A genetically engineered yarrowia lipolytica strain for increasing the yield of cocoa butter and a construction method thereof
By integrating the cocoa tree-derived stearoyl-CoA desaturase gene TcSAD1 into Yersinia lipolytica and knocking out the endogenous enzyme YlD9, the problems of oil yield and fatty acid composition in Yersinia lipolytica were solved, resulting in a significant improvement in cocoa butter yield and quality, making it suitable for industrial production.
Patent Information
- Application Number
- CN202510823233.X
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-06-19
- Publication Date
- 2026-06-09
- Estimated Expiration
- 2045-06-19
Smart Images

Figure CN120665737B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of genetic engineering technology, specifically, it relates to a genetically engineered yeast strain that increases cocoa butter production and its construction method. Background Technology
[0002] Cocoa butter, a crucial ingredient in chocolate manufacturing, is primarily derived from cocoa beans. Its unique aroma and melting point characteristics make it a key determinant of chocolate product quality. However, traditional cocoa butter extraction methods are limited by natural resources, resulting in high production costs. Furthermore, supply is unstable due to natural factors such as climate and pests, making it difficult to meet the growing market demand. Therefore, developing alternative cocoa butter production methods has significant economic and social value.
[0003] The production of cocoa butter substitutes via microbial fermentation has become a research hotspot. Among these, *Yersinia lipolytica* is widely used in oil production due to its high oil accumulation capacity and safety. Existing research shows that *Yersinia lipolytica* can produce large amounts of oil using carbon sources such as glucose, and its fatty acid composition can be regulated through genetic engineering. However, existing *Yersinia lipolytica* strains have limited oil production, and their fatty acid composition differs significantly from that of natural cocoa butter, particularly in the proportions of stearic acid, oleic acid, and linoleic acid, which are difficult to meet the standard requirements for cocoa butter.
[0004] Currently, research on producing cocoa butter substitutes using microbial fermentation is increasing both domestically and internationally, but an ideal industrial production plan is still lacking. Existing genetic engineering strategies mainly focus on fatty acid synthesis pathways, but the modification and regulation of key enzymes have not yet achieved ideal results. In particular, research on genetically modifying plant-derived key enzymes in *Yarrowia lipolytica* is relatively limited, lacking systematic research and industrial application cases. Therefore, developing novel genetically engineered strains to improve the yield and quality of cocoa butter is of great significance for meeting market demand and reducing production costs. Summary of the Invention
[0005] The purpose of this invention is to provide an engineered strain of Yersinia lipolytica for producing cocoa butter, in order to address the practical problem of low yield in microbial cocoa butter production. This invention aims to provide a method that can increase the cocoa butter yield in Yersinia lipolytica strains, thereby overcoming the shortcomings of the prior art.
[0006] To achieve the above objectives, a first aspect of the present invention provides a method for constructing a genetically engineered *Yersinia lipolytica* strain that increases cocoa butter production. The method comprises transferring the stearoyl-CoA desaturase gene TcSAD1 from the cacao tree into the chromosome of a lipid-producing genetically engineered *Yersinia lipolytica* strain po1g, thereby obtaining a genetically engineered *Yersinia lipolytica* strain with increased cocoa butter production.
[0007] The NCBI accession number for the TcSAD1 sequence of the stearoyl-CoA desaturase gene from the cacao tree (Theobroma cacao) is GB: EOY04657.1.
[0008] According to a preferred embodiment of the present invention, the method further includes integrating TcSAD1 into the stearoyl-CoA desaturase YlD9 site of Yarrowia lipolytica through homologous recombination, and simultaneously knocking out the endogenous stearoyl-CoA desaturase YlD9 of Yarrowia lipolytica, wherein the NCBI accession number of the sequence of the endogenous stearoyl-CoA desaturase gene YlD9 (oleyl coAdesaturase, abbreviated as YID9 or OLE1) of Yarrowia lipolytica is GB: XP_501496.1.
[0009] In a second aspect, the present invention provides a genetically engineered yeast strain for increasing cocoa butter production, comprising the stearoyl-CoA desaturase gene TcSAD1 derived from cocoa trees.
[0010] In any of the above-mentioned preferred embodiments, the Yersinia lipolytica genetically engineered strain for increasing cocoa butter production lacks the Y1D9 gene, which is an endogenous stearoyl-CoA desaturase in Yersinia lipolytica.
[0011] In any of the above-mentioned preferred embodiments, the TcSAD1 gene is integrated into the stearoyl-CoA desaturase YlD9 site of the knocked-out YlD9 yeast strain for increasing cocoa butter production.
[0012] Preferably, the NCBI accession number for the TcSAD1 sequence of the stearoyl-CoA desaturase gene from the cocoa tree is GenBank: EOY04657.1.
[0013] Preferably, the NCBI accession number for the sequence of the endogenous stearoyl-CoA desaturase gene YlD9 from Yarrowia lipolytica is GenBank: XP_501496.1.
[0014] Preferably, the TcSAD1 has a codon-optimized nucleotide sequence as shown in SEQ ID NO.1.
[0015] Preferably, the *Yersinia lipolyticis* is a genetically engineered *Yersinia lipolyticis* strain po1g that produces oil.
[0016] A third aspect of the present invention provides the application of the Yersinia lipolyticis genetically engineered strain described in any of the preceding claims for increasing cocoa butter yield in the production of cocoa butter.
[0017] A fourth aspect of the present invention provides a method for producing cocoa butter using any of the above-described methods, employing the genetically engineered *Yarrowia lipolytica* strain that increases cocoa butter yield.
[0018] Preferably, the Yersinia lipolytica genetically engineered strain for increasing cocoa butter yield described above is fermented in a fermentation medium.
[0019] Preferably, the fermentation medium is a fermentation medium containing CSM medium, comprising the following components in the following proportions: 50 g / L glucose, 1.7 g / LYNB (excluding amino acids and ammonium sulfate), 1.1 g / L ammonium sulfate, and 1.29 g / L CSM medium.
[0020] In a preferred embodiment of the present invention
[0021] First, the genetically engineered *Yarrowia lipolytica* strain, which increases cocoa butter production, is cultured as a seed culture. The preferred seed culture medium is CSM medium, the preferred culture temperature is 30°C, and the preferred seed culture time is 24 hours.
[0022] Then, fermentation is carried out. The seed culture is inoculated into the fermentation medium at a certain ratio. Preferably, the seed culture is inoculated into the fermentation medium at an inoculation amount of 5% (v / v); preferably, the fermentation medium is a fermentation medium containing CSM medium; preferably, the fermentation temperature is 30°C; preferably, the culture is carried out in a shaker at 180 rpm for 3 days.
[0023] The present invention has the following beneficial effects:
[0024] The cocoa butter yield of the Yersinia lipolytica genetically engineered strain obtained by the method of the present invention is significantly increased compared with the starting strain, and the total oil yield can reach 1.34 g / L at the shake flask level.
[0025] The growth rate of the Yersinia lipolytica genetically engineered strain for increasing cocoa butter production was higher than that of the wild-type strain, and the total oil concentration was increased to 1.34 g / L. At the same time, the stearic acid content increased to 13.2%, and the linoleic acid content decreased to 16.8%. The proportions of POP, POS, and SOS in the triglycerides of the Yersinia lipolytica genetically engineered strain for increasing cocoa butter production were increased to 7.4%, 14%, and 3.3%, respectively.
[0026] POP (1,3-dispalmitoyl-2-oleic acid triglyceride) is one of the main components of cocoa butter, giving it unique physical properties such as a suitable melting point and a smooth texture. The presence of POP helps cocoa butter remain solid at room temperature while melting rapidly at body temperature, resulting in a silky texture.
[0027] POS (1-palmitoic acid-2-oleic acid-3-stearic acid triglyceride) is also an important component of cocoa butter. Together with POP, it affects the crystallization behavior and physical properties of cocoa butter. The presence of POS helps cocoa butter form a stable crystal structure, thus affecting the texture and luster of chocolate.
[0028] SOS (1,3-distearate-2-oleic acid triglyceride) is also a component of cocoa butter. SOS's high melting point helps increase the hardness of cocoa butter, and its balance with other triglycerides improves the texture of the cocoa butter.
[0029] It is evident that the Yersinia lipolytica genetically engineered strain obtained in this invention, which improves the yield and quality of cocoa butter, is suitable for cocoa butter production. Attached Figure Description
[0030] Figure 1 This is a schematic diagram of the plasmid pYLXP'-TcSAD1.
[0031] Figure 2 This is a schematic diagram of the plasmid pUrlp-OLE1::TcSAD1.
[0032] Figure 3 The growth curves of strains po1g-wt and OLE1::TcSAD1 are shown.
[0033] Figure 4 The graph shows the total fatty acid concentration in the fermentation broth of strains po1g-wt and OLE1::TcSAD1.
[0034] Figure 5 A comparative diagram of the fatty acid composition of strains po1g-wt and OLE1::TcSAD1.
[0035] Figure 6Comparison of triglyceride composition between strains po1g-wt and OLE1::TcSAD1. Detailed Implementation
[0036] The present invention will be further described in detail below with reference to the accompanying drawings and specific embodiments.
[0037] The technical solution of the present invention will be clearly and completely described below with reference to specific embodiments. It should be understood that the described embodiments are only a part of the embodiments of the present invention, and not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of the present invention.
[0038] In this specific embodiment, the PCR amplification system is as follows: total volume 50 μL; DNA template, 1 μL; upstream primer (10 μM) and downstream primer (10 μM) 2 μL each; 2×Phanta Flash Master Mix, 25 μL; and finally, make up to 50 μL with double-distilled water.
[0039] In this specific embodiment, the PCR amplification program is as follows: amplification conditions are 95℃ pre-denaturation for 3 min (1 cycle); 95℃ denaturation for 15 sec, annealing at 56℃ for 15 sec, extension at 72℃ for 60 sec / kb (30 cycles); and 72℃ extension for 5 min (1 cycle).
[0040] In this specific embodiment, the chassis cells used are Yersinia lipophila po1g strain, which are from the Synthetic Biology and Intelligent Control Laboratory of Guangdong Technion – Israel Institute of Technology.
[0041] Expression vectors were constructed using plasmids pYLXP' and pUrlp, from the Synthetic Biology and Intelligent Control Laboratory of Guangdong Technion – Israel Institute of Technology.
[0042] in:
[0043] The *Yarrowia lipolytica* po1g strain is a commercially available strain, obtainable by the public through purchase, such as the *Yarrowia lipolytica* po1g strain provided by Zhejiang Beniaobang Biotechnology Co., Ltd., product number: BIO-YL-Po1g. The *Yarrowia lipolytica* po1g strain is described in existing literature and can also be obtained by the public through sharing.
[0044] The pYLXP' plasmid is a gene-engineered expression vector specifically designed for *Yalibrium lipolyticum*. pYLXP' is a commercially available vector, readily available to the public, such as through Zhejiang Beniaobang Biotechnology Co., Ltd., product number: YaliBrick plasmid (pYLXP' vector series). The pYLXP' plasmid contains a leucine (Leu2) tag used for screening in *Yalibrium lipolyticum*, as well as the strong promoter TEF and terminator XPR2, both of which function in *Yalibrium lipolyticum*. Figure 1 The image shows the pYLXP'-TcSAD1 recombinant plasmid. Those skilled in the art can determine the structure of the pYLXP' plasmid and obtain it using conventional plasmid construction methods. The pYLXP' plasmid is described in existing literature and is also publicly available through sharing.
[0045] The pUrlp plasmid contains a leucine tag (Leu2) used for screening in *Yarrowia lipolytica*, as well as the strong promoter TEF and terminator XPR2, both of which function in *Yarrowia lipolytica*. Figure 2 The image shows the pUrlp-OLE1::TcSAD1 plasmid. Those skilled in the art can determine the structure of the pUrlp plasmid and obtain it using conventional plasmid construction methods. The pUrlp plasmid is described in existing literature and is also publicly available through sharing, such as in: Engineered Yersinia lipolytica strains for producing cocoa butter and their construction methods and applications (https: / / www.patentguru.com / cn / CN119162009A).
[0046] The concept of this invention is not limited to the source or acquisition method of the terrestrial cells and plasmids. Any terrestrial strains and plasmids that can realize the technical solution of this invention are applicable to this invention.
[0047] Example 1: Construction of expression vector pYLXP'-TcSAD1
[0048] Step 1: Use gene synthesis technology to obtain TcSAD1 (such as the nucleotide sequence of SEQ ID NO. 1) optimized for the codons of Yersinia lipophila;
[0049] Using the codon-optimized TcSAD1 as a template, primers TcSAD1-f and TcSAD1-r were used to amplify the fragment TcSAD1-hom required for homologous recombination.
[0050] The primer sequences used for amplification in step 1 are shown in Table 1 below:
[0051] Table 1: Primers used in this step
[0052] Primer name Sequence 5'-3' serial number TcSAD1-f accagcactttttgcagtactaaccgcagatggctttgaagctcaacccca SEQ ID NO.2 TcSAD1-r acaggccatggaactagtcgttagagcttcacctctcggtcgaag SEQ ID NO.3
[0053] Step 2: Obtain the pYLXP' vector. The vector is a circular plasmid, containing a leucine (Leu2) tag used for screening in *Yersinia lipolytica*, as well as the strong promoter TEF and terminator XPR2, which function in *Yersinia lipolytica*. The pYLXP' vector was double-digested with SnaBI and KpnI to obtain a linearized vector.
[0054] The double enzyme digestion reaction system is shown in Table 2. The reaction conditions were 37℃ and the reaction time was 3h.
[0055] Table 2: Plasmid double enzyme digestion reaction system
[0056] reagents Dosage (μL) pYLXP vector 10 (approximately 3 μg) 10× buffer solution 5 SnaBI 3 KpnI 3 Double distilled water 29
[0057] After the enzyme digestion reaction, the linearized pYLXP' vector fragment was separated by agarose gel electrophoresis, and the target fragment was recovered from the linearized pYLXP' vector fragment using a DNA gel recovery kit to obtain the purified linearized plasmid vector fragment.
[0058] Step 3: The TcSAD1-hom fragment from Step 1 is fused with the linearized pYLXP' vector fragment from Step 2 using seamless cloning technology (Gibson assembly) to construct the pYLXP'-TcSAD1 recombinant plasmid (e.g., ...). Figure 1 (As shown).
[0059] Example 2: Construction of the integrated vector pUrlp-OLE1::TcSAD1
[0060] Step 1): Using the *Yersinia lipolytica* po1g genome as a template, the upstream homologous arm up1000-hom was amplified using primers up1000-hom-f and up1000-hom-r; the downstream homologous arm dw1000-hom was amplified using primers dw1000-hom-f and dw1000-hom-r using the *Yersinia lipolytica* po1g genome as a template; TcSAD1 (TEFin) was amplified using primers TcSAD1-hom-f and TcSAD1-hom-r using pYLXP'-TcSAD1 as a template; the amplified fragments were separated by agarose gel electrophoresis, and the purified fragments were obtained by using a DNA gel recovery kit. The primers used in this step are shown in Table 3.
[0061] Table 3:
[0062]
[0063]
[0064] Step 2): Obtain the pUrlp vector. The vector is a circular plasmid, containing a leucine (Leu2) tag used for screening in *Yarrowia lipolytica*, as well as the strong promoter TEF and terminator XPR2, which function in *Yarrowia lipolytica*. The pUrlp vector was double-digested with AvrII and SalI to obtain the loxp-leu2-loxp and pUrlp-AvrII / SalI linearized vectors, respectively.
[0065] The double enzyme digestion reaction system is shown in Table 4. The reaction conditions were 37℃ and the reaction time was 3h.
[0066] Table 4: Plasmid double enzyme digestion reaction system
[0067] reagents Dosage (μL) pUrlp vector 10 (approximately 3 μg) 10× buffer solution 5 AvrII 3 SalI 3 Double distilled water 29
[0068] Step 3): The fragment from Step 1) is fused with the fragment from Step 2) using Gibson assembly to construct the pUrlp-OLE1::TcSAD1 recombinant plasmid (e.g., ...). Figure 2 (As shown).
[0069] The seamless cloning reaction system is shown in Table 5. The reaction conditions were 50℃ and 0.5h.
[0070] Table 5: Seamless Cloning Reaction System
[0071] reagents Dosage (μL) pUrlp-AvrII / SalI 1 up1000-hom 1 loxp-leu2-loxp 1 TcSAD1(TEFin) 1 dw1000-hom 1 Seamless cloning enzyme 5
[0072] Example 3: Construction of recombinant strain po1g-OLE1::TcSAD1
[0073] Step 1): Amplify and replace the linearized fragment OLE1::TcSAD1 required for OLE1 integration using primers up-6.4kf and dw-6.4kr. The primers used in this step are shown in Table 6.
[0074] Table 6:
[0075]
[0076]
[0077] Step 2): Transformation of *Yarrowia lipolyticis* po1g. Pick single colonies (2-3 mm) from the plate and incubate overnight in YPD liquid tubes for approximately 14-16 hours; inoculate into 25 ml of YPD medium (250 mL shake flask), initial OD600 = 0.5, and incubate with shaking for approximately 3 hours; then add 2.5 mL of hydroxyurea (final concentration 50 mM, stock solution 500 mM, aliquoted and stored at -80℃ for long-term storage), and continue incubation for 2 hours; collect 3 mL of bacterial culture in a 2 mL round-bottom EP tube, centrifuge (5000 rpm, 2.5 min), and wash twice with an equal volume of sterile water; transform using the lithium acetate PEG4000 method, as shown in Table 7, prepare a resuspending solution in the transformation solution, and incubate at 39℃ for one hour, shaking for 15 seconds every 15 minutes. Finally, plate onto CSM-Leu selective plates for screening positive transformants.
[0078] Table 7: Yeast Conversion System
[0079] reagents Dosage 50% PEG4000 80μL 2M Lithium Acetate 5μL 2M DTT 5μL ssDNA 5μL OLE1::TcSAD1 500ng
[0080] An engineered yeast strain containing the exogenous gene TcSAD1 was obtained to synthesize cocoa butter.
[0081] Example 4: Fermentation production of yeast cocoa butter using the engineered Yeast lipolyticis strain po1g-OLE1::TcSAD1 constructed in Example 3. The specific steps for producing yeast cocoa butter are as follows:
[0082] 1) Seed culture: Inoculate the activated colonies into CSM medium and incubate at 30°C for 24 hours.
[0083] 2) Fermentation culture: Inoculate the seed culture into the fermentation medium at an inoculation rate of 5% (v / v) (as shown in Table 8, C / N = 100) and culture for 3 days at 30℃ and 180 rpm in a shaker.
[0084] Table 8: Fermentation Culture Media
[0085] reagents Concentration (g / L) glucose 50 YNB, free of amino acids and ammonium sulfate 1.7 ammonium sulfate 1.1 CSM medium 1.29
[0086] CSM was purchased from Beijing Cooler Master Technology Co., Ltd., product number PM2200-20g; YNB was purchased from Sangon Biotech (Shanghai) Co., Ltd., product number A600505-0100.
[0087] Comparative Example 5
[0088] Unlike Example 4, yeast cocoa butter was produced using a wild-type Yersinia lipolytica strain (Yersinia lipolytica chassis strain po1g).
[0089] Experiment 1: Quantitative analysis of fatty acids:
[0090] Take the 3-day fermentation broth from Example 4 and Comparative Example 5 respectively, and test them according to the following steps:
[0091] 4OD cells (e.g., 200μL of 20OD culture medium) will be transferred to 1.5 mL centrifuge tubes and washed twice with double-distilled water.
[0092] Fatty acid transesterification and determination procedure: 500 μL of 0.5N methanol-sodium hydroxide solution and 100 μL of 2 g / L tridecanoic acid dissolved in n-hexane were added to the bacterial cells as an internal standard, and the mixture was shaken at 1200 rpm for 2 hours. Then, 40 μL of 98% concentrated sulfuric acid and 400 μL of n-hexane were added to the sample sequentially, and the mixture was shaken at 1200 rpm for 15 minutes. Finally, the sample was centrifuged, and the upper n-hexane layer was collected and quantified using an HP-INNOWAX (30 m × 0.25 mm) capillary column for GC-FID. Specific results are shown below. Figure 3 , Figure 4 and Figure 5 As shown, po1g-WT is Comparative Example 5, and OLE1::TcSAD1 is Example 4.
[0093] Depend on Figure 3 , Figure 4 and Figure 5 It can be seen that, compared with Comparative Example 5, the growth rate of strain OLE1::TcSAD1 was improved, and the total oil concentration increased from 0.88 g / L to 1.34 g / L, while stearic acid ( Figure 5 The content of C18:0 also increased from 11.4% to 13.2%, and linoleic acid (C18:0) also increased. Figure 5 The C18:2 content decreased from 20.3% to 16.8%.
[0094] Depend on Figure 6 It was found that the proportions of POP, POS, and SOS in Yeast lipolyticis cells (po1g-wt) were 4.8%, 8.7%, and 1.9%, respectively. After site-specific integration of cocoa tree-derived D9 desaturase (TcSAD1) into po1g, the proportions of POP, POS, and SOS in the triglycerides of po1g-TcSAD1 cells increased to 7.4%, 14%, and 3.3%, respectively.
[0095] The above embodiments are merely illustrative examples and are not intended to limit the implementation. Those skilled in the art will recognize that other variations or modifications can be made based on the above description. It is neither necessary nor possible to exhaustively list all possible implementations. However, obvious variations or modifications derived therefrom are still within the scope of protection of this invention.
Claims
1. A genetically engineered *Yarrowia lipolytica* strain for increasing cocoa butter production, characterized in that, The cocoa butter-enhancing Yersinia lipolytica genetically engineered strain contains the stearoyl-CoA desaturase gene TcSAD1 derived from cocoa trees. Using Yersinia lipolytica po1g strain as the chassis cell, the TcSAD1 gene is integrated into the knocked-out Yersinia lipolytica endogenous stearoyl-CoA desaturase gene YlD9. The codon-optimized nucleotide sequence of the TcSAD1 gene is shown in SEQ ID NO.
1. The NCBI accession number for the sequence of the Yersinia lipolytica endogenous stearoyl-CoA desaturase gene YlD9 is GenBank: XP_501496.
1.
2. The method for constructing a genetically engineered *Yarrowia lipolytica* strain to increase cocoa butter yield according to claim 1, characterized in that, The chromosome of the genetically engineered Yeast lipolytica strain was modified with the stearoyl-CoA desaturase gene TcSAD1, which is derived from cocoa trees.
3. The construction method as described in claim 2, characterized in that, The chassis cells of the genetically engineered Yersinia lipolytica strain are Yersinia lipolytica po1g strain, and the endogenous stearoyl-CoA desaturase gene YlD9 of this strain is missing.
4. The application of the Yersinia lipolyticis genetically engineered strain for increasing cocoa butter yield as described in claim 1 in the production of cocoa butter.
Citation Information
Patent Citations
Yarrowia lipolytica engineering strain for producing cocoa butter equivalent and construction method and application of Yarrowia lipolytica engineering strain
CN119162009A
Paeonia ostii [alpha]-linolenic acid synthesis enzyme encoding genes and applications thereof
CN106244604A
Oleic acid production in yeast
CN107208088A