Streptomyces Targetron gene targeting vector as well as construction method and application thereof
By codon optimization and promoter-driven expression of the Ll.LtrB intron-encoding protein gene ltrA, combined with overexpression of RecX, a Streptomyces Targetron gene targeting vector was constructed, which solved the problem of low gene targeting efficiency in Streptomyces with high GC content and achieved the screening and activation of Streptomyces secondary metabolites.
Patent Information
- Application Number
- CN202410300962.2
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2024-03-15
- Publication Date
- 2025-09-16
AI Technical Summary
The existing type II intron Ll.LtrB has low gene targeting efficiency or is difficult to achieve target screening in Streptomyces with high GC content, and has not been widely used in Streptomyces.
A Streptomyces Targetron gene targeting vector was constructed. By codon-optimizing the protein gene ltrA encoded by the Ll.LtrB intron, and driving expression using Streptomyces constitutive and thiostrepton-inducible promoters, overexpression of RecX was combined to inhibit RecA-dependent homologous recombination, thereby improving transformation efficiency and targeting efficiency.
Gene targeting was successfully achieved in Streptomyces, and the red pigment biosynthesis gene cluster in Streptomyces roseosporus was screened and the expression of jedomycin was activated in Streptomyces venezuelae, which improved the conversion rate and targeting efficiency and simplified the process of constructing the gene mutation library.
Smart Images

Figure HDA0004743781330000011 
Figure HDA0004743781330000012 
Figure HDA0004743781330000021
Abstract
Description
Technical Field
[0001] The present invention relates to the field of biotechnology, in particular to a Streptomyces Targetron gene targeting vector and a construction method and application thereof. Background Art
[0002] Group II introns are a class of mobile genetic elements with the ability to self-splice. They are found in bacterial genomes, as well as in the chloroplasts and mitochondrial genomes of fungi, plants, and protists. Group II introns consist of catalytically active intronic RNA and intron-encoded proteins. Intronic RNA can bind to intron-encoded proteins to form ribonucleoproteins, which recognize and cleave DNA target sites. The intronic RNA is then reverse-transcribed into cDNA using the intronic RNA as a template. Cells then use the cDNA as a template to synthesize complementary DNA, thereby inserting the intronic RNA into the DNA target site, achieving intron "homing." Because group II intron recognition of DNA target sites depends primarily on complementary base pairing between the intronic RNA and the DNA target site, designing the intronic RNA recognition sequence can enable intron recognition and "homing" to different target sites.
[0003] The Ll.LtrB intron from Lactococcus lactis has been developed into a highly efficient gene targeting system, Targetron, due to its high homing efficiency. This system has been widely used in various Gram-positive and Gram-negative bacteria. However, no such tools have been developed for Streptomyces. Summary of the Invention
[0004] The purpose of the present invention is to provide a Streptomyces Targetron gene targeting vector and its construction method and application.
[0005] Since the type II intron Ll.LtrB is derived from Lactococcus lactis with low GC content, the gene targeting efficiency of Ll.LtrB intron is low or it is difficult to achieve target screening in Streptomyces with high GC content.
[0006] In a first aspect, the present invention provides a method for constructing a Streptomyces Targetron gene targeting vector, comprising the following steps:
[0007] (1) The type II intron Ll.LtrB from Lactococcus lactis was cloned into the Escherichia coli-Streptomyces shuttle plasmid to obtain a recombinant plasmid;
[0008] Among them, the DNA sequence encoding the intron RNA in the group II intron Ll.LtrB and the intron-encoding protein gene ltrA are driven by a Streptomyces constitutive promoter and a thiostrepton-inducible promoter, respectively, and the gene ltrA is a gene optimized according to the codon preference of Streptomyces;
[0009] (2) The Streptomyces gene recX is cloned into the recombinant plasmid obtained in (1) to obtain the Streptomyces Targetron gene targeting vector.
[0010] Preferably, the E. coli-Streptomyces shuttle plasmid in (1) is pKC1139.
[0011] The nucleotide sequence of the optimized gene ltrA in (1) is shown in SEQ ID NO: 1.
[0012] Furthermore, the Streptomyces gene recX in (2) is driven by a Streptomyces constitutive promoter.
[0013] Preferably, the gene recX is from Streptomyces coelicolor.
[0014] Preferably, the Streptomyces constitutive promoter in (1) is kasO*p, the thiostrepton inducible promoter is tipAp, and the Streptomyces constitutive promoter in (2) is SF14p.
[0015] In a second aspect, the present invention provides a Streptomyces Targetron gene targeting vector constructed according to the method.
[0016] In a specific embodiment of the present invention, the targeting vector is pSC30, and its nucleotide sequence is formed by sequentially connecting the sequences shown in SEQ ID NO: 3 and 4.
[0017] In a third aspect, the present invention provides a genetic manipulation system comprising the targeting vector.
[0018] In a fourth aspect, the present invention provides any of the following applications of the targeting vector or the genetic operating system:
[0019] 1) Used for gene targeting in Streptomyces;
[0020] 2) Used for screening and activation of Streptomyces secondary metabolites.
[0021] The Streptomyces secondary metabolites include but are not limited to type II polyketide red pigment and jedomycin.
[0022] By means of the above technical solution, the present invention has at least the following advantages and beneficial effects:
[0023] The present invention provides a genetic manipulation tool for Streptomyces targeting the group II intron Ll.LtrB and demonstrates its application in the screening and activation of secondary metabolites in Streptomyces. This marks the first application of the low-GC-content group II intron Ll.LtrB in a high-GC-content Streptomyces species. By optimizing the codons of the intron-encoded protein gene ltrA within Ll.LtrB, the tool successfully achieved gene targeting in Streptomyces coelicolor. Furthermore, by controlling the expression of the intron-encoded protein LtrA and inhibiting RecA-dependent homologous recombination in Streptomyces, the tool improved both the conversion rate and gene targeting efficiency.
[0024] The present invention also successfully used this tool to screen for the red pigment biosynthesis gene cluster in Streptomyces roseosporus and to activate the expression of degamycin in Streptomyces venezuelae. Compared with traditional gene knockout methods that rely on homologous recombination, this tool is simpler, more effective, and saves time and costs, providing a new tool for constructing gene mutation libraries. BRIEF DESCRIPTION OF THE DRAWINGS
[0025] Figure 1 This is a schematic diagram of the structure of the group II intron-based targeting vector pSC30 in a preferred embodiment of the present invention.
[0026] Figure 2 This is the PCR verification of the SCO5087 gene knockout mutant SCO5087D in the preferred embodiment of the present invention.
[0027] Figure 3 This is the sequencing verification of the SCO5087 gene knockout mutant SCO5087D in the preferred embodiment of the present invention.
[0028] Figure 4 This is the PCR verification of the SSIG_RS15030 gene knockout mutant SSIG_RS15030D in the preferred embodiment of the present invention.
[0029] Figure 5 This is the sequencing verification of the SSIG_RS15030 gene knockout mutant SSIG_RS15030D in the preferred embodiment of the present invention.
[0030] Figure 6 Schematic diagram of the structure of the targeting plasmid pSC30E carrying the promoter ermE*p in a preferred embodiment of the present invention.
[0031] Figure 7 This is the PCR verification of the Venezuelan Streptomyces mutant strain EJAD23 in the preferred embodiment of the present invention.
[0032] Figure 8 This is the sequencing verification of the Venezuelan Streptomyces mutant strain EJAD23 in the preferred embodiment of the present invention.
[0033] Figure 9 This is a shake flask fermentation unit of the jedomycin of the wild-type strain ISP5230 of Streptomyces venezuelae and its mutant strain EJAD23 in the preferred embodiment of the present invention. DETAILED DESCRIPTION
[0034] The present invention aims to provide a Streptomyces genetic manipulation tool based on targeting the group II intron Ll.LtrB and its application in the screening and activation of Streptomyces secondary metabolites. By constructing the Streptomyces genetic manipulation tool pSC30 based on targeting the group II intron Ll.LtrB, the following effects were achieved: ① By codon optimization and controlled expression of the gene ltrA within the group II intron Ll.LtrB, gene targeting of the intron Ll.LtrB in Streptomyces was achieved and the transformation efficiency of the vector tool was improved. ② By overexpressing RecX to inhibit RecA-dependent homologous recombination, the targeting efficiency of the group II intron in Streptomyces was improved. ③ Using this targeting plasmid pSC30, the red pigment biosynthesis gene cluster in Streptomyces roseosporus was screened. ④ Using the promoter-carrying targeting plasmid pSC30E, degamycin was activated in Streptomyces venezuelae.
[0035] The present invention adopts the following technical solutions:
[0036] The schematic diagram of the structure of the Streptomyces genetic manipulation tool pSC30 based on group II intron targeting of the present invention is shown in Figure 1 The amino acid sequence of the group II intron-encoded protein LtrA is shown in SEQ ID NO: 2, and the nucleotide sequence of the codon-optimized gene encoding this protein, ltrA (designated ltrAsco), is shown in SEQ ID NO: 1. The nucleotide sequence of vector pSC30 is formed by sequentially concatenating the sequences shown in SEQ ID NOs: 3 and 4.
[0037] The present invention clones the type II intron Ll.LtrB from Lactococcus lactis into the Escherichia coli-Streptomyces shuttle plasmid pKC1139 to construct a Streptomyces genetic manipulation tool based on type II intron targeting, namely the vector pSC30. This tool is then used to achieve gene targeting in Streptomyces coelicolor, screening of a red pigment biosynthesis gene cluster in Streptomyces roseosporus, and activation of a degamycin biosynthesis gene cluster in Streptomyces venezuelae.
[0038] Specifically, the technical solution of the present invention is: first, the DNA sequence encoding intron RNA and the intron-encoding protein gene ltrA are cloned from the Escherichia coli-Clostridium shuttle plasmid pSY6 (containing type II intron Ll.LtrB), and inserted into the Escherichia coli-Streptomyces shuttle plasmid pKC1139 through TEDA connection. The expression is driven by the Streptomyces constitutive promoters kasO*p and ermE*p, respectively, thereby constructing a Streptomyces genetic manipulation tool based on type II intron Ll.LtrB targeting - vector pZW27.
[0039] The target site prediction website ClosTron was used to predict the target site for the gene SCO5087 from Streptomyces coelicolor. Based on the predicted scores, site 1017 on the antisense strand of the SCO5087 gene was selected as the target site. The intronic RNA target recognition fragment was amplified using the primers provided on the website and cloned into pZW27, replacing the recognition sequence of the original intronic RNA. This generated the specific targeting plasmid pZW27-SCO5087. The plasmid was then transformed into Streptomyces coelicolor via protoplast transformation. Screening of the transformants revealed no SCO5087 target mutants.
[0040] In order to achieve successful targeting of the group II intron Ll.LtrB in Streptomyces, the gene ltrA (named ltrAsco) was optimized and synthesized according to the codon preference of Streptomyces coelicolor, and replaced the original gene ltrA in pZW27-SCO5087 to obtain the specific targeting plasmid pZW28-SCO5087. Finally, the gene SCO5087 targeting mutant was successfully obtained with a targeting efficiency of 0.49%.
[0041] In order to improve the transformation efficiency of the targeting plasmid in Streptomyces, the promoter ermE*p was replaced with the promoter tipAp to control the expression of the intron-encoded protein gene ltrAsco, resulting in the specific targeting plasmid pZW30-SCO5087. Ultimately, the transformation rate of the targeting plasmid was increased from 7.2% to 45%, and the targeting efficiency was increased from 0.49% to 0.83%.
[0042] To improve the targeting efficiency of this targeting plasmid in Streptomyces, the gene recX from Streptomyces coelicolor was amplified and cloned into pZW30-SCO5087, with expression driven by the promoter SF14p. This resulted in the construction of the Streptomyces genetic manipulation tool, the vector pSC30 (SEQ ID NO: 3), based on group II intron targeting. Ultimately, the targeting efficiency of the targeting plasmid was increased from 0.83% to 2.38%.
[0043] The prediction website antiSMASH was used to predict secondary metabolite gene clusters in the Streptomyces roseosporus genome. Gene clusters with similarity below 75% were selected from the results, and type II intron targeting sites of the structural genes in these gene clusters were predicted using the website ClosTron. Corresponding targeting plasmids were constructed. The targeting plasmids were mixed and transformed into Streptomyces roseosporus by protoplast transformation. The transformants were screened to obtain mutants without red pigment production. The mutants were sequenced and compared to obtain a gene cluster for synthesizing red pigment. The structural genes in this gene cluster were verified by PCR and sequencing, confirming that this gene cluster is the gene cluster for synthesizing red pigment in Streptomyces roseosporus.
[0044] The promoter ermE*p was inserted into the intronic RNA sequence of the group II intron Ll.LtrB to generate pSC30E. Group II intron targeting sites within the jadJ gene cluster of Streptomyces venezuelae were predicted, and site 85 upstream of the jadJ gene was selected as the target site. A specific targeting plasmid, pSC30E-jadJp, was constructed and transformed into Streptomyces venezuelae. Mutants were screened and activated, achieving jadJ.
[0045] The following examples are provided to illustrate the present invention but are not intended to limit the scope of the invention. Unless otherwise specified, the examples were performed according to conventional experimental conditions, such as those in Sambrook et al. (Sambrook J & Russell DW, Molecular Cloning: a Laboratory Manual, 2001), or according to the conditions recommended by the manufacturer's instructions.
[0046] In the present invention, the reference sequence number of the group II intron Ll.LtrB of Lactococcus lactis in NCBI is AAB06503.1.
[0047] The reference sequence number of the Streptomyces coelicolor gene recX in NCBI is NP_629895.1.
[0048] The promoter kasO*p can be found in Wang et al., 2013, the promoter ermE*p can be found in Bibb et al., 1985, the promoter tipAp can be found in Takano et al., 1995, and the promoter SF14p can be found in Labes et al., 1997.
[0049] Example 1 Construction of a Streptomyces gene targeting vector based on the type II intron Ll.LtrB
[0050] PCR primers were designed based on the sequences of the promoters kasO*p and ermE*p as follows:
[0051] kasO*p-fw:
[0052] 5′-TGCATACTAGAGGGATCCTGTTCACATTCGAACCGT-3′;
[0053] kasO*p-rev:
[0054] 5′-GCTTGGGCTGCAGGTCGACTTCTAGATGGCCACGACTTTACAAC-3′;
[0055] ermE*p-fw:
[0056] 5′-CGCGCGCGGCCGCGGATCCTACTAGTTGGATCCTACCAACCGGC-3′;
[0057] ermE*p-rev:
[0058] 5′-ACGGTTCGAATGTGAACAGGATCCCTCTAGTATGCA-3′;
[0059] Using the plasmid pKCCpf1 (see Li et al., 2018, provided by the laboratory of Wang Weishan, Institute of Microbiology, Chinese Academy of Sciences) as a template, PCR amplification was performed using the primer pairs kasO*p-fw / rev and ermE*p-fw / rev, respectively. PCR reaction conditions were: 95°C for 3 min, followed by 28 cycles (95°C for 25 s, 60°C for 25 s, and 72°C for 15 s), 72°C for 5 min, and storage at 4°C. The two fragments were ligated into the vector pKC1139 (see Bierman et al., 1992, provided by the laboratory of Wang Weishan, Institute of Microbiology, Chinese Academy of Sciences) using the TEDA assembly method, generating the vector pKC1139ke. Sequencing confirmed that the fragments were correctly inserted into the vector and that the sequences were correct.
[0060] Primers were designed based on the sequence encoding intron RNA in the group II intron Ll.LtrB and the sequence of the gene ltrA as follows:
[0061] intron-fw:
[0062] 5′-TTGTAAAGTCGTGGCCATCATATGTCGAGATAATTATCCTTA-3′;
[0063] intron-rev:
[0064] 5′-CTTGGGCTGCAGGTCGACTTGCATAGAAATTGCATCAA-3′;
[0065] ltrA-fw:
[0066] 5′-TGCCGGTTGGTAGGATCCAAATGAAACCAACAATGGCA-3′;
[0067] ltrA-rev:
[0068] 5′-CTTGGGCTGCAGGTCGACTACGAGAACGGGTGCTCGAC-3′;
[0069] Plasmid pSY6 (see Shao et al., 2007, provided by the laboratory of Wang Weishan, Institute of Microbiology, Chinese Academy of Sciences) was used as a template for PCR amplification using the primer pairs intron-fw / rev and ltrA-fw / rev. PCR reaction conditions were: 95°C for 3 min, followed by 29 cycles of 95°C for 25 s, 55°C for 25 s, and 72°C for 40 s, followed by 72°C for 5 min, and storage at 4°C. The fragment was ligated into the vector pKC1139ke using the TEDA assembly method to generate the vector pZW27. Sequencing confirmed that the fragment had been correctly inserted into the vector and that the sequence was correct.
[0070] Example 2 Construction of SCO5087-specific targeting vector
[0071] Based on the nucleotide sequence of the gene SCO5087 (NCBI No.: NP_629237.1) in Streptomyces coelicolor, the target site of this gene was predicted using the group II intron target prediction website ClosTron (WWW.ClosTron.cn). Based on the score, the 1017th site of the antisense strand of the SCO5087 gene was selected as the target site, and the primers were designed as follows:
[0072] SCO5087-IBS:
[0073] 5′-AAAAAAGCTTATAATTATCCTTACGCGTCCGTGCGGTGCGCCCAGAT AGGGTG-3′;
[0074] SCO5087-EBS2:
[0075] 5′-TGAACGCAAGTTTCTAATTTCGGTTACGCGTCGATAGAGGAAAGTGTCT-3′;
[0076] SCO5087-EBS1d:
[0077] 5′-CAGATTGTACAAATGTGGTGATAACAGATAAGTCCGTGCGGGTAACTTAC CTTTCTTTGT-3′;
[0078] EBS universal:
[0079] 5′-CGAAATTAGAAACTTGCGTTCAGTAAAC-3′;
[0080] Plasmid pZW27 was used as a template and primer pairs SCO5087-IBS / EBS universal and SCO5087-EBS2 / EBS1d were used for PCR amplification. PCR reaction conditions were: 95°C for 3 min, followed by 29 cycles of (95°C for 25 s, 55°C for 25 s, and 72°C for 15 s), 72°C for 5 min, and storage at 4°C.
[0081] Design primers intron-universal as shown in the following table:
[0082] intron-universal:
[0083] 5′-CATAGGTTCTCCTACAGATTGTACAAATGTGGTGATAA-3′;
[0084] Using the two fragments obtained above as templates, PCR amplification was performed with the primer pair intron-fw / intron-universal. PCR reaction conditions were: 95°C for 3 minutes, followed by 29 cycles of 95°C for 25 seconds, 55°C for 25 seconds, and 72°C for 15 seconds; 72°C for 5 minutes; and storage at 4°C. Using the TEDA assembly method, the fragments were ligated into the pZW27 vector, replacing the original recognition sequence for the intronic RNA in the group II intron Ll.LtrB. This generated the specific targeting vector pZW27-SCO5087. Sequencing confirmed that the fragments were correctly inserted into the vector and that the sequence was correct.
[0085] Example 3 Obtaining a SCO5087 gene insertion-inactivation mutant in Streptomyces coelicolor
[0086] 1. Transformation of specific targeting vector pZW27-SCO5087
[0087] The specific targeting vector pZW27-SCO5087 was transformed into competent cells of Escherichia coli ET12567 by electroporation or heat shock to obtain non-methylated DNA. The non-methylated plasmid DNA was used to transform the protoplasts of Streptomyces coelicolor, which can significantly improve the transformation efficiency.
[0088] Wild-type Streptomyces coelicolor strain M145 (provided by the laboratory of Wang Weishan's group at the Institute of Microbiology, Chinese Academy of Sciences) was used as the starting strain for protoplast preparation. Protoplasts were transformed with plasmid pZW27-SCO5087 extracted from Escherichia coli ET12567. The protoplasts were plated onto dried RM14 plates without antibiotics and incubated at 28°C for 24 hours. Then, 1 mL of an aqueous solution containing 50 μg of apramycin was applied to the plates. Incubation was continued at 28°C for 5–7 days. The resulting colonies were identified as transformants.
[0089] Fifty transformants were picked for each culture, inoculated on MS plates containing 50 μg / mL apramycin, and cultured at 28°C for 5-7 days to restore spore production.
[0090] 2. Verification of insertional inactivation of the SCO5087 gene
[0091] PCR was used to verify the insertional inactivation of gene SCO5087 in Streptomyces coelicolor.
[0092] The PCR verification primers were designed based on the sequence of the SCO5087 gene as follows:
[0093] SCO5087-fw:
[0094] 5′-ACGACCCGGAGCACGCC-3′
[0095] SCO5087-rev:
[0096] 5′-CCCAGCGAGTGGCCGAC-3′
[0097] PCR amplification was performed using genomic DNA from wild-type Streptomyces coelicolor strain M145 and transformants harboring the specific targeting vector pZW27-SCO5087 as templates using primer pair SCO5087-fw / rev. PCR reaction conditions were: 95°C for 5 minutes, followed by 28 cycles of 95°C for 25 seconds, 62°C for 25 seconds, and 72°C for 35 seconds; 72°C for 5 minutes; and storage at 4°C. A 391-bp fragment was amplified using genomic DNA from wild-type Streptomyces coelicolor strain M145 as a template, and a 391-bp fragment was amplified using genomic DNA from transformants harboring the specific targeting vector pZW27-SCO5087 as a template, indicating that the unoptimized group II intron Ll.LtrB has low targeting efficiency in Streptomyces coelicolor.
[0098] 3. Construction of the specific targeting vector pZW28-SCO5087 and verification of insertional inactivation of the SCO5087 gene
[0099] Based on the codon preference of the Streptomyces coelicolor genome, the intron-encoding protein gene ltrA within the group II intron Ll.LtrB was codon-optimized and synthesized. The optimized gene ltrA was named ltrAsco, and its nucleotide sequence is shown in SEQ ID NO: 1. ltrA in pZW27-SCO5087 was replaced with ltrAsco to construct the specific targeting vector pZW28-SCO5087.
[0100] According to the above steps, the transformation of the specific targeting vector pZW28-SCO5087 and the verification of the insertional inactivation of the SCO5087 gene were repeated. Figure 2 As shown, a 391 bp fragment was amplified using the genomic DNA of the wild-type Streptomyces coelicolor strain M145 as a template; a 1306 bp fragment was amplified using the genomic DNA of the transformant containing the specific targeting vector pZW28-SCO5087 as a template, indicating that the obtained transformant was an insertion-inactivation mutant of the SCO5087 gene (named SCO5087D).
[0101] The SCO5087 gene insertion-inactivation mutant SCO5087D was further sequenced and verified. The results showed that ( Figure 3 ), compared with the wild-type strain M145, the coding sequence of the intron RNA of type II intron Ll.LtrB was inserted 1017 bp downstream of the start codon of the SCO5087 gene in SCO5087D, which was a correct insertional inactivation mutant of the SCO5087 gene.
[0102] According to statistics, the targeting efficiency of type II intron Ll.LtrB in Streptomyces coelicolor is 0.49%.
[0103] Example 4 Optimization of Streptomyces gene targeting vector based on group II intron Ll.LtrB
[0104] 1. Construction of specific targeting vector pZW30-SCO5087
[0105] Transformation of the specific targeting vector pZW28-SCO5087 reduced the number of transformants in Streptomyces coelicolor. To weaken the toxicity of the intron-encoded protein LtrAsco to Streptomyces coelicolor, the thiostrepton-inducible promoter tipAp (whose promoter strength is lower than the constitutive promoter ermE*p) was synthesized, and the constitutive promoter ermE*p that drives the expression of ltrAsco in pZW28-SCO5087 was replaced with tipAp to obtain the specific targeting vector pZW30-SCO5087.
[0106] The transformation of the specific targeting vector and verification of the insertional inactivation of the SCO5087 gene in Example 3 were repeated, and the transformation and targeting efficiencies of pZW30-SCO5087 in Streptomyces coelicolor were statistically calculated. Compared with pZW28-SCO5087, the transformation efficiency of pZW30-SCO5087 in Streptomyces coelicolor increased from 7.2% to 45%, and the targeting efficiency increased from 0.49% to 0.83%. This indicates that controlling the expression of ltrAsco can improve the transformation and targeting efficiencies of pZW30-SCO5087 in Streptomyces coelicolor.
[0107] (2) Construction of specific targeting vector pSC30-SCO5087
[0108] The Streptomyces constitutive promoter SF14p was synthesized. Based on the nucleotide sequence of the gene recX in Streptomyces coelicolor, the primers were designed as follows:
[0109] recX-fw: 5′-GTATCTGAAAGGGGATACGCGTGGAGCCGTCCGCCGAG-3′
[0110] recX-rev: 5′-ACAGCTATGACATGATTACGTCAGAACCCCTCGTCGCC-3′
[0111] Genomic DNA from wild-type Streptomyces coelicolor strain M145 was used as a template and the primer pair recX-fw / rev was amplified by PCR. PCR reaction conditions were: 95°C for 5 min, followed by 29 cycles of 95°C for 25 s, 60°C for 25 s, and 72°C for 25 s, followed by 72°C for 5 min, and storage at 4°C. The synthesized promoter fragment SP14p and the PCR-amplified recX fragment were ligated into the vector pZW30-SCO5087 using the TEDA assembly method to generate the vector pSC30-SCO5087.
[0112] The transformation of the specific targeting vector and verification of the insertional inactivation of the SCO5087 gene in Example 3 were repeated, and the targeting efficiency of pSC30-SCO5087 in Streptomyces coelicolor was statistically calculated. The targeting efficiency of pSC30-SCO5087 in Streptomyces coelicolor was increased to 2.38%. This indicates that overexpressing recX to inhibit RecA-dependent homologous recombination can improve the targeting efficiency of pSC30-SCO5087 in Streptomyces coelicolor.
[0113] Example 5 Screening of red pigment biosynthesis gene clusters in Streptomyces roseosporus
[0114] Using the secondary metabolite gene cluster prediction website antiSMASH (antismash-db.secondarymetabolites.org), 31 secondary metabolite gene clusters were predicted in the genome of Streptomyces roseosporus NRRL11379. Eighteen secondary metabolite gene clusters with a similarity below 75% were selected to predict target sites for group II intron Ll.LtrB in their structural genes.
[0115] The above steps were repeated to construct specific targeting plasmids for each structural gene. These plasmids were mixed and transformed into Streptomyces roseosporus by protoplast transformation. After screening, a strain that did not produce red pigment was obtained.
[0116] PCR and sequencing were used to verify the specific targeting plasmid contained in Streptomyces roseosporus that does not produce red pigment. The primers were designed as follows:
[0117] intron-seq-fw:
[0118] 5′-TCGAGATAATTATCCTTA-3′
[0119] intron-seq-rev:
[0120] 5′-TGCATAGAAATTGCATCAA-3′
[0121] PCR amplification was performed using genomic DNA from Streptomyces roseosporus, a strain that does not produce red pigment, as a template using the primer pair intron-seq-fw / rev. PCR reaction conditions were: 95°C for 3 minutes, followed by 28 cycles of 95°C for 25 seconds, 58°C for 25 seconds, and 72°C for 20 seconds; 72°C for 5 minutes, and storage at 4°C. Sequencing confirmed that the specific targeting plasmid contained in Streptomyces roseosporus, a strain that does not produce red pigment, is pSC30-SSIG_RS15030. The gene SSIG_RS15030 (NCBI No. WP_006126304.1) is derived from a gene cluster involved in the synthesis of type II polyketides (sequence similarity: 14%).
[0122] The SSIG_RS15030 gene in Streptomyces roseosporus, which does not produce red pigment, was further sequenced and verified, and the primers were designed as follows:
[0123] SSIG_RS15030-fw:
[0124] 5′-AGGAGGAGTACGTCGTGG-3′
[0125] SSIG_RS15030-rev:
[0126] 5′-CGGAGTGGTCAGGTTCGC-3′
[0127] Genomic DNA from wild-type Streptomyces roseosporus strain NRRL11379 and Streptomyces roseosporus that does not produce red pigment was used as template and primer pair SSIG_RS15030-fw / rev was used for PCR amplification. PCR reaction conditions: 95°C, 5 min; (95°C, 25 s; 60°C, 25 s; 72°C, 40 s) for 28 cycles; 72°C, 5 min; 4°C storage. Figure 4 As shown, a 788 bp fragment was amplified using the genomic DNA of the wild-type Streptomyces roseosporus strain NRRL11379 as a template; a 1703 bp fragment was amplified using the genomic DNA of the Streptomyces roseosporus that does not produce red pigment as a template, indicating that the Streptomyces roseosporus that does not produce red pigment is an SSIG_RS15030 gene insertion-inactivation mutant (named SSIG_RS15030D).
[0128] The SSIG_RS15030 gene insertion-inactivation mutant SSIG_RS15030D was further sequenced and verified. The results showed that ( Figure 5), compared with the wild-type strain NRRL11379, the coding sequence of the intron RNA of type II intron Ll.LtrB was inserted 582 bp downstream of the start codon of the SSIG_RS15030 gene in SSIG_RS15030D, which was a correct SSIG_RS15030D gene insertion-inactivation mutant.
[0129] Example 6 Activation of the degamycin biosynthetic gene cluster in Streptomyces venezuelae
[0130] 1. Construction of the targeting plasmid pSC30E carrying the promoter ermE*p
[0131] Primers were designed based on the ermE*p promoter sequence as follows:
[0132] Intron-ermE*p-fw:
[0133] 5′-agatatttattacgtggcgaGGATCCCTCTAGTATGCA-3′;
[0134] Intron-ermE*p-rev:
[0135] 5′-CTATCATTGCCATTTCCCAATGGATCCTACCAACCGGC-3′;
[0136] Using pZW27 as a template, PCR amplification was performed with primer pair Intron-ermE*p-fw / rev. PCR reaction conditions: 95°C, 5 min; (95°C, 25 s; 60°C, 25 s; 72°C, 15 s) for a total of 28 cycles; 72°C, 5 min; 4°C, storage. The obtained ermE*p fragment was ligated to the vector pSC30 (SEQ ID NO: 3) by TEDA assembly method to obtain the vector pSC30E ( Figure 6 ). Sequencing confirmed that the fragment had been correctly inserted into the vector and the sequence was correct.
[0137] 2. Construction of specific targeting plasmid pSC30E-jadJp
[0138] Based on the nucleotide sequence of the promoter region of the jadJ biosynthetic gene cluster of Streptomyces venezuelae, the target site of the promoter region was predicted using ClosTron, a group II intron target prediction website. Based on the score, the 85th site upstream of the start codon of the jadJ gene was selected as the target site, and the primers were designed as follows:
[0139] jadJp-IBS:
[0140] 5′-AAAAAAGCTTATAATTATCCTTAAAGCTCGTCGTGGTGCGCCCAGATAGG GTG-3′;
[0141] jadJp-EBS2:
[0142] 5′-TGAACGCAAGTTTCTAATTTCGGTTAGCTTCCGATAGAGGAAAGTGTCT-3′;
[0143] jadJp-EBS1d:
[0144] 5′-CAGATTGTACAAATGTGGTGATAACAGATAAGTCGTCGTGAATAACTTAC CTTTCTTTGT-3′;
[0145] Using the plasmid pSC30E as a template, PCR amplification was performed using the primer pairs jadJp-IBS / EBS universal and jadJp-EBS2 / EBS1d, respectively. PCR reaction conditions were: 95°C for 3 min, followed by 29 cycles of (95°C for 25 s, 55°C for 25 s, and 72°C for 15 s), 72°C for 5 min, and storage at 4°C. The two resulting fragments were used as templates for PCR amplification using the primer pair intron-fw / intron-universal. PCR reaction conditions were: 95°C for 3 min, followed by 29 cycles of (95°C for 25 s, 55°C for 25 s, and 72°C for 15 s), 72°C for 5 min, and storage at 4°C. The fragments were ligated into the pSC30E vector using the TEDA assembly method to generate the specific targeting vector pSC30E-jadJp. Sequencing confirmed that the fragments were correctly inserted into the vector and that the sequences were correct.
[0146] 3. Validation of the insertion of the group II intron Ll.LtrB carrying the promoter ermE*p into the promoter region of the jedomycin gene cluster
[0147] According to the above-mentioned specific targeting vector transformation method, the specific targeting vector pSC30E-jadJp was transformed into the wild-type Streptomyces venezuelae strain ISP5230. The promoter region of the jadJp biosynthesis gene cluster in Streptomyces venezuelae was verified by PCR to confirm the insertion of the type II intron.
[0148] PCR verification primers were designed based on the sequence of the promoter region of the jedomycin biosynthesis gene cluster in Streptomyces venezuelae as follows:
[0149] jadJp-fw:
[0150] 5′-CCCCGCACATTCCCGTCC-3′;
[0151] jadJp-rev:
[0152] 5′-GAACGCCTCGTCAGCCGC-3′;
[0153] Using genomic DNA from wild-type Streptomyces venezuelae strain ISP5230 and transformants containing the specific targeting vector pSC30E-jadJp as templates, PCR amplification was performed using primer pair jadJp-fw / rev. PCR reaction conditions: 95°C, 5 min; (95°C, 25 s; 60°C, 25 s; 72°C, 40 s) for a total of 28 cycles; 72°C, 5 min; 4°C storage. Figure 7 As shown, a 535 bp fragment was amplified using the genomic DNA of the wild-type Venezuelan Streptomyces strain ISP5230 as a template; a 1645 bp fragment was amplified using the genomic DNA of the transformant containing the specific targeting vector pSC30E-jadJp as a template, indicating that the obtained transformant was the mutant strain EJAD23 carrying the promoter ermE*p and the type II intron Ll.LtrB targeted inserted into the promoter region of the jadromycin biosynthesis gene cluster.
[0154] The mutant strain EJAD23 was further sequenced and verified, and the results showed that ( Figure 8 ), and the mutant strain EJAD23 was successfully constructed.
[0155] 4. Determination of jedomycin production
[0156] Venezuelan Streptomyces wild-type strain ISP5230 and mutant strain EJAD23 were inoculated into MYM medium (100 mL / 250 mL Erlenmeyer flask) and cultured in a shaking incubator at 28°C for 24 hours (250 rpm). The inoculum was then inoculated into GM medium (100 mL / 250 mL Erlenmeyer flask) at a 1% v / v inoculum and cultured in a shaking incubator at 28°C for 48 hours. After the fermentation broth was inoculated, the supernatant was centrifuged and the pH was adjusted to 3.0 with 1M hydrochloric acid. The supernatant was then extracted with 1 / 2 volume of ethyl acetate and dried using a rotary evaporator. The resulting solid powder was dissolved in anhydrous ethanol, and the resulting sample was used to determine the yield of jedomycin by HPLC.
[0157] HPLC analysis conditions were: C18 reverse phase column, column length 25 cm, column inner diameter 4.6 mm, mobile phase A was water containing 0.1% trifluoroacetic acid; mobile phase B was acetonitrile containing 0.1% trifluoroacetic acid, flow rate 1.0 mL / min, injection volume 20 μL, detection wavelength 313 nm. The elution program was as follows: 0-20 min, mobile phase B increased from 50% to 100%; 20-23 min, mobile phase B was maintained at 100%; 23-23.5 min, mobile phase B decreased from 100% to 50%; the analysis results are shown in Figure 2. Figure 9 shown.
[0158] from Figure 9 It can be seen that the wild-type strain ISP5230 of Streptomyces venezuelae did not synthesize degamycin, while the mutant strain EJAD23 produced 29.74 μg / ml of degamycin, indicating that after the type II intron Ll.LtrB carrying the promoter ermE*p was targeted and inserted into the promoter region of the degamycin gene cluster, the constitutive promoter ermE*p successfully activated the expression of degamycin.
[0159] Although the present invention has been described in detail above using general descriptions and specific embodiments, it will be apparent to those skilled in the art that modifications and improvements may be made based on the present invention. Therefore, such modifications and improvements, which do not depart from the spirit of the present invention, are intended to be within the scope of protection claimed herein.
[0160] References:
[0161] 1. Bibb, MJ, Janssen, GR, and Ward, JM (1985). Cloning and analysis of the promoter region of the erythromycin resistance gene (ermE) of Streptomyceserythraeus. Gene 38, 215-226.
[0162] 2. Bierman, M., Logan, R., O'Brien, K., Seno, ET, Rao, RN, and Schoner, BE (1992). Plasmid cloning vectors for the conjugal transfer of DNA from Escherichia coli to Streptomyces spp. Gene 116,43-49.
[0163] 3、Labes,G.,Bibb,M.,and Wohlleben,W.(1997).Isolation andcharacterization of a strong promoter element from the Streptomycesghanaensis phage I19 using the gentamicin resistance gene(aacC1)of Tn 1696asreporter.Microbiology(Reading,England)143(Pt 5),1503-1512.
[0164] 4、Li,L.,Wei,K.,Zheng,G.,Liu,X.,Chen,S.,Jiang,W.,and Lu,Y.(2018).CRISPR-Cpf1-Assisted Multiplex Genome Editing and Transcriptional Repressionin Streptomyces.Appl Environ Microbiol 84.
[0165] 5、Shao,L.,Hu,S.,Yang,Y.,Gu,Y.,Chen,J.,Yang,Y.,et al.(2007).Targetedgene disruption by use of a group II intron(targetron)vector in Clostridiumacetobutylicum.Cell Res 17,963-965.
[0166] 6、Takano,E.,White,J.,Thompson,C.J.,and Bibb,M.J.(1995).Constructionof thiostrepton-inducible,high-copy-number expression vectors for use inStreptomyces spp.Gene 166,133-137.
[0167] 7、Wang,W.,Li,X.,Wang,J.,Xiang,S.,Feng,X.,and Yang,K.(2013).Anengineered strong promoter for streptomycetes.Appl Environ Microbiol 79,4484-4492。
Claims
1. A method for constructing a Streptomyces Targetron gene targeting vector, characterized in that: The following steps are involved: (1) The type II intron Ll.LtrB from Lactococcus lactis was cloned into the Escherichia coli-Streptomyces shuttle plasmid to obtain a recombinant plasmid; Among them, the DNA sequence encoding the intron RNA in the group II intron Ll.LtrB and the intron-encoding protein gene ltrA are driven by a Streptomyces constitutive promoter and a thiostrepton-inducible promoter, respectively, and the gene ltrA is a gene optimized according to the codon preference of Streptomyces; (2) The Streptomyces gene recX is cloned into the recombinant plasmid obtained in (1) to obtain the Streptomyces Targetron gene targeting vector.
2. The method according to claim 1, characterized in that The E. coli-Streptomyces shuttle plasmid described in (1) is pKC1139.
3. The method according to claim 1, characterized in that The nucleotide sequence of the optimized gene ltrA in (1) is shown in SEQ ID NO:
1.
4. The method according to claim 1, wherein (2) The Streptomyces gene recX is expressed by a Streptomyces constitutive promoter; Preferably, the gene recX is from Streptomyces coelicolor.
5. The method according to claim 4, characterized in that The constitutive promoter of Streptomyces described in (1) is kasO*p, the thiostrepton inducible promoter is tipAp, and the constitutive promoter of Streptomyces described in (2) is SF14p.
6. The Streptomyces Targetron gene targeting vector constructed according to the method according to any one of claims 1 to 5.
7. The targeting carrier according to claim 6, characterized in that The targeting vector is pSC30, and its nucleotide sequence is formed by sequentially connecting the sequences shown in SEQ ID NO: 3 and 4.
8. A genetic operating system comprising the targeting vector according to claim 6 or 7.
9. Any of the following uses of the targeting vector according to claim 6 or 7 or the genetic manipulation system according to claim 8: 1) Used for gene targeting in Streptomyces; 2) Used for screening and activation of Streptomyces secondary metabolites.
10. The use according to claim 9, characterized in that The secondary metabolites of Streptomyces include type II polyketide compound red pigment and jedomycin.