NF-kB sensing and effect gene expression vector and application of recombinant adeno-associated virus delivered in vivo in cancer treatment

By using NF-κB-specific promoter and microRNA gene expression vector in cancer cells, combined with adeno-associated virus delivery system, the side effects and selectivity problems of NF-κB inhibitors in cancer treatment were solved, and targeted inhibition of NF-κB RelA gene and anti-tumor effect were achieved.

CN120661694APending Publication Date: 2025-09-19SOUTHEAST UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202510612330.4
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-05-13
Publication Date
2025-09-19

AI Technical Summary

Technical Problem

Existing NF-κB inhibitors have side effects and lack selectivity for cancer cells in cancer treatment, making them difficult to develop into drugs. Traditional gene expression vectors are unable to achieve targeted and selective expression of NF-κB.

Method used

A gene expression vector containing the NF-κB-specific promoter DMP and a microRNA targeting the NF-κB RelA gene was used to construct a recombinant adeno-associated virus rAAV-DMP-miR533 through an adeno-associated virus delivery system to selectively inhibit the expression of the NF-κB RelA gene in cancer cells.

Benefits of technology

It achieves selective inhibition of NF-κB RelA gene expression in cancer cells, showing significant anti-tumor effects and good biosafety, avoiding side effects on normal cells, and is suitable for the treatment of various types of cancer.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120661694A_ABST
    Figure CN120661694A_ABST
Patent Text Reader

Abstract

The invention discloses an NF-kappa B sensing and effect gene expression vector and an application of a recombinant adeno-associated virus delivered in vivo in cancer treatment. The gene expression vector comprises one or more functional DNA fragment DMP-microRNA genes; the functional DNA fragment DMP-microRNA gene is composed of two functional elements DMP and a microRNA gene, the DMP is an NF-kappa B specific promoter, and the microRNA gene is a microRNA coding sequence for targeted inhibition of NF-kappa B gene expression. The gene expression vector prepared by the invention can selectively and remarkably inhibit the expression of NF-kB RelA molecules in cancer cells, and the recombinant adeno-associated virus constructed by taking the adeno-associated virus as an in-vivo delivery vector of the gene expression vector has a good treatment effect on various cancers and has good tumor targeting and safety.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the field of cancer gene therapy biotechnology, and in particular to an NF-κB sensor and effector gene expression vector and an in vivo delivered recombinant adeno-associated virus for use in cancer therapy. Background Art

[0002] Traditional cancer treatments, including surgery, chemotherapy, radiotherapy, and newer immunotherapies, have been used to improve the quality of life and survival rates of cancer patients. However, current cancer treatments still face many challenges, such as side effects or toxicity, drug tolerance, recurrence, and low response rates. Therefore, the development of breakthrough cancer treatments is urgently needed.

[0003] Nuclear factor κB (NF-κB) is a sequence-specific, DNA-binding transcription factor (TF) that plays a key role in physiological and pathological processes. NF-κB exerts its function by binding to DNA-binding sites within the genome (termed κB sites) to regulate the expression of its target genes. The RelA subunit (also known as p65) is ubiquitously expressed in mammalian cells and, when constitutively activated, is closely associated with cellular transformation. Furthermore, NF-κB is frequently overactivated during chronic inflammation and subsequent cancer progression, promoting cell proliferation, angiogenesis, invasion / metastasis, and inhibiting apoptosis. Numerous studies have reported associations between aberrant NF-κB activation and various diseases. For example, in many human cancers, NF-κB is aberrantly activated, enhancing cell survival and malignancy by upregulating anti-apoptotic genes. Given its constitutive overactivation in virtually all cancer cells, NF-κB has become a promising target for cancer therapy. Consequently, numerous companies and researchers are committed to developing NF-κB inhibitors for therapeutic purposes, such as small molecule inhibitors, siRNAs, and decoys. However, NF-κB is a double-edged sword. Its basal activity is crucial for normal cellular function, including tissue homeostasis and immune responses. Consequently, excessive inhibition of NF-κB activity can produce side effects, and current NF-κB inhibitors, due to the difficulty in avoiding these side effects, have so far eluded drug development and clinical use. In other words, current cancer therapies targeting NF-κB lack selectivity for cancer cells, highlighting the need to develop technologies specifically targeting cancer cells.

[0004] MicroRNAs (miRNAs) are a class of small, highly conserved endogenous noncoding RNA molecules, typically approximately 22 nucleotides in length, with gene expression-regulating abilities similar to those of small interfering RNAs (siRNAs). Most mature miRNAs are initially transcribed from DNA sequences as primary miRNAs (pri-miRNAs). These pri-miRNAs undergo a two-step cleavage process to form precursor miRNAs (pre-miRNAs), which are then mediated by RNA polymerase II (Pol II) to form the RNA-induced silencing complex (RISC). miRNAs negatively regulate gene expression by pairing with target messenger RNAs (mRNAs) as guides. The degree of complementarity between the miRNA and its mRNA target determines the silencing mechanism employed, which may involve cleavage and subsequent degradation of the target mRNA or inhibition of its translation. Currently, there are two approaches to regulating target gene expression with microRNAs. One is direct chemical synthesis of small interfering RNAs (siRNAs) for in vivo delivery; several drugs using this approach have been approved for clinical treatment, but this approach lacks strict in vivo cellular targeting, making it difficult to use in cancer treatment. The second approach is to use promoters driven by DNA polymerase III (Pol III), such as the U6 promoter, to control shRNA expression in cells in vivo. However, Pol III promoters are universally active in all cell types, making them incapable of selectively controlling microRNA expression in cancer cells and limiting their use in cancer treatment. Promoters driven by DNA polymerase II (Pol II) often have enhancer sequences upstream. Transcription factor proteins that bind to these enhancers often exhibit tissue and cell-specific expression, thereby controlling gene expression only in certain tissues and cells. NF-κB is a typical enhancer-binding transcription factor protein. However, common Pol II promoters, such as CMV, EF-1α, SV40, LTR, and β-actin, contain multiple transcription factor binding sites. While these promoters are highly active and can control exogenous gene expression in various tissues, they lack tissue and cell selectivity. To achieve targeted exogenous gene expression in target tissue cells, tissue-specific promoters, such as muscle and liver-specific promoters, can be used. However, these promoters are not suitable for broad-based gene therapy for cancer, as cancer can arise in diverse tissues. Since NF-κB is overactivated in almost all types of cancer cells and has very low activity in normal cells, artificially synthesized NF-κB-specific promoters have been widely used in recent years to drive the expression of reporter genes (such as luciferase) in cancer cells in vitro for basic scientific research, such as screening for NF-κB inhibitors.NF-κB-specific promoters are composed of multiple NF-κB binding sites, or κB sites, in tandem. Because they contain virtually no binding sites for other transcription factors, their activity is determined solely by the level of intracellular NF-κB activation, meaning their activity is regulated solely by NF-κB. This offers a potential way to control the expression of exogenous genes in various cancer cell types. However, currently, the use of NF-κB to control exogenous gene expression in various cancer cell types has primarily been used to control the expression of reporter genes, such as GFP, in cultured cells in vitro and to screen for potential NF-κB inhibitors. It has not yet been applied to control the expression of an artificial microRNA targeting an NF-κB family member, such as RELA, thereby forming an intelligent feedback loop to sense and regulate intracellular NF-κB activity for in vivo cancer treatment. Summary of the Invention

[0005] Purpose of the Invention: To address the problems existing in existing cancer treatments, the present invention provides a gene expression vector for cancer treatment, used in the preparation of a recombinant adeno-associated virus for in vivo delivery for cancer treatment. This gene expression vector and the recombinant adeno-associated virus delivered in vivo can achieve cancer treatment in living mammals by inhibiting expression of the intracellular immunosuppressive NF-κB RelA gene, and is expected to be used in the preparation of new biopharmaceuticals for the treatment of human cancer. The novel gene expression vector and the recombinant adeno-associated virus delivered in vivo provided by the present invention are expected to overcome the problem of existing NF-κB inhibitor drugs being unsuitable for development as drugs due to side effects, providing an NF-κB-targeted cancer gene therapy agent with strict tumor selectivity in vivo and thus greater safety.

[0006] The present invention also provides a construction method and application of the recombinant adeno-associated virus for delivering the gene expression vector in vivo.

[0007] Technical solution: In order to achieve the above-mentioned objectives, the present invention proposes the use of a gene expression vector for the treatment of cancer diseases in the preparation of a recombinant adeno-associated virus for in vivo delivery for the treatment of cancer diseases, wherein the gene expression vector comprises one to multiple functional DNA fragments DMP-microRNA genes; the functional DNA fragment DMP-microRNA gene is composed of two functional elements DMP and microRNA gene, wherein DMP is an NF-κB-specific promoter, and the microRNA gene is a microRNA coding sequence that targets and inhibits the expression of the NF-κB gene.

[0008] The NF-κB specific promoter is composed of an NF-κB decoy and a minimal promoter, and the DMP includes NF-κB decoys and minimal promoters of various sequences.

[0009] The sequence of the DMP is shown in SEQ ID NO. 1: 5'-GGGAAT TTC CGG GGACTT TCC GGG AAT TTC CGG GGA CTT TCC GGG AAT TTC CTAGAG GGTATATAATGGAAG CTCGAC TTC CAG-3'.

[0010] Wherein, the microRNA coding sequence is a microRNA coding sequence that encodes a microRNA that can inhibit the expression of NF-κB RelA gene.

[0011] The microRNA coding sequence capable of inhibiting the expression of NF-κB RelA gene is shown in SEQ ID NO. 2, SEQ ID NO. 2: 5′-CAAAGATGG GAT GAGAAA GGA-3′.

[0012] Among them, the expressed microRNA is processed and matured by the intracellular microRNA maturation system and can bind to NF-κB RelAmRNA in the cytoplasm, thereby inhibiting the expression of NF-κB RELA / P65 protein.

[0013] Furthermore, after the expressed miR is matured by the intracellular microRNA maturation system, it can bind to NF-κB RelA mRNA in the cytoplasm, thereby inhibiting the expression of NF-κB RelA / P65 protein; the microRNA maturation system processing means that the initially expressed miR must be cleaved and processed by these systems (some proteins and their complexes) to become a mature miR before it can exert its function; the main steps of this process include the initial transcription product of miR, pri-miRNA, being processed into pre-miRNA by the Drosh-DGCR8 complex in the cell nucleus; pre-miRNA is assisted by Exportin 5 protein to enter the cytoplasm from the cell nucleus; pre-miRNA is further processed into miRNA by the Dicer-TRBP complex in the cytoplasm.

[0014] Wherein, after the functional DNA fragment DMP-microRNA gene is introduced into cells, its functional element DMP can bind to the transcription factor protein NF-κB in the cell nucleus, thereby activating the expression of the microRNA gene.

[0015] The adeno-associated virus includes any one of various serotypes of adeno-associated viruses AAV1 to AAV9.

[0016] Preferably, the adeno-associated virus is AAV2.

[0017] The invention relates to the use of the in vivo delivery recombinant adeno-associated virus in the preparation of cancer treatment reagents or drugs.

[0018] The method for constructing a recombinant adeno-associated virus for in vivo delivery comprises the following steps:

[0019] (1) synthesizing oligonucleotides, annealing with base-complementary oligonucleotides and extending with DNA polymerase to generate a DMP-miR533 fragment, then amplifying the linear DMP-miR533 fragment using primers hDMP-miR533MIuI F1 and hDMP-miR533EcoRI R1, and then cloning into the pAAV-MCS vector using the MIuI and EcoRI restriction sites to construct the pAAV-DMP-miR533 plasmid;

[0020] (2) In order to generate five copies of DMP-miR533, four pairs of specific primers were used to linearly amplify the DMP-miR533 fragment; the four pairs of specific primers were: hDMP-miR533EcoRI F2 and hDMP-miR533BamHI R2, hDMP-miR533BamHI F3 and hDMP-miR533SalI R3, hDMP-miR533SalI F4 and hDMP-miR533HindIII R4, hDMP-miR533HindIII F5 and hDMP-miR533BglII R5, and the four fragments were digested with four pairs of restriction endonucleases; the four pairs of restriction endonucleases were: EcoRI and BamHI, BamHI and SalI, SalI and HindIII, HindIII and BglII, respectively. The cleavage products were sequentially cloned into the pAAV-DMP-miR533 vector to construct the pAAV-5×DMP-miR533 vector targeting the human RelA gene;

[0021] (2) 293T cells were transfected with pAAV-DMP-miR533 or pAAV-5×DMP-miR533 plasmids and two helper plasmids, pAAV-Helper and pAAV-RC. After cell culture, the virus was extracted and the aqueous phase containing the purified virus was collected. The obtained viruses were named rAAV-DMP-miR533 and rAAV-5×DMP-miR533.

[0022] Preferably, the main process for constructing the recombinant adeno-associated virus for in vivo delivery includes the following steps:

[0023] (1) Obtain mouse and human NF-κB RelA gene sequences from the NCBI database and use the online BLOCK-iTTM The RNAiDesigner platform was used to design microRNA oligonucleotide sequences targeting human / mouse NF-κB RelA. Based on the specific promoter vector pDMP-miR developed in this laboratory, pDMP-miR533 (targeting NF-κB RelA) expression vectors were constructed. The gene expression cassettes of the above vectors were obtained by restriction endonuclease digestion and cloned into recombinant adeno-associated virus vectors (pAAV-MCS) to obtain pAAV-DMP-miR533 expression vectors. At the same time, a negative control vector pAAV-miRNT (NT is the abbreviation for notranscript, which can express a microRNA that does not target any transcript) was constructed. The above vector systems are designed for human and mouse genes respectively, and are used for subsequent experiments in human / mouse cells and mouse models.

[0024] (2) The DMP-miR533 functional fragment was recovered from the pDMP-miR533 vector by enzyme digestion and ligated to the pAAV-MCS vector to construct pAAV-DMP-miR533.

[0025] (3) 293T cells were transfected with pAAV-DMP-miR533 and two auxiliary plasmids, pAAV-Helper and pAAV-RC. After cell culture, the cells and culture medium were collected and frozen-thawed. Pure chloroform was added to the lysate of the frozen-thawed cells. After shaking, NaCl was added to the mixture and shaken until the NaCl dissolved. After centrifugation, the supernatant was collected, PEG8000 was added and shaken until it dissolved. The supernatant was discarded by centrifugation, and the precipitate was dissolved. DNase and RNase were then added to the dissolved precipitate. The reaction was incubated at room temperature and then extracted. The aqueous phase containing the purified virus was collected. After the virus was quantified, it was aliquoted and stored at -80°C for later use. The obtained virus was named rAAV-DMP-miR533 (abbreviated as rAAV-miR533).

[0026] Wherein, the cancer includes liver cancer, leukemia or colon cancer.

[0027] Wherein, the in vivo delivery of recombinant adeno-associated virus is used in the preparation of cancer treatment reagents or drugs through intravenous injection or intratumoral injection.

[0028] Preferably, the rAAV-miR533 of the present invention can be used to prepare a novel safe anticancer agent that can be administered in a variety of ways.

[0029] Furthermore, the rAAV-miR533 can be injected intravenously and intratumorally; intravenous injection can be used for systemic treatment of cancer, while intratumoral injection can be used for local treatment of cancer.

[0030] The present invention has prepared a recombinant adeno-associated virus (rAAV-DMP-miR533) containing DMP, an NF-κB-specific promoter formed by linking an NF-κB decoy and a minimal promoter; and miR533, which encodes an artificial microRNA targeting NF-κB RelA. Experimental studies have shown that these viruses have a good therapeutic effect on hepatocellular carcinoma modeled by H22 cells, leukemia modeled by WEHI-3 cells, and colon cancer modeled by CT26 cells in mice. The rAAV-miR533 also exhibits good tumor selectivity and safety in treating these cancer models. This invention is expected to provide a new technology and reagent for the treatment of various cancers.

[0031] The gene expression vector prepared by this invention can selectively and significantly inhibit the expression of the NF-κB RelA molecule in cancer cells. Using an adeno-associated virus as the in vivo delivery vehicle for this gene expression vector, the constructed recombinant adeno-associated virus has demonstrated promising therapeutic effects against liver cancer, leukemia, and colon cancer in mice, demonstrating excellent tumor targeting and safety in treating these cancerous mice. This invention is expected to provide a new technology and reagent for the treatment of various cancer diseases.

[0032] The present invention is based on the applicant's previously established tumor NF-κB activity-responsive gene expression technology (which has demonstrated high tumor selectivity and safety in ferroptosis therapy: Gao J, Luo T, Wang J. Gene interfered-ferroptosis therapy for cancers. Nat Commun. 2021 Sep 7; 12(1): 5311). The present invention develops a new cancer gene therapy to break through the current bottleneck of NF-κB inhibitors in pharmaceutical manufacturing and clinical application. Animal experiments have shown that rAAV vectors have shown significant anti-tumor activity, high tumor selectivity, and good safety.

[0033] Despite remarkable advances in cancer research, including the introduction of new diagnostic and therapeutic tools, which have led to substantial progress in cancer treatment and prevention, cancer remains a major global health challenge. Genomic instability and genetic diversity are considered key hallmarks of cancer, contributing to treatment resistance and disease progression. Conventional radiotherapy and chemotherapy are effective in targeting proliferating cancer cells; however, they often cause collateral damage to normal cells. Therefore, there is an urgent need to develop more effective cancer therapies that can selectively target cancer cells while sparing normal tissues.

[0034] Because NF-κB is constitutively activated in inflammation and cancer, it has become a promising target for cancer therapy. Unlike traditional strategies for inhibiting NF-κB activity, in this study, a DNA fragment, designated DMP-miR533, was constructed, containing the NF-κB-specific promoter DMP and an artificial microRNA targeting NF-κB RelA. A construct containing five copies of the DMP-miR533 fragment, designated 5×DMP-miR533, was developed. The antitumor effects of the DMP-miR533 strategy were subsequently investigated at both the cellular and systemic levels. The results demonstrated that both DMP-miR533 and 5×DMP-miR533 exhibited significant antitumor effects both in vitro and in vivo. Notably, DMP-miR533 demonstrated significant antitumor activity in three established mouse cancer models: an H22 cell-induced hepatocellular carcinoma model, a WEHI-3 cell-induced leukemia model, and a CT-26 cell-induced colon cancer model. Furthermore, 5×DMP-miR533 demonstrated superior antitumor efficacy compared to DMP-miR533 in both in vitro and in vivo experiments. Importantly, both DMP-miR533s exhibited good biosafety in these treatments.

[0035] Decoy oligonucleotides, small interfering RNA (siRNA), and chemical compounds are the three main agents used to inhibit the intracellular activity of NF-κB and its signaling pathway. However, NF-κB decoys are easily enzymatically degraded in vivo and require repeated high-dose administration for sustained inhibition, hindering their development as clinical drugs to date. Similarly, the clinical application of siRNA technology targeting NF-κB activity has been hampered by challenges in intracellular delivery, effective dosing, and overall efficacy. Furthermore, no chemical inhibitors have demonstrated efficacy against NF-κB activity in clinical trials. These observations suggest that therapeutic strategies aimed at directly or indirectly inhibiting NF-κB activity are currently impractical. The underlying reason is that NF-κB has a double-edged sword effect. While it plays a detrimental role in diseases such as inflammation and cancer, its basal activity is essential for normal cellular function. In summary, anti-tumor strategies targeting NF-κB often lack specificity for cancer cells. A significant advantage of the DMP-miR533 anti-tumor strategy compared to traditional NF-κB inhibitors such as decoys, siRNA, and chemical compounds is that it avoids excessive inhibition of NF-κB activity in normal cells. Furthermore, DMP-miR533 is a typical sensor-effector gene therapy expression vector. DMP-miR533 can sense (sensing) whether there is excessive NF-κB activity within cells and respond (effecting). Therefore, DMP-miR533 can monitor and regulate NF-κB activity within cells; this is the fundamental difference between the present invention and traditional NF-κB inhibitors, which only have effects but no sensing. In the DMP-miR533 system, increased NF-κB activity is associated with enhanced DMP transcriptional activity and elevated miR533 transcriptional levels. The present invention also demonstrates that both DMP-miR533 and 5×DMP-miR533 can induce significant apoptosis in cancer cells with elevated NF-κB activity without affecting the growth of normal cells with low NF-κB activity. Therefore, the DMP-miR533 anti-tumor strategy mitigates the side effects associated with traditional NF-κB inhibitors and has transformative potential.

[0036] The present invention aimed to investigate the in vivo antitumor efficacy of the DMP-miR533 strategy by packaging DMP-miR533 and 5×DMP-miR533 into adeno-associated virus (AAV) gene delivery vectors, creating rAAV-DMP-miR533 and rAAV-5×DMP-miR533. Results showed that the rAAV constructs effectively inhibited tumor growth in three mouse models without causing side effects or toxicity. AAV is the first vector system approved for clinical use due to its ability to transduce a wide range of species in vivo without evidence of toxicity. It offers several advantages, including tropism for dividing and non-dividing cells, lack of host genome integration, stable long-term transgene expression, high transgene production, and low immunogenicity. Despite the limited packaging capacity of AAV vectors (~4.7 kb), the short length of the DMP and microRNA coding sequences enabled the inclusion of five DMP-miR533 cassettes within a single AAV viral particle. This packaging strategy enhances the potential for increasing viral dosing and improving therapeutic efficacy. Furthermore, DMPs are considered weak promoters; however, the ability of AAV vectors to promote stable, long-term transgene expression offers advantages for efficient microRNA translation. In this study, it was demonstrated that neither rAAV-DMP-miR533 nor rAAV-5×DMP-miR533 exhibited significant toxicity in mouse models at the doses administered. Notably, even after three systemic administrations of the highest dose in a mouse model of colon cancer, rAAV-DMP-miR533 and rAAV-5×DMP-miR533 did not produce any detectable effects on biochemical markers or spleen function. Furthermore, this study demonstrates for the first time that rAAV-DMP-miR533, an artificial microRNA targeting NF-κBRelA, can effectively inhibit tumor growth in vivo. Furthermore, the multiple tandem administrations of rAAV-DMP-miR533 (rAAV-5×DMP-miR533) achieved significant anti-tumor effects without causing side effects or toxicity. Therefore, rAAV-DMP-miR533 represents a novel and safe strategy for targeting NF-κB with potential applications in anti-tumor gene therapy and can be used to treat other diseases caused by excessive NF-κB activation, such as inflammation.

[0037] Beneficial effects: Compared with the prior art, the present invention has the following advantages:

[0038] This invention proposes for the first time the use of a gene expression vector for cancer therapy in the preparation of a recombinant adeno-associated virus for in vivo delivery. This invention develops a novel anti-tumor strategy, DMP-miR533, which effectively exploits overactivated NF-κB activity in cancer cells. This approach contrasts with current strategies that inhibit NF-κB activity through various inhibitors. Using adeno-associated virus (AAV) as a delivery vector, the anti-tumor efficacy of the DMP-miR533 strategy was evaluated in multiple cancer cell lines and mouse models, including hepatocellular carcinoma, leukemia, and colon cancer. Furthermore, the invention proposes the use of the in vivo delivered recombinant adeno-associated virus in the preparation of a cancer therapeutic agent or drug. The results of the present invention demonstrate that rAAV-DMP-miR533 exhibits significant anti-tumor efficacy and good biosafety in these cancer models. Therefore, this invention presents a promising universal gene therapy approach that is applicable to a variety of cancer types by directly targeting NF-κB. Furthermore, it has the potential to treat other diseases characterized by overactivated NF-κB, such as anti-aging by eliminating senescent cells. BRIEF DESCRIPTION OF THE DRAWINGS

[0039] Figure 1 Schematic diagram of the anti-tumor strategy using DMP-miR533 and the detection of NF-κB expression levels in cells. (A) Schematic diagram of the cancer treatment approach using DMP-miR533, highlighting components such as Decoy Minimal Promoter (DMP), RNA polymerase II (Pol II), RNase III enzyme Dicer, RNA-induced silencing complex (RISC), and RNA interference (RNAi). (B) NF-κB expression levels in cancer cells and normal cells. Notably, cancer cell lines A549, BGC823, and CT-26 exhibited overactivation of NF-κB, while normal cell lines MRC-5, GES-1, and NIH / 3T3 showed weak NF-κB activity. NF-κB RelA expression was quantified using qPCR (n = 3 wells).

[0040] Figure 2To evaluate the results of human cell responses to DMP-miR533. A549, BGC823, MRC-5, and GES-1 cell lines were transfected with different plasmids and subsequently cultured for 24, 48, and 72 hours, respectively. (A) Representative fluorescence images of cells stained with acridine orange / ethidium bromide (AO / EB). Scale bar: 100 μm. (B) Quantification of living cells at the indicated time intervals. Quantification was performed using ImageJ 2× software to analyze AO / EB-stained fluorescence images (n=3 images). (C) Growth curve of cell viability. Cell viability was detected using CCK-8 assay (n=3 wells). (D) Relative expression levels of NF-κB and its target genes. Cells were transfected with different plasmids and cultured for 24 hours (n=3 wells). Gene expression analysis was then performed using qPCR, and relative quantification (RQ) was calculated as 2 –ΔΔCt In the figure, pAAV-DMP-miRNT is abbreviated as pmiRNT; pAAV-DMP-miR533 is abbreviated as pmiR533; and pAAV-5×DMP-miR533 is abbreviated as p5×miR533.

[0041] Figure 3 To evaluate the results of mouse cell response to DMP-miR533. CT-26 and NIH / 3T3 cells were transfected with different plasmids and then cultured for 24, 48, and 72 hours. (A) Representative fluorescence images of cells stained with AO / EB, the scale bar represents 100 μm. (B) Quantification of viable cells at different time points. Quantification was performed using ImageJ 2× software to analyze the fluorescence images of AO / EB staining (n = 3 images). (C) Cell viability curve. Cell viability was assessed using CCK-8 assay (n = 3 wells). (D) Relative expression levels of NF-κB and its target genes in CT-26 and NIH / 3T3 cells transfected with different plasmids and cultured for 24 hours (n = 3 wells). Gene expression analysis was performed using qPCR, and relative quantification (RQ) was calculated as 2 –ΔΔCt In the figure, pAAV-DMP-miRNT is abbreviated as pmiRNT; pAAV-DMP-miR533 is abbreviated as pmiR533; and pAAV-5×DMP-miR533 is abbreviated as p5×miR533.

[0042] Figure 4Results of rAAV evaluation. (A) Representative fluorescence images showing infection of hematologic cancer cell lines with rAAV-DMP-miR533. HL-60, KG-1a, and WEHI-3 cells were infected with various rAAV vectors and cultured for 1 to 10 days. HL-60 and KG-1a cells were stained with AO / EB and imaged using fluorescence microscopy, while WEHI-3 cells were imaged under bright-field microscopy. Scale bar: 100 μm. (B) Growth curves showing the viability of hematologic cancer cells, determined by CCK-8 assay (n = 3 wells). (C) Representative fluorescence images of cells stained with AO / EB. MDA-MB-453, CT-26, HL7702, and NIH / 3T3 cells were infected with various rAAV vectors and cultured for 24, 48, and 72 hours, respectively. Scale bar: 100 μm. (D) Growth curves depict the viability of MDA-MB-453, CT-26, HL7702, and NIH / 3T3 cells, assessed by CCK-8 assay (n = 3 wells). In the figure, rAAV-DMP-miRNT is abbreviated as rAAV-miRNT; rAAV-DMP-miR533 is abbreviated as rAAV-miR533; and rAAV-5×DMP-miR533 is abbreviated as rAAV-5×miR533.

[0043] Figure 5 Results of using rAAV-DMP-miR533 to treat hepatocellular carcinoma and leukemia in mouse models. (A) Schematic diagram of the development and therapeutic intervention of the H22-induced hepatocellular carcinoma mouse model. The model was established by intraperitoneal injection (ii) of H22 cells and then treated with intravenous (iv) rAAV-MCS (n=5) and rAAV-DMP-miR533 (n=6). (B) Body weight measurement of hepatocellular carcinoma mice after inoculation. (C) Survival analysis of hepatocellular carcinoma mice after viral administration. (D) Schematic diagram of the development and therapeutic intervention of the WEHI-3-induced leukemia mouse model. The leukemia model was established by subcutaneous injection (sc) of WEHI-3 cells and treated with intravenous (iv) rAAV. (E) Representative images of leukemic mice after intravenous injection of rAAV-MCS (n=10) and rAAV-DMP-miR533 (n=10). (F) Representative images of leukemia mouse tumors after intravenous injection of rAAV-MCS and rAAV-DMP-miR533. (G) Comparative analysis of tumor size in leukemia mice before and after intravenous injection of rAAV-MCS and rAAV-DMP-miR533. In the figure, rAAV-DMP-miR533 is abbreviated as rAAV-miR533.

[0044] Figure 6Results of rAAV-DMP-miR533 treatment of colon cancer in a mouse model. (A) Schematic diagram of the establishment of a CT-26-induced mouse colon cancer model and subsequent treatment regimen. The model was established by intravenous (iv) injection of CT-26 cells, followed by intravenous injection of PBS (n=10), rAAV-DMP-miRNT (n=10), rAAV-DMP-miR533 (n=10), and rAAV-5×DMP-miR533 (n=10). (B) Mouse body weight. (C) Mouse tumor size measurement. (D) Imaging of mouse tumors and spleens. (E) Mouse tumor weight. (F) Mouse spleen weight. (G) Serum biochemical indices: ALP, ALT, and AST (reflecting liver toxicity). (H) Serum biochemical indices: UREA, UA, and CREA (reflecting kidney toxicity). (I) Abundance of viral DNA, miR533, and RelA expression in various mouse tissues (expr.). Viral DNA abundance, miR533, and RelA expression were detected using qPCR, and the relative expression levels were expressed as 2 -ΔCt In the figure, rAAV-DMP-miRNT is abbreviated as rAAV-miRNT; rAAV-DMP-miR533 is abbreviated as rAAV-miR533; and rAAV-5×DMP-miR533 is abbreviated as rAAV-5×miR533. DETAILED DESCRIPTION

[0045] The present invention will be further described below with reference to the accompanying drawings and examples.

[0046] Unless otherwise specified, the materials and reagents used in the examples can be obtained from commercial sources.

[0047] 1. Construction of vector

[0048] The complete sequence of human RelA / p65 mRNA (NCBI accession number BC014095) was cloned into BLOCK-iT TMRNAiDesigner (https: / / rnaidesigner.thermofisher.com / rnaiexpress / ) was used to identify potential microRNAs, ultimately identifying miR533 (CAAAGATGG GAT GAGAAA GGA). Two complementary oligonucleotides, designated hDMP-miR533F and hDMP-miR533R, were synthesized. These oligonucleotides contain five canonical κB sites (GGGAATTTCCGGGGACTTTCC GGGAATTTCC GGGGACTTTCC GGGAATTTCC), which serve as NF-κB bait, a minimal promoter sequence (TAGAGGGTAT ATAATGGAAG CTCGACTTCC AG), and the miR533 sequence (TGC TGC AAA GAT GGG ATGAGAAAG GAG TTT TGG CCA CTG ACT GAC TCC TTT CTT CCC ATC TTT G). The oligonucleotides were annealed and extended to generate the DMP-miR533 fragment. The linear DMP-miR533 fragment was then amplified using primers hDMP-miR533MIuI F1 and hDMP-miR533EcoRI R1 and then cloned into the pAAV-MCS vector (Stratagene) using MIuI and EcoRI restriction sites (ThermoFisher Scientific) to construct the pAAV-DMP-miR533 plasmid. To generate five copies of DMP-miR533, DMP-miR533 fragments were linearly amplified using specific primers: hDMP-miR533EcoRI F2 and hDMP-miR533BamHI R2, hDMP-miR533BamHI F3 and hDMP-miR533SalI R3, hDMP-miR533SalI F4 and hDMP-miR533HindIII R4, and hDMP-miR533HindIII F5 and hDMP-miR533BglII R5. These fragments were sequentially cloned into the pAAV-DMP-miR533 vector using restriction sites for EcoRI and BamHI, BamHI and SalI, SalI and HindIII, and HindIII and BglII, provided by ThermoFisher Scientific. This process ultimately resulted in the construction of the pAAV-5×DMP-miR533 vector targeting human RelA. See Table 1 for details on primer and oligonucleotide sequences.

[0049] Table 1. Oligonucleotides used to construct miR533 expression vector targeting human RelA

[0050]

[0051]

[0052] Note: Underline indicates restriction enzyme cutting site.

[0053] Similarly, the complete sequence of mouse RelA / p65 mRNA (NCBI accession number BC094053) was cloned into the block-iT TMRNAi Designer (https: / / rnaidesigner.thermofisher.com / rnaiexpress / ) was used to identify potential miRNAs, ultimately identifying miR533 (TAC TCT TGA AGG TCT CAT AGG), which targets mouse RelA. Two complementary oligonucleotides were synthesized and designated mDMP-miR533F and mDMP-miR533R. These oligonucleotides contain the NF-κB decoy sequence (same as above), a minimal promoter sequence (same as above), and the miR533 sequence (TGC TGT ACT CTTGAA GGT CTC ATA GGG TTT TGG CCA CTG ACT GAC CCT ATG AGC TTC AAG AGT A). The oligonucleotides were annealed and extended to generate the DMP-miR533 fragment. The linear DMP-miR533 fragment was then amplified using primers mDMP-miR533MIuI F1 and mDMP-miR533EcoRI R1 and cloned into the pAAV-MCS vector (Stratagene) using MIuI and EcoRI restriction sites (ThermoFisher Scientific) to construct the pAAV-DMP-miR533m plasmid. To generate five copies of miR533, DMP-miR533 fragments were linearly amplified using specific primers: mDMP-miR533EcoRI F2 and mDMP-miR533BamHI R2, mDMP-miR533BamHI F3 and mDMP-miR533SalIR3, mDMP-miR533SalI F4 and mDMP-miR533HindIII R4, and mDMP-miR533HindIII F5 and mDMP-miR533BglII R5. These fragments were sequentially cloned into the pAAV-DMP-miR533m vector using restriction sites for EcoRI and BamHI, BamHI and SalI, SalI and HindIII, and HindIII and BglII (provided by ThermoFisher Scientific). This process ultimately resulted in the construction of the pAAV-5×DMP-miR533m vector targeting mouse RelA. See Table 2 for details on primer and oligonucleotide sequences.

[0054] Table 2. Oligonucleotides used to construct miR533 expression vector targeting mouse RelA

[0055]

[0056]

[0057] Note: Underline indicates restriction enzyme cutting site.

[0058] The negative control vector pDMP-miRNT used in the present invention was derived from the applicant's earlier study: Gao J, Luo T, Wang J. Gene interfered-ferroptosis therapy for cancers. Nat Commun. 2021 Sep 7; 12(1): 5311). The sequence of miRNT is TGC TGAAAT GTA CTG CGC GTG GAGACG TTT TGGCCACTGACT GAC GTC TCCACG CAG TACATT T.

[0059] The above vectors are used to transfect in vitro cultured cells of human or mouse origin, respectively. Vectors targeting human genes are used to transfect human cells, while vectors targeting mouse genes are used to transfect mouse cells. The cell species of origin are described below.

[0060] 2. Cell culture

[0061] Cancer cell lines used in the present invention include A549 (human non-small cell lung cancer), BGC-823 (human gastric cancer), HL-60 (human promyelocytic acute leukemia), KG-1a (human acute myeloid leukemia), MDA-MB-453 (human breast cancer), H22 (mouse hepatic ascites tumor), WEHI-3 (mouse acute monocytic leukemia), and CT-26 (mouse colorectal cancer). Normal cell lines include HEK-293T (human fetal kidney), MRC-5 (human embryonic lung fibroblasts), GES-1 (human gastric epithelium), HL7702 (human normal hepatocytes), and NIH / 3T3 (mouse embryonic fibroblasts). Specifically, BGC-823, MDA-MB-453, H22, WEHI-3, CT-26, HEK-293T, and NIH / 3T3 cells were cultured in Dulbecco's modified Eagle's medium (DMEM) (Gibco); A549, GES-1, and HL7702 cells were cultured in Roswell Park Memorial Institute (RPMI) 1640 medium (Gibco); HL-60 and KG-1a cells were cultured in Isoff's modified Dulbecco's medium (IMDM) (Gibco); and MRC-5 cells were cultured in minimum essential medium (MEM) (Gibco).

[0062] All culture media were supplemented with 10% fetal bovine serum (FBS) (HyClone), 100 units / ml penicillin, and 100 μg / ml streptomycin (ThermoFisher). Cell lines were originally purchased from the Cell Resource Center of the Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences, and incubated in a humidified incubator at 37°C with 5% carbon dioxide.

[0063] 3. Cell processing

[0064] A549, BGC-823, CT-26, MRC-5, GES-1, and NIH / 3T3 cells were seeded into 24-well plates at a density of 1×10^5 cells per well and cultured overnight. Transfection was performed using the 2000 (ThermoFisher) according to the manufacturer's protocol. First, cells were incubated in 500 μL Buffer (ThermoFisher) was incubated at 37°C for 30 minutes. Two stock solutions were prepared: the first contained 50 μL of Opti-MEM buffer containing 500 ng of each plasmid, including pAAV-DMP-miRNT (which expresses miRNA without a targeted transcript and is maintained in our laboratory), pAAV-DMP-miR533 targeting human or mouse RelA, and pAAV-5×DMP-miR533 targeting human or mouse RelA. The second solution consisted of 50 μL of Opti-MEM buffer and 2 μL 2000. These solutions were vortexed and incubated at room temperature for 5 minutes. Subsequently, the Opti-MEM / Lipofectamine solution was added dropwise to the Opti-MEM / plasmid solution, vortexed again, and incubated at room temperature for 20 minutes. Finally, the Opti-MEM / Lipofectamine / plasmid mixture was added to the corresponding wells. After a 4-hour incubation period, the medium in each well was replaced with 500 μL of fresh DMEM, RPMI 1640, or MEM supplemented with 10% FBS. Subsequently, the cells were incubated at 37°C in an atmosphere containing 5% carbon dioxide. At 24, 48, and 72 hours after transfection, the cells were washed twice with PBS and stained with acridine orange / ethidium bromide (AO / EB) (Sangon Biotech) according to the manufacturer's instructions, resulting in a uniform green color for live cells. Subsequently, cells were observed and imaged using a fluorescence microscope (IX51, Olympus) at a constant magnification of 200×, and cell counting was performed using ImageJ 2× software.

[0065] 4. Cell Viability Measurement

[0066] To evaluate cell viability, A549, BGC-823, CT-26, MRC-5, GES-1, and NIH / 3T3 cells were seeded into 96-well plates at a density of 5 × 10^3 cells per well and cultured overnight. 2000 100 ng of plasmids, including pAAV-DMP-miRNT, pAAV-DMP-miR533 for human or mouse RelA, and pAAV-5×DMP-miR533 for human or mouse RelA, were transfected into cells. After 4 hours of incubation, the culture medium in each well was replaced with 100 μL of fresh DMEM, RPMI 1640, or MEM culture medium containing 10% FBS. At 24, 48, and 72 hours after transfection, 10 μL of cell Counting Kit-8 reagent (CCK-8) (YEASEN) was added to each well. Then, incubate at 37°C in a 5% carbon dioxide humidity incubator for 1 hour, and measure the absorbance at 450 nm using a microplate reader (BioTek). Untransfected cells were used as negative controls, and cell viability was calculated using the following formula: [(A450 of treatment group wells - A450 of negative control wells) / (A450 of control treatment group wells - A450 of negative control wells)]×100%.

[0067] 5. Quantitative PCR (qPCR) detection

[0068] Cell lines A549, BGC-823, CT-26, MRC-5, GES-1, and NIH / 3T3 were seeded into 6-well plates at a density of 1.5×10^6 cells per well and cultured overnight. 2500 ng of plasmid DNA, including pAAV-DMP-miRNT, pAAV-DMP-miR533 targeting human or mouse RelA, and pAAV-5×DMP-miR533 also targeting human or mouse RelA, were transfected into these cells. After a 24-hour transfection period, the cells were transfected using the manufacturer's protocol. Total RNA was extracted from cultured cells using a SYBR Green real-time PCR system (Invitrogen). RNA concentration was determined using a NanoDrop 2000 spectrophotometer (ThermoFisher). Next, 500 ng of total RNA was reverse transcribed into complementary DNA (cDNA) using PrimeScript™ RT MasterMix (TaKaRa) according to the manufacturer's instructions in a total reaction volume of 10 μL. Quantitative PCR (qPCR) was used to quantify the mRNA expression levels of NF-κB target genes, including RelA, NF-κB1, MMP9, IL-6, and CCL2, using an ABI Step One Plus system (Applied Biosystems). A 20 μL qPCR reaction mixture contained 10 μL SYBR Green Real-Time PCR Master Mix (2×) (Roche), 0.25 μM of each primer, and 2 μL cDNA. The qPCR experimental process is as follows: first, denaturation at 95°C for 10 minutes, followed by 45 cycles of denaturation treatment, each cycle consisting of 15 seconds of denaturation at 95°C and 1 minute of annealing / extension at 60°C. Melting curve analysis confirmed the presence of a single PCR product. The Ct value was normalized by subtracting the Ct value of GAPDH and calculated using the instrument software. The mRNA expression level is expressed as relative quantification (RQ) with the formula RQ = 2 -ΔCt or RQ = 2 -ΔΔCt , where ΔCt = Cttarget - CtGAPDH, and ΔΔCt = ΔCttreatment - ΔCtcontrol. Each qPCR assay was performed in at least three technical replicates. The primers used for qPCR are listed in Table S.

[0069] Table 3. Oligonucleotides used as qPCR primers

[0070]

[0071]

[0072] 6. rAAV Preparation

[0073] HEK-293T cells were seeded at a density of 5 × 10 cells per flask in a 75 cm 2 The cells were then transfected with 4 μg of different pAAV plasmids, including pAAV-MCS, pAAV-DMP-miRNT, and pAAV-DMP-miR533 targeting human and mouse RelA, as well as pAAV-5×DMP-miR533 targeting human and mouse RelA. In addition, 4 μg of pAAV-RC (Stratagene) and pHelper (Stratagene) were used, and the cells were transfected with 2000 as a transfection reagent. The cells were cultured for another 72 hours. To prepare the viral lysate, the transfected HEK-293T cells were collected with a cell scraper and transferred to a 50 mL upright conical tube. The cells underwent three freeze-thaw-vortex cycles, including freezing at -80°C overnight, thawing in a 37°C water bath for 1 hour, and vigorous vortexing. Cell debris was first removed by centrifugation at 10,000g for 10 minutes at room temperature, and the supernatant was then collected into a new 50 mL conical tube as the initial rAAV lysate. Subsequently, chloroform was added to the supernatant at a ratio of 1:10 (v / v) and incubated with rotation at 37°C for 1 hour. Finally, solid sodium chloride was added to the mixture to a final concentration of 1 M. The supernatant was obtained by centrifugation at 10,000g for 15 minutes at 4°C and then transferred to a new 50 mL conical tube. Polyethylene glycol (PEG8000, Sigma) was added to a final concentration of 10%. After the mixture was frozen on ice for 1 hour, it was centrifuged at 12,000g for 15 minutes at room temperature and the supernatant was removed. The resulting precipitate was resuspended in PBS buffer, which was considered an intermediate recombinant adeno-associated virus (rAAV) product. To concentrate and purify rAAV, the intermediate product was treated with 1 μg / mL of DNase and RNase and incubated at room temperature for 30 minutes. An equal volume of chloroform was then added and the mixture was rotated and stirred. Afterwards, the mixture was centrifuged at 10,000g for 10 minutes at 4°C to collect the supernatant, which was the final rAAV product. Five different final rAAV products were prepared and named rAAV-MCS, rAAV-DMP-miRNT, rAAV-DMP-miR533, and rAAV-5×DMP-miR533.

[0074] 7. rAAV titration

[0075] Recombinant Adeno-Associated Virus (rAAV) Titer Assessment The titer of recombinant adeno-associated viruses (rAAVs) was determined by quantitative polymerase chain reaction (qPCR) using primers rAAV-qF and rAAV-qR (see Table 3). A standard DNA fragment consisting of 160 base pairs of AAV genomic DNA with a known molecular copy number was used as a reference sample for constructing a standard curve. This standard was serially diluted 5-fold, with concentrations ranging from 1:5 to 1:55. The viral genome concentration (vg) was calculated based on the established standard curve, and the quantified virus samples were stored at -80°C for subsequent experiments.

[0076] 8. rAAV infection of cells

[0077] Cell lines, including HL-60, KG-1a, WEHI-3, MDA-MB-453, CT-26, HL7702, and NIH / 3T3, were seeded in 24-well plates at a density of 1×10^5 cells per well and cultured overnight. Subsequently, rAAV variants—rAAV-MCS, rAAV-DMP-miRNT, rAAV-DMP-miR533, and rAAV-5×DMP-miR533—were infected at a multiplicity of infection of 1×10^4 vg per cell. After infection, cells were cultured, stained with acridine orange / ethidium bromide (AO / EB), and imaged at 200× magnification using a fluorescence microscope (model IX51; Olympus). Cell viability was assessed using the Cell Counting Kit-8 (CCK-8) assay as described previously.

[0078] 9. Animal experiments

[0079] In the present invention, three different animal models were used. For the hepatocellular carcinoma model, BALB / c mice were intraperitoneally injected with 2×10^6 H22 cells and the tumors were allowed to grow for seven days. Subsequently, the tumor-bearing mice were randomly divided into two groups: rAAV-MCS (n=5) and rAAV-DMP-miR533 (n=6). Each group received an intravenous injection of 1×10^9 viral genomes (vg), either rAAV-MCS or rAAV-DMP-miR533. Five days after the initial injection, the same viral vector was injected intravenously again. Body weight was monitored daily and used for survival analysis. In the leukemia model, BALB / c mice were subcutaneously transplanted with 1×10 7 WEHI-3 cells were injected into the inner thigh to establish a WEHI-3 xenograft model. Six days after tumor formation, the tumor-bearing mice were randomly divided into two groups: rAAV-MCS (n=10) and rAAV-DMP-miR533 (n=10). Each group received an intravenous injection of 1×10^9 of the corresponding viral vector. The mice were euthanized and photographed on the seventh day after viral injection. The tumor was resected and its size was measured using a precision caliper. The tumor volume was calculated using the formula V=(Dd 2 ) / 2, where D represents the primary tumor axis and d represents the secondary tumor axis. In the experimental model of colon cancer treatment, BALB / c mice were subcutaneously implanted with 1×10 6CT-26 cells were injected into the inner thigh to establish a CT-26 xenograft model. The mice were maintained for 8 days to promote tumor growth. Subsequently, the tumor-bearing mice were randomly divided into four groups: PBS (n=10), rAAV-DMP-miRNT (n=10), rAAV-DMP-miR533 (n=10) and rAAV-5×DMP-miR533 (n=10). Each group received three intravenous injections, one day apart, of PBS, 1×10^10 vg of rAAV-DMP-miRNT, rAAV-DMP-miR533 and rAAV-5×DMP-miR533. Body weight and tumor size were monitored daily. Tumor volume was calculated by the formula V=(Dd 2 ) / 2, where D is the major tumor axis and d is the minor tumor axis. On the ninth day after the initial viral injection, the mice were euthanized and photographed. The tumor and spleen of each mouse were removed, weighed, and photographed. Serum samples were collected from each group for routine hematological analysis and evaluation of serum biochemical parameters. These parameters include alkaline phosphatase (ALP), alanine aminotransferase (ALT) and aspartate aminotransferase (AST) to evaluate liver function; and urea, uric acid (UA) and creatinine (CREA) to evaluate renal function. Quantitative PCR (qPCR) was used to analyze viral genomic DNA (gDNA) from different parts of the body, including the heart, liver, spleen, lung, kidney and tumor tissues.

[0080] 10. Statistical analysis

[0081] Data are presented as mean ± standard deviation (SD). Statistical significance between two groups was assessed using a two-tailed unpaired t-test. Comparisons involving three or more groups were performed using one-way or two-way analysis of variance (ANOVA) with Tukey's post hoc correction for multiple comparisons. A p-value of less than 0.05 was considered statistically significant.

[0082] Example 1

[0083] The anti-tumor mechanism of DMP-miR533

[0084] In view of the advantages and limitations of current NF-κB inhibition strategies such as decoy and siRNA, the present invention constructed a transgenic DMP-miRNA vector named DMP-miR533 ( Figure 1A). This vector is designed to express an artificial microRNA (miR533) that targets NF-κB RelA, which is regulated by the DMP promoter. The DMP promoter is specific for NF-κB and contains an NF-κB decoy and a minimal promoter. NF-κB is a sequence-specific DNA-binding transcription factor that is often overactivated in cancer cells. Therefore, when the DMP-miR533 vector is transfected into cancer cells, such as the human non-small cell lung cancer cell line A549, the human gastric cancer cell line BGC823, and the mouse colon cancer cell line CT-26, these cells all show NF-κB overactivation ( Figure 1 B), activated NF-κB binds to the decoy and initiates the transcription of miR533. This process then targets and degrades NF-κB RelA, ultimately inducing apoptosis in cancer cells. In contrast, when the DMP-miR533 vector was transfected into normal cells, such as the human fetal lung fibroblast cell line MRC-5, the human gastric epithelial cell line GES-1, and the mouse embryonic fibroblast cell line NIH / 3T3, these cells exhibited minimal NF-κB activity ( Figure 1 B) Due to the lack of sufficient NF-κB activation, miR533 transcription does not occur. To comprehensively evaluate the anti-tumor efficacy of the DMP-miR533 strategy in cell and animal models, miR533 constructs specifically targeting human and mouse NF-κB RelA transcripts were designed and synthesized. Human cells were treated with DMP-miR533 targeting human NF-κB RelA, while mouse cells and mice were treated with DMP-miR533 targeting mouse NF-κB RelA.

[0085] Example 2

[0086] In vitro anti-tumor effect of DMP-miR533

[0087] To evaluate the antitumor efficacy of the DMP-miR533 strategy, human non-small cell lung cancer A549 cells and human gastric cancer BGC823 cells, characterized by NF-κB hyperactivation, were first transfected with DMP-miR533 targeting human RelA for 24 to 72 hours. To enhance tumor cell killing, a construct containing five copies of DMP-miR533, designated pAAV-5×DMP-miR533, was developed and co-transfected to target human or mouse RelA. Furthermore, normal human cell lines, including human fetal lung fibroblasts MRC-5 and human gastric epithelial GES-1 cells, which exhibit minimal NF-κB activity, were also transfected with the same plasmid. All cell lines were also transfected with DMP-miRNT as a control. Cell viability was assessed using the CCK-8 assay at three different time points, and cells were stained with acridine orange / ethidium bromide (AO / EB). AO / EB staining results showed that the plasmids pAAV-DMP-miR533 and pAAV-5×DMP-miR533 targeting human NF-κB RelA induced significant time-dependent cytotoxic effects in human cancer cell lines A549 and BGC823. It is worth noting that the anti-tumor effect of pAAV-5×DMP-miR533 was better than that of pAAV-DMP-miR533. In addition, neither DMP-miR533 nor 5×DMP-miR533 had any effect on the normal human cell lines GES-1 and MRC-5. In addition, the negative control plasmid DMP-miRNT had no effect on any cell line at all treatment times, such as Figure 2 As shown in A.

[0088] At the same time, ImageJ software was used to quantify the number of surviving cells in the AO / EB staining images. The analysis showed that after transfection of pAAV-DMP-miR533 and pAAV-5×DMP-miR533, cancer cells underwent significant time-dependent apoptosis. After 72 hours of treatment, only a few cancer cells were still alive, which highlights the powerful anti-tumor effect of the pAAV-DMP-miR533 strategy. It is worth noting that compared with pAAV-DMP-miR533, pAAV-5×DMP-miR533 showed stronger cytotoxicity against A549 and BGC823 cells, as shown in Figure 3. Figure 2 This observation was validated by CCK-8 experiments, further confirming the effectiveness and specificity of the DMP-miR533 strategy in inducing cancer cell death, with 5×DMP-miR533 showing a more significant anti-tumor effect ( Figure 2C). Importantly, the DMP-miR533 system had no significant effect on the normal cell lines MRC-5 and GES-1. Similarly, cell count and viability assays confirmed that pAAV-DMP-miRNT had no effect on any cell line.

[0089] To further verify the anti-tumor effect of DMP-miR533 at the mRNA level, quantitative PCR (qPCR) was used to detect the expression of NF-κB RelA and its target genes NF-κB1, MMP9, IL-6, and CCL2. The results showed that in cancer cell lines A549 and BGC823, the expression of these genes was significantly reduced after transfection with pAAV-DMP-miR533 and pAAV-5×DMP-miR5335 compared with the pAAV-DMP-miRNT control group (p<0.05), while no significant changes were observed in normal cell lines MRC-5 and GES-1 (p>0.05) ( Figure 2 D). Notably, pAAV-5×DMP-miR533 transfection resulted in a more significant knockdown of RelA and NF-κB target genes (p≤0.0001), whereas pAAV-DMP-miR5335 transfection was not significant ( Figure 2 D). Furthermore, DMP-miRNT had no effect on gene expression in either cancer cells or normal cells. These findings suggest that the pAAV-DMP-miRNT anti-tumor strategy effectively inhibits the growth of cancer cells characterized by NF-κB overactivation by downregulating the expression of NF-κB and its target genes, with pAAV-5×DMP-miR533 exhibiting a more pronounced anti-tumor effect than pAAV-DMP-miR533.

[0090] To investigate the anti-tumor effects of the DMP-miR533 system targeting mouse NF-κB RelA, mouse colon cancer cells (CT-26) exhibiting NF-κB hyperactivation and mouse embryonic fibroblasts (NIH / 3T3) with minimal NF-κB activity were transfected with pAAV-DMP-miR5333 and pAAV-5×DMP-miR533 for durations ranging from 24 to 72 hours. Acridine orange / ethidium bromide (AO / EB) staining results showed that CT-26 cells underwent significant time-dependent cell death after transfection with pAAV-DMP-miR533 and pAAV-5×DMP-miR533, which target mouse NF-κB RelA. Notably, the anti-tumor effect of pAAV-5×DMP-miR533 was much greater than that of pAAV-DMP-miR533 ( Figure 3A). In contrast, pAAV-DMP-miR533 and pAAV-5×DMP-miR533 had no significant effect on normal mouse NIH / 3T3 cells. Survival curves showed that both pAAV-DMP-miR533 and pAAV-5×DMP-miR533 transfection induced significant time-dependent cell death in CT-26 cells. After 72 hours of treatment, very few surviving cells remained in CT-26 cells, highlighting the powerful anti-cancer effect of the DMP-miR533 system ( Figure 3 B). Cell viability curves demonstrate the effectiveness and specificity of the DMP-miR533 system in inducing apoptosis in CT-26 cancer cells, while having no effect on normal NIH / 3T3 mouse cells ( Figure 3 C). In addition, compared with the pAAV-DMP-miRNT control group, transfection with pAAV-DMP-miR533 and pAAV-5×DMP-miR533 significantly downregulated the expression of NF-κBRelA and its target genes NF-κB1, MMP9, IL-6, and CCL2 in CT-26 cancer cells ( Figure 3 D), but no such effect was observed in NIH / 3T3 normal cells ( Figure 3 D). Notably, results from AO / EB staining images, viable cell counts, cell viability assays, and gene expression analysis demonstrated that pAAV-5 × DMP-miR533 exhibited a stronger antitumor effect than pAAV-DMP-miR533. Taken together, these findings demonstrate that the DMP-miR533 system does not affect normal NIH / 3T3 cells, and that DMP-miRNT has no effect on any cell type. Overall, the DMP-miR533 strategy effectively inhibited NF-κB RelA expression, resulting in decreased cancer cell viability and increased cell death, highlighting its antitumor potential in vitro.

[0091] Example 3

[0092] In vitro anti-tumor effect of rAAV-DMP-miR533

[0093] To investigate the in vivo anti-tumor effects of DMP-miR533, DMP-miR533 and 5×DMP-miR533 were cloned into adeno-associated virus (AAV) vectors to generate recombinant viruses (rAAV). Initially, three blood cancer cell lines—human acute myeloid leukemia cell line HL-60, human acute myeloid leukemia cell line KG-1a, and mouse leukemia cell line WEHI-3—were infected with rAAV-MCS and rAAV-DMP-miR533 for periods ranging from 1 to 10 days. Imaging results showed that rAAV-DMP-miR533 targeting human and mouse NF-κB RelA induced significant time-dependent cytotoxic effects in HL-60, KG-1a, and WEHI-3 cells compared with rAAV-MCS infection ( Figure 4 A). In addition, cell viability assay confirmed the significant anti-tumor effect of rAAV-DMP-miR533 infection (p≤0.001) ( Figure 4 B), whereas infection with empty vector rAAV-MCS had no effect on the viability of these three cancer cell lines.

[0094] To further evaluate the efficacy and specificity of rAAV-DMP-miR533 in inducing cancer cell toxicity in vitro, human triple-negative breast cancer cells (MDA-MB-453) and CT-26 cells with overactivated NF-κB were exposed to rAAV-DMP-miR533 and rAAV-5×DMP-miR533 for a period of time ranging from 24 to 72 hours. At the same time, human hepatocytes (HL7702) and NIH / 3T3 cells were also treated with the same viruses. AO / EB staining image analysis showed that both rAAV-DMP-miR533 and rAAV-5×DMP-miR533 infection produced significant time-dependent cytotoxic effects on MDA-MB-453 and CT-26 cells, with extremely low cancer cell survival rates observed after 72 hours of treatment ( Figure 4 C). Notably, rAAV-5×DMP-miR533 exhibited more pronounced anti-tumor effects on MDA-MB-453 and CT-26 cells compared to rAAV-DMP-miR533. In contrast, neither rAAV-DMP-miR533 nor rAAV-5×DMP-miR533 affected the viability of normal cells HL7702 and NIH / 3T3 ( Figure 4 C). Furthermore, cell viability assays using CCK-8 confirmed these findings, showing that rAAV-DMP-miR533 and rAAV-5×DMP-miR533 significantly reduced the viability of MDA-MB-453 and CT-26 cells, with rAAV-5×DMP-miR533 exhibiting a more potent antitumor effect than rAAV-DMP-miR533 ( Figure 4 D) As negative controls, MDA-MB-453, CT-26, HL7702, and NIH / 3T3 cells were simultaneously infected with rAAV-miRNT under the same treatment conditions. The proliferation of these four cell lines was not affected by the control rAAV, with p values ​​greater than 0.05.

[0095] Example 4

[0096] The therapeutic effect of rAAV-DMP-miR533 on liver cancer and leukemia

[0097] The therapeutic effect of rAAV-DMP-miR533 on hepatocellular carcinoma and leukemia was studied. To evaluate the in vivo anti-tumor effect of DMP-miR533, two different animal experiments were performed using virus-based DMP-miR533. In the first experiment, BALB / c mice were inoculated with mouse hepatocellular carcinoma cells (H22) by intravenous injection to establish a hepatocellular carcinoma mouse model. On the seventh day after tumor inoculation, tumor-bearing mice were randomly divided into two groups and received intravenous injections of two different viral vectors: rAAV-MCS (n=5) and rAAV-DMP-miR533 (n=6), with a dose of 1×10^9 viral genomes per mouse. On the fifth day after the initial injection, the same viral vector was injected again ( Figure 5 A). The results showed that rAAV-DMP-miR533 significantly inhibited tumor growth compared with rAAV-MCS treatment, as evidenced by slower weight gain ( Figure 5 B). In addition, the survival rate of mice treated with rAAV-DMP-miR533 was significantly higher than that of the rAAV-MCS group ( Figure 5 C) (p<0.0001), one mouse survived to the end of the experiment.

[0098] In the second animal experiment, BALB / c mice were subcutaneously transplanted with WEHI-3 mouse leukemia cells to establish a leukemia mouse model. On the sixth day after tumor inoculation, the tumor-bearing mice were randomly divided into two groups and received a single intravenous injection of two different viral variants: rAAV-MCS (n=10) and rAAV-DMP-miR533 (n=10), with a dose of 1×10^9 vector genomes ( Figure 5 D). The results showed that all mice injected with rAAV-MCS developed large tumors on the left side, which were manifested by congestion and swelling of the tumor mass ( Figure 5 E). In contrast, the tumors of mice treated with rAAV-DMP-miR533 were significantly smaller than those of the control group ( Figure 5E). Tumor imaging examination showed that rAAV-DMP-miR533 treatment significantly inhibited tumor growth compared with the rAAV-MCS control group ( Figure 5 F). It is noteworthy that before viral treatment, the average tumor volume of the rAAV-MCS group and the rAAV-DMP-miR533 group was 96.2 mm 3 and 95.5mm 3 ( Figure 5 G). After treatment, the mean tumor volume of the rAAV-MCS group increased to 714.8 mm 3 , while the average tumor volume of the rAAV-DMP-miR533 group was 333.4 mm 3 , indicating that rAAV-DMP-miR533 treatment has a significant anti-tumor effect ( Figure 5 G). In addition, no mice died in either animal experiment after rAAV administration, demonstrating the safety of the rAAV vector. These results demonstrate the safe and potent tumor suppressive properties of rAAV-DMP-miR533 in vivo.

[0099] Example 5

[0100] The therapeutic effect of rAAV-DMP-miR533 on colon cancer

[0101] To further investigate the in vivo anti-tumor effect of the DMP-miR533 strategy, rAAV-DMP-miR533 and rAAV-5×DMP-miR533 were injected into a mouse model bearing cancer cell xenografts. Specifically, CT-26 mouse colon cancer cells were subcutaneously transplanted into BALB / c mice to establish a colon cancer model. On the ninth day after tumor inoculation, the tumor-bearing mice were randomly divided into four groups and received three intravenous injections of PBS (n=10), rAAV-DMP-miRNT (1×10^10 vector genomes per mouse, n=10), rAAV-DMP-miR533 (n=10), or rAAV-5×DMP-miR533 (n=10) (see Figure 6 A). The results showed that compared with the PBS and rAAV-DMP-miRNT groups, rAAV-DMP-miR533 and rAAV-5×DMP-miR533 treatments significantly inhibited tumor growth, accompanied by a gradual increase in body weight (see Figure 6B). The tumor size of mice treated with rAAV-DMP-miR533 and rAAV-5×DMP-miR533 was significantly smaller than that of mice treated with rAAV-DMP-miRNT in the control group (p≤0.05). In addition, the anti-tumor effect of rAAV-5×DMP-miR533 was more pronounced than that of rAAV-DMP-miR533 (see Figure 6 C). In addition, tumor and spleen image analysis showed that rAAV-DMP-miR533 and rAAV-5×DMP-miR533 treatment groups had significant effects on tumor growth ( Figure 6 D) and splenomegaly ( Figure 6 The inhibitory effect of rAAV-5×DMP-miR533 on tumor suppression was significantly stronger than that of the PBS and rAAV-DMP-miRNT control groups. Notably, rAAV-5×DMP-miR533 treatment had a more pronounced tumor suppression effect. These findings were confirmed by measuring tumor and spleen weights, which showed that both rAAV-DMP-miR533 and rAAV-5×DMP-miR533 treatment groups had significantly reduced tumor weights compared with rAAV-DMP-miRNT treatment (p≤0.05) ( Figure 6 E) and spleen weight (p≤0.05) ( Figure 6 F).

[0102] To further investigate the anti-tumor efficacy and safety of the DMP-miR533 system in vivo, a comprehensive analysis of the serum and major tissues of mice was performed. We evaluated serum biochemical indices, including ALP, ALT, AST, UREA, UA, and CREA, to assess liver and kidney function, respectively. In addition, we quantified viral DNA content in heart, liver, spleen, lung, kidney, and tumor tissues using qPCR detection. Our findings showed that PBS and rAAV-DMP-miRNT administration resulted in significant liver damage compared with rAAV-DMP-miR533 and rAAV-5×DMP-miR533 treatment, as manifested by increased ALP, ALT, and AST levels (p≤0.05) ( Figure 6 G), and significant renal damage, as indicated by increased levels of UREA, UA, and CREA (p≤0.05) ( Figure 6 H). In contrast, analysis of serum biochemical parameters in the rAAV-DMP-miR533 and rAAV-5×DMP-miR533-treated groups showed minimal effects on these parameters, highlighting the in vivo biosafety of rAAV-DMP-miR533 and rAAV-5×DMP-miR533.

[0103] In addition, qPCR was used to quantify viral DNA, RelAmRNA, and miR533 mRNA in heart, liver, spleen, lung, kidney, and tumor tissues. The results showed that after treatment with rAAV-DMP-miRNT, rAAV-DMP-miR533, and rAAV-5×DMP-miR533, the viral DNA content in liver and tumor tissues, which represents the distribution of the virus, increased significantly ( Figure 6 I). In contrast, the distribution of rAAV in other tissues was minimal, demonstrating the tissue tropism of rAAV and the tumor specificity of the DMP-promoted microRNA system. In addition, miR533 RNA expression was significantly increased in tumor tissues treated with rAAV-DMP-miR533 and rAAV-5×DMP-miR533 compared with PBS and rAAV-DMP-miRNT (p≤0.0001)( Figure 6 I); in normal tissues (heart, liver, spleen, lung, and kidney), rAAV-DMP-miR533 and rAAV-5×DMP-miR533 treatment did not result in significant expression of miR533 RNA, indicating the tumor tissue specificity of miR533 expression. Accordingly, compared with tumor tissues treated with PBS and rAAV-DMP-miRNT, RelA mRNA expression was significantly knocked down in tumor tissues treated with rAAV-DMP-miR533 and rAAV-5×DMP-miR533 (p≤0.0001) ( Figure 6 I); In addition, it can be seen that RelA mRNA is only highly expressed in tumor tissues, while its expression in normal tissues (heart, liver, spleen, lung, and kidney) is extremely low. In summary, these findings demonstrate that rAAV-DMP-miR533 has significant tumor selectivity and in vivo anti-tumor effects in a colon cancer mouse model.

Claims

1. A use of a gene expression vector for cancer treatment in the preparation of a recombinant adeno-associated virus for in vivo delivery for cancer treatment, wherein the gene expression vector comprises one or more functional DNA fragments DMP-microRNA genes; the functional DNA fragment DMP-microRNA gene is composed of two functional elements DMP and microRNA gene, wherein DMP is an NF-κB-specific promoter, and the microRNA gene is a microRNA coding sequence that targets and inhibits NF-κB gene expression.

2. The use according to claim 1, characterized in that The NF-κB specific promoter consists of an NF-κB decoy and a minimal promoter, and the DMP includes NF-κB decoys and minimal promoters of various sequences.

3. The use according to claim 1, characterized in that The sequence of the DMP is preferably as shown in SEQ ID NO.

1.

4. The use according to claim 1, characterized in that The microRNA coding sequence is a microRNA coding sequence that can inhibit the expression of NF-κB RelA gene.

5. The use according to claim 4, characterized in that The microRNA coding sequence capable of inhibiting NF-κB RelA gene expression is shown in SEQ ID NO.

2.

6. The use according to claim 5, characterized in that After being processed and matured by the intracellular microRNA maturation system, the expressed microRNA can bind to NF-κB RelAmRNA in the cytoplasm, thereby inhibiting the expression of NF-κB RELA / P65 protein.

7. The use according to claim 1, characterized in that After the functional DNA fragment DMP-microRNA gene is introduced into cells, its functional element DMP can bind to the transcription factor protein NF-κB in the cell nucleus, thereby activating the expression of the microRNA gene.

8. The use according to claim 1, characterized in that The adeno-associated virus includes any one of various serotypes of adeno-associated viruses AAV1 to AAV9.

9. Use of the in vivo delivery recombinant adeno-associated virus according to claim 1 in the preparation of a cancer therapeutic agent or drug.

10. The use according to claim 9, characterized in that The method for constructing a recombinant adeno-associated virus for in vivo delivery comprises the following steps: (1) synthesizing oligonucleotides, annealing with base-complementary oligonucleotides and extending with DNA polymerase to generate a DMP-miR533 fragment, then amplifying the linear DMP-miR533 fragment using primers hDMP-miR533 MIuI F1 and hDMP-miR533 EcoRI R1, and then cloning into the pAAV-MCS vector using the MIuI and EcoRI restriction sites to construct the pAAV-DMP-miR533 plasmid; (2) In order to generate five copies of DMP-miR533, four pairs of specific primers were used to linearly amplify the DMP-miR533 fragment; the four pairs of specific primers were: hDMP-miR533 EcoRI F2 and hDMP-miR533 BamHI R2, hDMP-miR533 BamHIF3 and hDMP-miR533 SalI R3, hDMP-miR533 SalI F4 and hDMP-miR533 HindIII R4, hDMP-miR533 HindIII F5 and hDMP-miR533 BglII R5, and the four fragments were digested with four pairs of restriction endonucleases; the four pairs of restriction endonucleases were: EcoRI and BamHI, BamHI and SalI, SalI and HindIII, HindIII and BglII, respectively. The cleavage products were sequentially cloned into the pAAV-DMP-miR533 vector to construct the pAAV-5×DMP-miR533 vector targeting the human RelA gene; (2) 293T cells were transfected with pAAV-DMP-miR533 or pAAV-5×DMP-miR533 plasmids and two helper plasmids, pAAV-Helper and pAAV-RC. After cell culture, the virus was extracted and the aqueous phase containing the purified virus was collected. The obtained viruses were named rAAV-DMP-miR533 and rAAV-5×DMP-miR533.

11. The use according to claim 1 or 9, characterized in that: The cancer includes liver cancer, leukemia or colon cancer.

12. The use according to claim 9, characterized in that The in vivo delivery of recombinant adeno-associated virus is used in the preparation of cancer treatment reagents or drugs through intravenous injection or intratumoral injection.