyphenol DNA extraction kit. The experimental steps were as follows: An appropriate amount of plant tissue was added to liquid nitrogen and ground thoroughly. 400 μl of buffer GPS and 10 μl of RNase A (10 mg / ml) were quickly added to the ground powder. After vortexing, the centrifuge tube was placed in a 65°C water bath for 15 min for lysis. During the water bath, the centrifuge tube was repeatedly inverted to mix the sample. 100 μl of buffer GPA was added to the centrifuge tube, and the mixture was vortexed for 1 min. The centrifuge tube was then centrifuged at 12,000 rpm (~13,400 × g) for 5 min. The supernatant was transferred to a CS filter column and centrifuged at 12,000 rpm (~13,400 × g) for 1 min. The filtrate was then transferred to a new centrifuge tube. 500 μl of anhydrous ethanol was added to the new centrifuge tube and mixed thoroughly (flocculation may occur at this point). Transfer the solution and flocculent precipitate obtained in the previous step to the RNase-Free adsorption column CR2. Centrifuge at 12,000 rpm (~13,400×g) for 1 min, discard the waste liquid, and place the RNase-Free adsorption column CR2 back into the collection tube. Add 550 μl of protein removal solution RD to the RNase-Free adsorption column CR2 and centrifuge at 12,000 rpm (~13,400×g) for 1 min. Discard the waste liquid after centrifugation, add 700 μl of wash buffer PW, centrifuge at 12,000 rpm (~13,400×g) for 1 min, discard the waste liquid, and place the RNase-Free adsorption column CR2 back into the collection tube. Repeat the above steps. Place the RNase-Free adsorption column CR2 back into the collection tube, centrifuge at 12,000 rpm (~13,400×g) for 2 min, discard the collection tube, and then transfer the RNase-Free adsorption column CR2 to a new centrifuge tube. Air dry at room temperature for 5-10 min. Add 30 μL of ddH2O to the RNase-Free adsorption column CR2 and incubate at room temperature for 5 min. Centrifuge at 12,000 rpm (~13,400×g) for 2 min and collect the solution into a centrifuge tube. Reabsorb the collected solution into the adsorption column CR2, incubate at room temperature for 3 min, and centrifuge at 12,000 rpm (~13,400×g) for 2 min to obtain genomic DNA.

[0129] Using the 35S::PmVNS2 plasmid as a positive (+) control and CK as a negative (-) control, the vector primer p35Sf3 was used as the upstream primer (5'-AGGAAGGTGGCTCCTACAAATGCCATC-3') and the target gene-specific primer PmVNS2-R (PmVNS2-R: 5'-TCATTTTCCTGCAAAGCTCCAGAG-3') was used as the downstream primer to perform DNA-level PCR detection on the overexpression lines.

[0130] The results are as follows Figure 4As shown, the target band was detected in all eight transgenic lines (T1-T8) and the positive control (+). This preliminarily demonstrates that the exogenous T-DNA carrying the PmVNS2 gene has been successfully integrated into the poplar genomic DNA.

[0131] RNA was extracted from T1-T8 and CK lines using a polysaccharide-polyphenol RNA extraction kit and reverse transcribed into cDNA for qRT-PCR analysis. The transcriptional level of the PmVNS2 gene in overexpressing plants was determined. Primer sequences are shown below:

[0132] qRTPmVNS2-F: 5'-TCCGCAGCTGGAGAGTCCAA-3',

[0133] qRTPmVNS2-R: 5'-AGCTGCTGACTGTGGATTGGC-3';

[0134] EF1α-F: 5'-GGCAAGGAGAAGGTACACAT-3',

[0135] EF1α-R: 5'-CAATCACACGCTTGTCAATA-3'.

[0136] The results are as follows Figure 5 As shown, the expression level of the CK line was set as the reference level (1). PmVNS2 expression was highest in transgenic T7 (597-fold), followed by T1 and T6 (532-fold and 418-fold, respectively). The three transgenic lines with the highest relative expression levels (T1, T6, and T7) and the CK line were selected as materials for subsequent experiments.

[0137] 5. Phenotypic observation of transgenic lines

[0138] 1) Observe and statistically analyze the development of various aspects, including rooting time, number of roots, and plant height. The samples for observation and statistics consisted of transgenic and CK tissue culture seedlings cultured under the same growth conditions. Data measured included plant height, number of lateral roots, maximum lateral root length, and total root length. Five plants were taken from each of the three transgenic lines T1, T6, and T7, and CK. Phenotypic data were measured every 10 days for a total of 40 days. Statistical results were analyzed using one-way ANOVA, with different lowercase letters indicating statistically significant differences (P < 0.05).

[0139] The results are as follows Figure 6 and Figure 7As shown, compared with the control (CK) plants, the transgenic lines exhibited significant growth advantages in plant height and root development (including root number and total root length). From 0-20 days, root growth was significantly superior, with the average number of roots and total root length reaching 2.00 times and 2.52 times that of the CK, respectively. During 20-30 days, the total root length of the transgenic lines increased significantly, especially the T7 line (46.73±1.62 cm vs. CK line: 18.83±2.84 cm). During 30-40 days, the number of roots in the transgenic lines was 2.00 times that of the CK, the total root length was 1.83 times that of the CK, and the plant height of the transgenic lines (increasing by 6.68 cm from 10-40 days) was significantly greater than that of the CK line (5.80 cm).

[0140] 2) Subsequently, the bottle openings of the above-mentioned transgenic lines and CK tissue culture seedlings were opened for hardening off in a greenhouse. The culture medium on the roots was washed away with water containing a trace amount of sterilizing agent, and the seedlings were transplanted into sterilized nutrient soil for 60 days of growth. The phenotypic differences in plant height and ground diameter between the transgenic plants and CK were statistically analyzed.

[0141] The results are as follows Figure 8 and Figure 9 As shown, after 60 days of growth in soil pots, the transgenic lines further exhibited enhanced phenotypic advantages: plant height and ground diameter (2.61±0.15 mm vs. CK line: 1.99±0.14 mm) were significantly greater than CK. These results suggest that PmVNS2 may coordinate plant growth by promoting both aboveground development (including plant height and stem radial growth) and root expansion.

[0142] Example 4

[0143] 1. Paraffin sections

[0144] Based on the enhanced radial growth of the stems in PmVNS2-overexpressing plants studied above, we further investigated the regulatory role of PmVNS2 in secondary cell wall formation. Paraffin sections of transgenic lines (T1, T7) and the CK line, grown on MS medium for 40 days, were analyzed. The specific steps are as follows:

[0145] Stem segments from the 10th-11th nodes of transgenic T1, T7, and CK lines were cut into 2mm pieces and fixed for 24 hours in FAA fixative (50% anhydrous ethanol: 38% formaldehyde: glacial acetic acid = 18:1:1). The following treatments were then performed sequentially: 0.5 hours of soaking in distilled water → 40 minutes of soaking in 35% ethanol → Stage I solution (50% distilled water + 40% ethanol + 10% n-butanol) → Stage II solution (30% distilled water + 50% ethanol + 20% n-butanol) → Stage III solution (15% distilled water + 50% ethanol + 35% n-butanol) → Stage IV solution (5% distilled water + 40% ethanol + 55% n-butanol) → Stage V solution (25% ethanol + 75% n-butanol) → Stage VI solution (100% n-butanol). Dehydration was completed by soaking twice, 1 hour each time. After dehydration, the material was immersed in a 1:1 mixture of n-butanol and paraffin for 24 hours, followed by three immersions in pure paraffin solution (each 1 hour apart). The sample was poured into an embedding cassette containing paraffin solution and placed in cold water to rapidly solidify the liquid paraffin for subsequent sectioning. The trimmed paraffin blocks were then serially sectioned, and the resulting serial sections were placed on a slide adhesive. The dewaxing and staining process was as follows: slides were immersed twice in pure xylene (25 minutes each) → 1 / 2 xylene + 1 / 2 ethanol → 100% ethanol → 95% ethanol → 85% ethanol → 70% ethanol → 50% ethanol → 35% ethanol → distilled water (1 minute each) → 1% safranin aqueous solution for 12 hours → distilled water for 5 minutes → 35% ethanol → 50% ethanol → 70% ethanol → 85% ethanol (3 minutes each) → 95% ethanol + 0.1% Fast Green aqueous solution for 30 seconds → pure alcohol twice → 1 / 2 xylene + 1 / 2 ethanol → pure xylene twice (5 minutes each). After mounting, observe under an optical microscope.

[0146] Microscopic observation results Figure 10 This indicates that, compared with the CK strain, the transgenic T1 and T7 strains have approximately 1.5 times more secondary xylem cell layers, and the proportion of medullary cavity and primary xylem is relatively reduced.

[0147] 2. Scanning electron microscopy

[0148] To observe the secondary cell wall thickness of the stems of the T1, T7, and CK lines, the base of the stems of each poplar plant was transversely sectioned and scanned by electron microscopy. The bases of the transgenic and CK lines were transversely sectioned into 5 mm segments and immediately fixed in 4% glutaraldehyde fixative. The samples were dehydrated at the Modern Analytical Testing Center of Nanjing Forestry University, and then cut into ultrathin planes for critical point drying. The dried samples were then mounted on the observation stage and sputtered with gold. Observation was performed using a scanning electron microscope (Quanta 200, USA).

[0149] Further analysis of the ultrastructure of the stem cross-section using scanning electron microscopy (SEM) further indicates that ( Figure 11The xylem cell wall thickness of the transgenic line (3.45±0.27 μm) was significantly different from that of the CK line (1.91±0.18 μm). These tissue morphology and ultrastructure results together indicate that overexpression of PmVNS2 specifically promotes the deposition of the secondary xylem wall.

[0150] Example 5

[0151] 1. Screen for genes related to lignin, cellulose, and xylan biosynthesis in the poplar genome and detect their expression levels in PmVNS2 overexpression lines. Primer sequences are shown below:

[0152] qRTPAL4-F: 5'-GCCCCCTGATCGAAGTGATT-3',

[0153] qRTPAL4-R: 5'-TGGCAATTTCGGCACCTTTG-3';

[0154] qRTC4H2-F: 5'-AAGAGGTTCTGCACACGCAA-3',

[0155] qRTC4H2-R: 5'-AATCCCATGAGTTGCAGCCT-3';

[0156] qRT4CL5-F: 5'-AAATGGCGCAAATGGGGATG-3',

[0157] qRT4CL5-R: 5'-GGGGCAGAGTCTACACACAT-3';

[0158] qRTHCT1-F: 5'-TGCGGAGGAGTTTCACTTGG-3',

[0159] qRTHCT1-R: 5'-GTGTTGAGCTGATCCCTGGT-3'.

[0160] qRTC3H3-F: 5'-GTCAAGCCTGTGAGGTTCCG-3',

[0161] qRTC3H3-R: 5'-GGCAGCAACCTCATCTTCTC-3';

[0162] qRTCCOAOMT1-F: 5'-CATCTTTGTGGATGCTGACA-3',

[0163] qRTCCOAOMT1-R: 5'-GACGGCAGAGAGTGATGCCA-3';

[0164] qRTCCR2-F: 5'-GACCATTGTTGCAGCCCACT-3',

[0165] qRTCCR2-R: 5'-GGTAGGGATGGGGTACTCAG-3';

[0166] qRTCOMT2-F: 5'-AACAGCCATTGAACTCGACC-3',

[0167] qRTCOMT2-R: 5'-GACACCATCCTCGTTCTTGGT-3'.

[0168] qRTCAD1-F: 5'-ACTTGGAGGAGTAGGGCACA-3',

[0169] qRTCAD1-R: 5'-AACAAACTGCAATGGGGCAT-3';

[0170] qRTCesA2B-F: 5'-TGGAGCGGAGTAAGCATTGAG-3',

[0171] qRTCesA2B-R: 5'-TCCAGCAACAACTCCAACGA-3';

[0172] qRTCesA3A-F: 5'-CCAGGCAACCACTATGGAGAA-3',

[0173] qRTCesA3A-R: 5'-ATTAGGCTCACCCTCACGCT-3'.

[0174] qRTGT43B-F: 5'-CCAGCTCCACCAAGCTCTAA-3',

[0175] qRTGT43B-R: 5'-ATGATCCAACTCTGCTTCGGG-3';

[0176] qRTGT43D-F: 5'-CCCCCATCTCACCAAAACGA-3',

[0177] qRTGT43D-R: 5'-CCGTACATAAGTGGGCGTGA-3';

[0178] The results are as Figure 12As shown, the expression levels of lignin biosynthesis-related genes (including CCR2, C3H3, C4H2, 4CL5, COMT2, and HCT1) in transgenic plants were significantly upregulated by 2-5 times compared to CK plants. Simultaneously, the expression levels of key cellulose synthesis enzyme genes CesA2B and CesA3A were also significantly increased, while xylan synthesis-related genes GT43B and GT43D showed a downregulated trend. This indicates that PmVNS2 may regulate secondary wall deposition by synergistically activating lignin and cellulose synthesis pathways and inhibiting xylan formation.

[0179] 2. Detection of the expression levels of MYB transcription factors related to secondary cell wall formation in poplar secondary cell wall overexpression lines. Primer sequences are shown below:

[0180] qRTMYB002-F: 5'-TTCAAAAAGGGCTTGTGGTC-3',

[0181] qRTMYB002-R: 5'-TATTGCCAAGAAGGGAATGC-3'.

[0182] qRTMYB003-F: 5'-CATTCTTGGCAACAGGTGGT-3',

[0183] qRTMYB003-R: 5'-TCGTTTGGTGAGGATGTGGA-3'.

[0184] qRTMYB020-F: 5'-AATGGACAAGGGTGTTGGAG-3',

[0185] qRTMYB020-R: 5'-GACCACCTGTTGCCAAGAAT-3'.

[0186] qRTMYB021-F: 5'-TCCATTTGCATTCCCTTCTC-3',

[0187] qRTMYB021-R: 5'-CCTCCCATGACATCTTTGCT-3'.

[0188] qRTMYB090-F: 5'-GGCCTGCAGAAGATGAGAAG-3',

[0189] qRTMYB090-R: 5'-TCCGGTGAGAAGCAAGAAGT-3'.

[0190] qRTMYB128-F: 5'-TACGAAAGCCTTCAGCACCT-3',

[0191] qRTMYB128-R: 5'-GAAAAAGCTCCCCACGTACA-3'.

[0192] qRTMYB158-F: 5'-GCTTGCCCTAGAGGTCACTG-3',

[0193] qRTMYB158-R: 5'-GGCTATGAGTGCCCATTTGT-3'.

[0194] The expression levels of seven MYB transcription factors associated with secondary cell wall formation (MYB002, MYB003, MYB020, MYB021, MYB090, MYB128, and MYB158) in transgenic lines were significantly higher than those in CK lines. Figure 13 Among them, MYB128 showed the most significant upregulation (>8-fold), and the expression levels of other MYB genes also reached 2-7 times that of the CK lines. This synergistic activation with the MYB regulatory network suggests that PmVNS2 may drive ectopic deposition of secondary walls during wood formation by acting upstream of the NAC-MYB regulatory cascade.

Claims

1. The application of the Masson pine PmVNS2 gene in promoting secondary cell wall formation in poplar, characterized by, The nucleotide sequence of the Masson pine PmVNS2 gene is shown in SEQ ID NO.

1.

2. The application according to claim 1, characterized in that, Includes the following steps: (1) Construct a vector for the PmVNS2 gene; (2) Transform the vector of the PmVNS2 gene into poplar tissues or cells; (3) Transgenic poplar plants with thickened secondary walls were obtained through cultivation and screening.

3. The application according to claim 2, characterized in that, The vector is a plant expression vector.

4. The application according to claim 3, characterized in that, The plant expression vector is 35S::PmVNS2.

5. The application of the Masson pine PmVNS2 gene in increasing the number of roots, plant height, or ground diameter of poplar trees, characterized by, The nucleotide sequence of the Masson pine PmVNS2 gene is shown in SEQ ID NO.

1.

6. The application of the Masson pine PmVNS2 gene in increasing the number of secondary xylem cell layers in poplar, characterized by, The nucleotide sequence of the Masson pine PmVNS2 gene is shown in SEQ ID NO.1.

Citation Information

Patent Citations

  • CN117088952A

  • US20070039070A1