Method for producing sesamin based on recombinant escherichia coli-saccharomycetes step-by-step fermentation

Abstract

The invention provides a method for producing sesamin based on recombinant Escherichia coli-saccharomycetes step-by-step fermentation, and relates to the technical field of bioengineering.The recombinant Escherichia coli heterologously expresses a key enzyme gene for converting eugenol into coniferyl alcohol, and protein coded by the key gene is vanillyl alcohol oxidase. The cheap chemical raw material eugenol can be converted into coniferyl alcohol; the recombinant saccharomyces cerevisiae strain expresses a key enzyme for synthesizing sesamin, namely sesamin synthase CYP81Q1 and guide protein DIR, fermentation liquor of recombinant escherichia coli can be converted into sesamin, 79 mg / L of sesamin is synthesized, and the production cost of sesamin is reduced.

Description

Technical Field

[0001] The invention belongs to the technical field of bioengineering, and in particular relates to a method for producing sesamin based on recombinant Escherichia coli-yeast step-by-step fermentation. Background Art

[0002] Sesamin, a key natural lignan, is a significant natural antioxidant with activity far exceeding that of similar substances. It effectively scavenges free radicals and toxins from the human body and possesses numerous important physiological functions, including antioxidant, anti-tumor, antiviral, and immune-regulating properties. It is a valuable raw material for the food, pharmaceutical, and health supplement industries. However, its low concentration in sesame seeds and leaves, coupled with the high cost of extraction, limits its application.

[0003] Currently, sesamin production relies primarily on extraction from natural plants, but this method has numerous limitations. For one thing, the sesamin content in sesame is very low, and the main domestic source of sesamin is extracted from sesame oil, a complex and costly process. Furthermore, factors such as the plant's growth cycle and geographical environment hinder the achievement of a large-scale, stable supply. Therefore, developing an efficient and sustainable method for producing sesamin is crucial.

[0004] As a green and sustainable production method, microbial fermentation has been widely used in recent years to produce various bioactive substances. Genetically engineering microorganisms to synthesize target products offers a new approach to addressing the shortage of natural products. Summary of the Invention

[0005] To address the above technical problems, the present invention provides a method for producing sesamin based on recombinant Escherichia coli-yeast step-by-step fermentation. By constructing a recombinant Escherichia coli strain for synthesizing coniferyl alcohol and a recombinant Saccharomyces cerevisiae strain for synthesizing sesamin, the inexpensive chemical raw material eugenol is converted into the expensive and scarce natural product sesamin. The yield of synthetic sesamin is 79 mg / L, realizing the first synthesis of sesamin in microbial cells.

[0006] The present invention provides a method for producing sesamin based on recombinant Escherichia coli-yeast step-by-step fermentation, comprising the following steps:

[0007] (1) The AmvaoA gene with the sequence of SEQ ID NO.1 was ligated into the linearized vector pET30a to obtain the recombinant plasmid pET30a-AmvaoA;

[0008] (2) The recombinant plasmid pET30a-AmvaoA obtained in step (1) was transformed into E. coli BL21 competent cells to obtain a recombinant E. coli engineered strain;

[0009] (3) Constructing the LEU-SDIR recombinant plasmid, introducing the SCPR1 gene with the sequence of SEQ ID NO.18 and the SCYP gene with the sequence of SEQ ID NO.16 into the LEU-SDIR recombinant plasmid through the flexible linker sequence GGGS to obtain the recombinant plasmid LEU-SDIR-SCYP-SCPR1, which was then introduced into the wat11 strain to construct the recombinant strain wat11-LEU-DIR-SCYP-SCPR1;

[0010] (5) culturing the recombinant Escherichia coli engineered strain obtained in step (1) in a culture medium containing eugenol as a substrate to obtain a fermentation broth containing coniferyl alcohol;

[0011] (6) The recombinant strain wat11-LEU-DIR-SCYP-SCPR1 of step (4) was inoculated into a LEU-deficient SC culture medium containing 20% ​​galactose for induction culture, and then the fermentation broth of step (5) was added, and sesamin was obtained after co-cultivation.

[0012] Furthermore, the linearized vector pET30a in step (1) is obtained by reverse PCR using primers SEQ ID NO.2 and SEQ ID NO.3.

[0013] Furthermore, in step (3), the construction process of the LEU-SCYP recombinant plasmid is to connect the sequence SEQ ID NO.4 with the vector pESC-LEU; the construction process of the LEU-SDIR recombinant plasmid is to connect the sequence SEQ ID NO.5 with the vector pESC-LEU;

[0014] Furthermore, the dual-gene co-expression vectors LEU-SDIR-SCYP and LEU-SCYP-CPR1 were obtained by subcloning.

[0015] Furthermore, the culture process of the recombinant Escherichia coli engineered strain in step (5) is as follows: the recombinant Escherichia coli engineered strain is inoculated into M9YE medium containing kanamycin resistance, cultured at 37°C until OD600 is 0.6-0.8, and then IPTG is added to induce protein expression at a final concentration of 0.2 mM. When inducing protein expression, the shaker is adjusted to 28°C and 220 rpm. After induction for 16 hours, 25 g / L eugenol is added as a substrate, and fermentation is continued for 96 hours.

[0016] Furthermore, during the induction culture, a heme precursor 5-ALA was added at a final concentration of 1 g / L.

[0017] Furthermore, it also includes liquid phase analysis after co-culture;

[0018] Among them, the conditions for liquid phase analysis are: mobile phase: deionized water A, methanol B;

[0019] Flow rate: 1 mL / min;

[0020] Detection wavelength: 280nm;

[0021] Column temperature: 30°C;

[0022] Chromatographic column: Alphasil ES-C18 column, 4.6 mm × 250 mm;

[0023] The gradient elution program was: 0-3 min A 100%-85%; 3-6 min A 85%-70%; 6-10 min A 70%-55%; 10-20 min A 55%-40%; 20-50 min A 40%-25%.

[0024] Compared with the prior art, the present invention has the following beneficial effects:

[0025] (1) The fermentation substrate eugenol used in the present invention is a natural and inexpensive chemical raw material (about 100-120 yuan / kg), which is often used in the food and cosmetics industries. Vanillyl alcohol oxidase (vaoA) can oxidize a variety of para-substituted phenols, including catalyzing eugenol into coniferyl alcohol. Vanillyl alcohol oxidase from black short stalk enzyme was introduced into Escherichia coli DE3, and the recombinant strain was shaken and fermented to synthesize coniferyl alcohol, the precursor of sesamin; sesamin synthase CYP81Q1 enzyme, the guide protein DIR protein can convert eugenol into sesamin, and in the presence of cytochrome P450 reductase SCPR1, the activity of CYP81Q1 enzyme is enhanced. These three proteins were heterologously expressed in the wat11 strain of Saccharomyces cerevisiae, and the fermentation broth of recombinant Escherichia coli was used as a precursor to synthesize 79 mg / L of sesamin, realizing the synthesis of sesamin in microbial cells for the first time;

[0026] (2) Dirigent protein promotes the formation of pinoresin, the direct precursor of sesamin, by stereoselective dimerization / free radical coupling of two coniferyl alcohol molecules. In the WAT11-LEU-SCYP and WAT11-LEU-SCYP-SCPR1 strains without DIR protein expression, no sesamin expression was detected, while the WAT11-LEU-SCYP-SDIR strain expressing DIR protein was detected to synthesize sesamin.

[0027] (3) The WAT11 strain is a model strain of Saccharomyces cerevisiae W303b-1, in which the endogenous cytochrome reductase SCPR1 is replaced with the endogenous SCPR1 of Arabidopsis thaliana. Therefore, it only needs to express the CYP gene and DIR gene on the plasmid to synthesize sesamin using coniferyl alcohol as a substrate. The SCPR1 and SCYP genes of Arabidopsis thaliana were constructed into a fusion protein using a flexible linker sequence and introduced into the LEU-SDIR plasmid to construct the plasmid LEU-SDIR-SCYP-SCPR1. This plasmid was introduced into the wat11 strain to construct the recombinant strain wat11-LEU-DIR-SCYP-SCPR1. It was found that the sesamin synthesis amount of this recombinant strain was 1.39 times higher than that of the wat11-LEU-SDIR-SCYP strain, which proved that the construction of the CYP-CPR fusion protein can improve the electron transfer efficiency in the catalytic cycle of the CYP enzyme, enhance the expression activity of the CYP enzyme, and increase the synthesis yield of sesamin. BRIEF DESCRIPTION OF THE DRAWINGS

[0028] Figure 1 HPLC profiles of different strains in Example 1;

[0029] Figure 2 This is a graph showing the sesamin synthesis yields of different strains in Example 1;

[0030] Figure 3 1 is the synthesis pathway diagram of sesamin in Example 1. DETAILED DESCRIPTION

[0031] The test materials and formulas to which the present invention is applied are as follows:

[0032] The pET30a plasmid, E. coli BL21 (DE3) strain, and E. coli DH5α strain used in this experiment were maintained by the laboratory of Shenzhen Institute of Frontier Technology, China Agricultural University; the pESC-LEU plasmid and Saccharomyces cerevisiae wat11 strain were donated by Li Wei's group at the Institute of Genomics, Chinese Academy of Agricultural Sciences; the WAT11 Saccharomyces cerevisiae strain was modified from the W303b-1 strain, in which the endogenous cytochrome P450 reductase SCPR1 was replaced with SCPR1 from Arabidopsis thaliana.

[0033] LB medium formula: 10.0 g / L tryptone, 5.0 g / L yeast extract, and 10.0 g / L NaCl. Autoclave at 121°C. Different types of antibiotics can be added according to experimental requirements. The concentrations in the formula refer to the final concentration, the same below.

[0034] LB solid medium formula: 10.0 g / L tryptone, 5.0 g / L yeast extract and 10.0 g / L NaCl, 1.5% agar powder, autoclaved at 121°C.

[0035] M9YE formula: 0.5g / L NaCl, 3g / L KH2PO4, 17.1g / L Na2HPO4·12H2O, 0.24g / LMgSO4, 0.011g / L CaCl2, 1g / L NH4Cl, 2g / L yeast extract, autoclaved at 121°C, and then filtered through a membrane, 4g / L glucose, to control the pH at 7.0.

[0036] YPD liquid medium: Accurately weigh 20.0 g glucose, 10.0 g yeast powder, and 20.0 g peptone, dissolve in 1 L of ultrapure water, sterilize at 115°C for 20 min, and store in aliquots.

[0037] YPD solid medium: Weigh 20.0 g glucose, 10.0 g yeast powder, 20.0 g peptone, and 15 g agar powder, dissolve in 1 L of ultrapure water, sterilize at 115°C for 20 min, and store in aliquots.

[0038] LEU-deficient SD medium: Weigh 14.0 g of powdered LEU-deficient SD induction medium, add 500 mL of deionized water, and sterilize at 115°C. For solid culture medium, add 1.5% agar powder.

[0039] LEU-deficient SD induction medium: Weigh 14.0 g of powdered LEU-deficient SD induction medium (SD / LEU Broth, catalog number PM2201, purchased from Coolaber), add 500 mL of deionized water, and sterilize at 115°C for 20 min. Then, add 25 mL of 40% filter-sterilized D-galactose and 1 g / L 5-ALA.

[0040] Note: The recombinant strain of the present invention can be constructed by the method described in the examples. All the following plasmid construction processes are inverse PCR and do not require enzyme digestion. The relevant gene sequences, vectors and operation steps have been fully disclosed and can be repeated by those skilled in the art without creative work.

[0041] Experimental Example 1

[0042] 1. Construction of a recombinant Escherichia coli strain for heterologous synthesis of coniferyl alcohol

[0043] The vanillyl alcohol oxidase (vaoA) gene sequence SEQ ID NO.1 from AmvaoA melanocarpa (AmvaoA) was optimized and synthesized, and primers pET30a F and pET30a R were designed to linearize the vector pET30a through inverse PCR. Primers AmvaoAF / R were designed to amplify the AmvaoA gene, and the AmvaoA genes were connected separately using the In-Fusion seamless cloning kit to obtain the recombinant plasmid pET30a-AmvaoA. The above plasmids were transformed into Escherichia coli DE3 competent cells by chemical transformation, and the recombinant engineered strains screened for kanamycin resistance were verified to be correct by PCR.

[0044] 2. Construction of a recombinant Saccharomyces cerevisiae strain for heterologous synthesis of sesamin

[0045] The CYP81Q1 and DIR genes from sesame were optimized and synthesized to obtain SCYP and SDIR genes with codon preferences similar to those of Saccharomyces cerevisiae. The SCPR1 gene from Arabidopsis thaliana was obtained using the wat111 strain genome as a template using primers LEU-SSCPR1 F / R.

[0046] The vector pESC-LEU was linearized using primers LEU F / R, and primers LEU-SCYP F / R were designed to amplify the SCYP gene. Primers LEU-SDIR F / R were designed to amplify the SDIR gene. The amplified SCYP and SDIR genes were respectively ligated with the linearized vector pESC-LEU and heat-shock transformed into E. coli DH5α competent cells. The cells were evenly spread on LB solid medium containing Amp resistance and cultured overnight. Single colonies were picked for colony PCR verification. The correct strains verified by PCR were expanded in LB medium with Amp resistance. The successfully constructed LEU-SCYP and LEU-SDIR recombinant plasmids were extracted and sent to Sangon Biotech for sequencing. The correctly sequenced plasmids were introduced into the wat11 strain to construct the recombinant strains wat11-LEU-DIR and wat11-LEU-SCYP.

[0047] The recombinant vector LEU-SCYP was linearized using primers LEU F2 / R2 in the table. The SDIR gene fragment was subcloned into the recombinant vector LEU-SCYP to construct the dual-gene co-expression vector LEU-SDIR-SCYP. The SCPR1 gene fragment was subcloned into the recombinant vector LEU-SCYP to construct the dual-gene co-expression vector LEU-SCYP-SCPR1. This vector was heat-shock transformed into E. coli DH5α competent cells and evenly spread onto LB solid medium containing Amp resistance for overnight culture. Single colonies were picked for colony PCR verification. The strains verified correct by PCR were expanded in Amp medium. The successfully constructed LEU-SDIR-SCYP and LEU-SCYP-SCPR1 recombinant plasmids were extracted and sent to Sangon Biotechnology Co., Ltd. for sequencing.

[0048] The recombinant vector LEU-SDIR was linearized using the primers LEU F3 / R3 in the table. The SCPR1 and SCYP genes of Arabidopsis thaliana were fused into the LEU-SDIR plasmid using the flexible linker sequence GGGS to construct the recombinant plasmid LEU-SDIR-SCYP-SCPR1. The recombinant plasmid was heat-shocked and transformed into E. coli. DH5α competent cells were evenly spread onto LB solid medium containing Amp resistance and cultured overnight. Single colonies were picked for colony PCR verification. The strains verified correct by PCR were expanded in Amp-resistant LB medium. The successfully constructed LEU-SDIR-SCYP-SCPR1 recombinant plasmid was extracted and sent to Sangon Biotechnology Co., Ltd. for sequencing. The correctly sequenced plasmids LEU-SCYP, LEU-SDIR--SCYP, LEU-SCYP-SCPR1, and LEU-SDIR-SCYP-SCPR1 were introduced into the wat11 strain to construct the recombinant strains wat11-LEU-SCYP, wat11LEU-SDIR--SCYP, wat11-LEU-SCYP-SCPR1, and wat11-LEU-SDIR-SCYP-SCPR1, respectively.

[0049] Among them, the preparation and transformation of Saccharomyces cerevisiae competent cells: Use the Competent Cell Preparation and Transformation Kit for Saccharomyces cerevisiae produced by Biyuntian to prepare competent cells and transform plasmids, and operate according to the instructions.

[0050] (1) Bacteria activation:

[0051] Take the glycerol culture of Saccharomyces cerevisiae stored at -80℃ and streak it on YPD plate culture medium, and culture it upside down at 30℃ for 2-4 days to activate the strain.

[0052] (2) Vaccination:

[0053] Use an inoculating loop or sterile pipette tip to pick up a fresh single yeast colony and inoculate it into 10 ml of YPD liquid medium.

[0054] (3) Cultivation:

[0055] Incubate at 28-30°C, 250 rpm overnight.

[0056] (4) Re-inoculation culture:

[0057] Transfer the overnight culture to 50 ml of YPD liquid medium and culture it to an initial OD600 of 0.2-0.3. Incubate at 30°C, 250-300 rpm for 2-3 hours, until the OD600 reaches 0.4-0.6.

[0058] Note: 4 tubes of 100 μl competent cells can be prepared for every 10 ml bacterial solution. The following steps are applicable to 10 ml bacterial solution. The specific amount of competent cells can be prepared according to actual conditions.

[0059] (5) Preparation of competent cells:

[0060] a. When the OD600 of the freshly cultured bacterial solution reaches 0.4-0.6, centrifuge at 3000×g for 3 minutes at room temperature, discard the supernatant, and retain the bacterial cells.

[0061] b. Take 7 ml of Buffer A to fully resuspend the collected bacteria, centrifuge at 3000 × g for 3 minutes at room temperature, discard the supernatant, and retain the bacteria;

[0062] c. Resuspend the cells in 400 μl of Buffer B and incubate at room temperature for 10 minutes. After the 10-minute incubation, the yeast competent cells are ready. Aliquot 100 μl into 1.5 ml sterile centrifuge tubes and proceed with transformation of the yeast competent cells.

[0063] Note: The prepared competent cells are best used immediately. They can also be stored at 4°C for 1 week, but the effectiveness will gradually decrease. Alternatively, glycerol can be added to a final concentration of 15%, mixed, and then frozen at -80°C. They are effective for at least 3 months.

[0064] (6) Transformation of Saccharomyces cerevisiae:

[0065] a. Mix 0.1-1 μg of plasmid DNA and 10 μl of heat-denatured carrier DNA by pipetting, then add to 100 μl of competent cells and flick to mix.

[0066] b. Add 600 μl of Buffer C and mix by inverting. Incubate in a 30°C water bath for 30 minutes.

[0067] c. After the previous step, add 70 μl of DMSO, gently invert and mix, incubate in a 42°C water bath for 15 minutes, and then immediately incubate on ice for 3-5 minutes;

[0068] d. Centrifuge at 12,000-14,000 g for 10 seconds at room temperature, discard the supernatant, and resuspend the cells in 100 μl of Buffer A.

[0069] e. Spread the resuspended bacterial solution onto the corresponding screening medium plate and culture it upside down at 30°C for 2-3 days until single colonies appear.

[0070] 3. Cultivation of recombinant strains and induced gene expression

[0071] Inducible expression of recombinant E. coli:

[0072] (1) Take 100 μL of E. coli DH5α competent cells and place them on ice to thaw. After the cells are completely thawed, add the target recombinant plasmid to the competent cells and mix gently. Then place on ice for 30 minutes to allow the recombinant plasmid to fully contact with the competent cells.

[0073] (2) Rapidly transfer the ice-bathed centrifuge tube to a 42°C water bath and heat shock for 45-60 seconds. After the heat shock is complete, immediately place the centrifuge tube back on ice and let it stand for 2-3 minutes to ensure that the cells can adapt to the rapid temperature change and maintain their physiological activity.

[0074] (3) Add 1000 μL of LB medium without antibiotics to the heat-shocked and cooled cells and mix gently. Place the centrifuge tube in a shaker at 37°C and 220 rpm for 1 hour to allow the E. coli cells to recover from the stress of heat shock treatment and resume normal growth and metabolism.

[0075] (4) The revived E. coli cells were centrifuged at 12,000 g for 1 minute to precipitate the cells. An appropriate amount of the cell precipitate was carefully aspirated and evenly spread on a plate containing kanamycin-resistant LB solid culture medium until the liquid on the surface of the plate was completely absorbed. The plate was inverted and placed in a bacterial incubator at 37°C for overnight culture. The next day, single colonies were selected from the plate and verified using PCR technology. For colonies with correct PCR verification results, a special kit was used to extract the plasmids therein. The extracted plasmids were transformed into competent E. coli BL21 (DE3) to obtain expression strains for subsequent experiments.

[0076] (5) The expression strain obtained in step (4) was inoculated into LB liquid medium containing kanamycin resistance and cultured at 37°C for 12-16 hours. After the culture was completed, the bacterial solution was appropriately diluted and then spread on an LB solid plate containing kanamycin resistance and cultured again at 37°C overnight. The next day, clones were selected from the solid plate and inoculated into LB liquid medium containing kanamycin resistance and cultured at 37°C for another 12-16 hours to obtain activated seed liquid;

[0077] (6) Shake flask fermentation and induction: The activated seed liquid was inoculated into 50 mL of kanamycin-resistant M9YE medium at a ratio of 1:100, and the culture was shaken at 37°C and 220 rpm until the OD600 was between 0.6 and 0.8. IPTG was added to a final concentration of 0.2 mM for induction. When inducing protein expression, the shaker was adjusted to 28°C and 220 rpm. After 16 hours of protein expression, 25 g / L eugenol was added as a substrate to continue fermentation. The fermentation was terminated after 96 hours of fermentation. The yield of coniferyl alcohol was 9.83 g / L, and the fermentation product was used as a precursor for synthesizing sesamin.

[0078] 4. Induced expression and product determination of yeast engineering bacteria

[0079] (1) Pick a single colony that has been successfully verified by colony PCR and inoculate it into 5 mL of LEU-deficient SD liquid medium containing 20% ​​glucose and incubate at 30°C and 220 rpm for 24 h. Then transfer the inoculum to 20 mL of LEU-deficient SD liquid medium containing 20% ​​glucose at a rate of 5.0% and incubate it in a shaker at 30°C and 220 rpm for 36 h.

[0080] (2) Centrifuge the cells at 5000 rpm for 5 min at 4°C and carefully discard the supernatant.

[0081] (3) Add 20 mL of ultrapure water to wash the cells, centrifuge at 5000 rpm at 4°C for 10 min, and discard the supernatant;

[0082] (4) Repeat step (3) three times to wash the cells to remove as much glucose as possible;

[0083] (5) Resuspend the cells in 50 mL of LEU-deficient SD liquid medium containing 20% ​​galactose, adjust the OD600 to 0.4-0.6, and add the heme precursor 5-ALA according to the experimental requirements.

[0084] (6) After the yeast strain was induced and cultured in a shaker at 28°C for 48 hours, 5 mL of recombinant Escherichia coli fermentation broth was added to the reaction system, and then cultured for 72 hours at 28°C and 220 rpm. 96 hours after the addition of the substrate, 1 mL of bacterial solution was taken from the reaction system, 1 mL of liquid-grade methanol was added, and the mixture was vortexed and extracted for 10 minutes. The supernatant was centrifuged at 12,000 rpm for 5 minutes, and the supernatant was aspirated and filtered through a 0.22 μm membrane for liquid phase analysis. The liquid phase analysis conditions were the same as those of the Figure 1 What is shown is consistent with what is described.

[0085] Through the above experiments, the inventors constructed a recombinant Escherichia coli strain that synthesizes coniferyl alcohol and a recombinant Saccharomyces cerevisiae strain that synthesizes sesamin, respectively. They converted the inexpensive chemical raw material eugenol into the expensive and scarce natural product sesamin, achieving a yield of 79 mg / L of synthesized sesamin, achieving the first-ever synthesis of sesamin in microbial cells.

[0086] like Figure 1 As shown, Dirigent protein promotes the formation of pinoresin, the direct precursor of sesamin, by stereoselective dimerization / radical coupling of two coniferyl alcohol molecules. In the WAT11-LEU-SCYP and WAT11-LEU-SCYP-SCPR1 strains without DIR protein expression, no sesamin expression was detected, while the WAT11-LEU-SCYP-SDIR strain expressing DIR protein detected the synthesis of sesamin.

[0087] like Figure 2 The WAT11 strain is a model strain derived from Saccharomyces cerevisiae W303b-1, in which the endogenous cytochrome reductase SCPR1 is replaced with the endogenous SCPR1 from Arabidopsis thaliana. Therefore, simply expressing the CYP and DIR genes on plasmids allows sesamin synthesis using coniferyl alcohol as a substrate. A fusion protein of the Arabidopsis SCPR1 and SCYP genes was constructed using a flexible linker sequence and introduced into the LEU-SDIR plasmid, resulting in the construction of the plasmid LEU-SDIR-SCYP-SSCPR1. This plasmid was then introduced into the wat11 strain to create the recombinant strain wat11-LEU-DIR-SCYP-SCPR1. This recombinant strain synthesized 1.39-fold more sesamin than the wat11-LEU-SDIR-SCYP strain, demonstrating that the construction of the CYP-CPR fusion protein improves the efficiency of electron transfer in the CYP enzyme catalytic cycle, enhances CYP enzyme expression activity, and increases sesamin synthesis yield.

[0088] Among them, the synthesis pathway of sesamin is as follows Figure 3 shown.

[0089] Among them, the primers used in the experimental example are shown in Table 1:

[0090] Table 1

[0091]

[0092] AmvaoA: SEQ ID NO.1:

[0093]

[0094]

[0095] SDIR SEQ ID NO.17:

[0096] tggccactaagacccaagccgccgccttgttgttgtgcttgttgatttccacctcctccccaaccgcttactccagaaagccaagaagaagatccccatgcagagaattaactttctttttccatgatgttttgtttaatggtcataattatcataatgctacttctgctattgttggttcaccacaatggggtaataagactgctgttgctaaaccatataattttggagatgttgttgtctttgatgacccaattaccgttgataataattttcatgg tgctccagttggtagagctcaaggtatgtacttatatgatcaatggtctacatatggtgcttggttgggtttttctttcttgtttaattcgactgaatatgttggtactttaaattttgctggtgctgatccattgatgaacaaaactagagatatttctgttattggtggtactggtgaattctttatggctagaggtattgctactttgtcaactgatgcttatgaaggtgacgtttattttagattaagagttgatattcaattatatgaatgttgg

[0097] SCPR1 SEQ ID NO.18:

[0098]

[0099] The embodiments described above are merely descriptions of preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Without departing from the spirit of the present invention, various modifications and improvements made to the technical solutions of the present invention by persons skilled in the art should fall within the scope of protection defined by the claims of the present invention.

Claims

1. A method for producing sesamin based on recombinant Escherichia coli-yeast step-by-step fermentation, characterized in that: The following steps are involved: (1) The AmvaoA gene with the sequence of SEQ ID NO.1 was ligated into the linearized vector pET30a to obtain the recombinant plasmid pET30a-AmvaoA; (2) The recombinant plasmid pET30a-AmvaoA obtained in step (1) was transformed into E. coli BL21 competent cells to obtain a recombinant E. coli engineered strain; (3) Constructing the LEU-SDIR recombinant plasmid, introducing the SCPR1 gene with the sequence of SEQ ID NO.18 and the SCYP gene with the sequence of SEQ ID NO.16 into the LEU-SDIR recombinant plasmid through the flexible linker sequence GGGS to obtain the recombinant plasmid LEU-SDIR-SCYP-SCPR1, which was then introduced into the wat11 strain to construct the recombinant strain wat11-LEU-DIR-SCYP-SCPR1; (5) culturing the recombinant Escherichia coli engineered strain obtained in step (1) in a culture medium containing eugenol as a substrate to obtain a fermentation broth containing coniferyl alcohol; (6) The recombinant strain wat11-LEU-DIR-SCYP-SCPR1 of step (4) was inoculated into a LEU-deficient SC culture medium containing 20% ​​galactose for induction culture, and then the fermentation broth of step (5) was added, and sesamin was obtained after co-cultivation.

2. The method according to claim 1, characterized in that In the step (1), the linearized vector pET30a is obtained by reverse PCR using primers SEQ ID NO.2 and SEQ ID NO.

3.

3. The method according to claim 1, characterized in that The construction process of the LEU-SDIR recombinant plasmid in step (3) is to connect the sequence SEQ ID NO.5 with the vector pESC-LEU.

4. The method according to claim 1, wherein The culturing process of the recombinant Escherichia coli engineered strain in step (5) is as follows: the recombinant Escherichia coli engineered strain is inoculated into M9YE medium containing kanamycin resistance, cultured at 37°C until OD600 is 0.6-0.8, and then IPTG is added to induce protein expression at a final concentration of 0.2 mM. When inducing protein expression, the shaker is adjusted to 28°C and 220 rpm. After 16 hours of induction, 25 g / L eugenol is added as a substrate, and fermentation is continued for 96 hours.

5. The method according to claim 1, wherein During the induction culture, the heme precursor 5-ALA was added at a final concentration of 1 g / L.

6. The method according to claim 1, characterized in that It also includes liquid phase analysis after co-culture; Among them, the conditions for liquid phase analysis are: mobile phase: deionized water A, methanol B; Flow rate: 1 mL / min; Detection wavelength: 280nm; Column temperature: 30°C; Chromatographic column: Alphasil ES-C18 column, 4.6 mm × 250 mm; The gradient elution program was: 0-3 min A 100%-85%; 3-6 min A 85%-70%; 6-10 min A 70%-55%; 10-20 min A 55%-40%; 20-50 min A 40%-25%.

Images