Chimeric antigen receptor CAR for targeting human EB virus, CAR-NK cell and application of chimeric antigen receptor CAR and CAR-NK cell

Abstract

The invention discloses a human EB (Epstein-Barr) virus targeting chimeric antigen receptor CAR, a CAR-NK cell and application, and the human EB virus targeting chimeric antigen receptor CAR comprises the following structure: a gH / gL single-chain antibody aiming at EB virus, a transmembrane region and an intracellular signal transduction region. The targeted human EB virus CAR-NK cell provided by the invention can effectively identify and kill nasopharyngeal carcinoma and B lymphoma infected by EBV, effectively kills tumor cells, can generate lasting immune response ability, does not generate serious toxic and side effects, and is beneficial to preventing tumor recurrence.

Description

TECHNICAL FIELD

[0001] The present application relates to the field of biotechnology engineering, and more particularly, to a chimeric antigen receptor CAR targeting human Epstein-Barr virus, CAR-NK cells and uses. BACKGROUND

[0002] Epstein-Barr virus (EBV) belongs to the herpes virus family and is universally susceptible in human population. Primary EBV infection can cause gland fever, but unlike other viruses, EBV is not cleared by the immune system after primary infection, but is carried for life. Under certain conditions, the infected EBV can be activated and carcinogenic. EBV is a DNA oncogenic virus of the lymphotrophic virus genus, and the most common form is latent infection. More than 90% of human EBV infections show lifelong latent state, most of which have good prognosis, but EBV infection can be life-threatening in immunodeficient individuals. EBV can infect epithelial cells and B cells, although the proportion of cancer directly caused by EBV is very low, but due to the high infection rate in the population, 200,000 new cancer cases and 140,000 cancer deaths worldwide each year are related to EBV infection. Epithelial cell malignancies are the most common EBV-related cancers, including gastric cancer and nasopharyngeal carcinoma, and EBV is also associated with Burkitt's malignant lymphoma and Hodgkin's lymphoma.

[0003] EBV is an enveloped virus that infects cells by complete fusion with the host cell membrane through its own membrane proteins exposed to the outside, the membrane proteins involved include the fusion protein gB and the auxiliary proteins gp350, gp42, gHgL that directly or indirectly interact with host cell receptors. EBV viral entry into B cells is initiated by the binding of the glycoprotein gp350 to complement receptor 2 (CR2-Fc). The virus glycoprotein complex composed of gH, gL and gp42 binds to human leukocyte antigen (HLA) class II molecules through gp42, gB is activated and promotes fusion of the viral membrane with the B cell membrane, and gH and gp42 are both essential for virus-B cell fusion. Infection of epithelial cells is mediated by EBV BMRF2 binding to integrin, gH / gL binding to integrin and hepatocyte receptor A2, and then activating gB to promote virus-cell membrane fusion. Glycoproteins gH / gL and gB form the core fusion mechanism of the virus, which is conserved in all herpes viruses.

[0004] Most of the serum neutralizing antibodies that block B cell infection currently target gp350, and almost all clinical trials for treating EBV infection use gp350 as the only immunogen. For example, Chinese patent 202111646561.5 provides a neutralizing monoclonal antibody that can recognize EB virus gp350 protein with high affinity, which can block the binding of gp350 protein and its ligand CR2.

[0005] Although epithelial cell infection is important in the EBV life cycle, and EBV-related epithelial cell malignancies are more common than B-cell cancers, no reports have been made on the therapeutic effect of cell therapy targeting EBV glycoprotein (such as gH / gL) on viral infection in B cells and epithelial cells. SUMMARY

[0006] Therefore, it is necessary to provide a chimeric antigen receptor CAR targeting human EB virus, a CAR-NK cell and a use thereof in view of the above technical problems.

[0007] To solve the above technical problems, the present application provides a chimeric antigen receptor CAR targeting human EB virus, which comprises the following structure: a single-chain antibody against gH / gL of EB virus, a transmembrane region and an intracellular signal transduction region.

[0008] Further, the single-chain antibody against gH / gL of EB virus comprises the amino acid sequences of SEQ ID No: 2 and SEQ ID No: 3.

[0009] Further, the chimeric antigen receptor CAR targeting human EB virus further comprises an IL-15 / IL-15Rα cytokine, and the IL-15 / IL-15Rα cytokine comprises the amino acid sequence of SEQ ID No: 1.

[0010] Further, the transmembrane region is CD8 TM, and the intracellular signal transduction region is the co-stimulatory signal domain CD137 of 4-1BB and the signal domain CD247 of the human CD3 complex ζ chain.

[0011] Further, the chimeric antigen receptor CAR targeting human EB virus further comprises a hinge domain between the single-chain antibody and the transmembrane region.

[0012] Further, the chimeric antigen receptor CAR targeting human EB virus is composed of the following structures in sequence: a signal peptide CD8 (SP), a single-chain antibody against gH / gL of EB virus, a hinge domain, a transmembrane region, an intracellular signal transduction region and an IL-15 / IL-15Rα.

[0013] The present application provides a CAR-NK cell targeting human EB virus, which is prepared by transducing a NK cell with any of the above chimeric antigen receptor CARs targeting human EB virus.

[0014] Further, the NK cell is taken from umbilical cord blood.

[0015] The third aspect of the present application provides a preparation method of CAR-NK cells targeting human EB virus, comprising: S1, constructing a retrovirus vector containing a chimeric antigen receptor CAR; S2, retrovirus packaging; S3, taking umbilical cord blood to separate and purify NK cells, and then activating the NK cells, using an enrichment method to obtain the NK cells, and culturing the NK cells with factors CD16, OKE432 and IL15 at a certain concentration to activate, and performing CAR gene transduction virus infection on the activated NK cells on the fourth day; and S4, collecting the activated NK cells after virus infection.

[0016] The fourth aspect of the present application provides the use of the CAR-NK cells targeting human EB virus in the preparation of a drug for treating a target human EB virus infection.

[0017] Compared with the prior art, the present application has the following beneficial effects:

[0018] The CAR-NK cells targeting human EB virus provided by the present application utilize the broad-spectrum and high-efficiency killing activity of NK cells, the natural cytotoxic activity characteristics, can be activated through a non-CAR dependent mechanism, and can recognize and kill EBV infected nasopharyngeal carcinoma and B lymphoma through the antigen-antibody effect of the CAR molecule, effectively kill tumor cells, enhance the treatment effect, and express the IL-15 / IL-15R alpha fusion protein gene, which can promote the secretion of IL-15 by NK cells and improve the activity of IL-15, so that the CAR-NK cells have a significantly improved killing ability for nasopharyngeal carcinoma and B lymphoma caused by EBV infection, can produce a persistent immune response ability, and do not produce serious toxic side effects, which is helpful for preventing tumor recurrence. BRIEF DESCRIPTION OF DRAWINGS

[0019] In order to more clearly illustrate the solutions in the present application or the prior art, the following will briefly introduce the drawings needed to be used in the embodiments or the prior art description. Obviously, the drawings in the following description are some embodiments of the present application, and other drawings can be obtained by those skilled in the art without creative labor.

[0020] Figure 1 EBV gH / gL scfv CAR molecule and IL-15 / IL-15R alpha fusion protein structure in Example 1 of the present application;

[0021] Figure 2 Expression results of EBV gH / gL protein of HK and B-LCL cells in Example 2 of the present application;

[0022] Figure 3The expression rate of the EBV gH / gL scfv and the EBV gH / gL scfv CAR molecule combined with expression of IL-15 / IL-15R alpha fusion protein for flow detection of the EBV gH / gL scfv of the application;

[0023] Figure 4A Comparison of the killing effect on HK-1 cells after 14d culture of the NT group, the G group and the G15 group in Example 5 of the application;

[0024] Figure 4B Comparison of the killing effect on HK-1 cells after 21d culture of the NT group, the G group and the G15 group in Example 5 of the application;

[0025] Figure 5A Comparison of the killing effect on B-LCL cells after 14d culture of the NT group, the G group and the G15 group in Example 5 of the application;

[0026] Figure 5B Comparison of the killing effect on B-LCL cells after 21d culture of the NT group, the G group and the G15 group in Example 5 of the application;

[0027] Figure 6A Expression result of TNF-α detected by the intracellular staining method of nasopharyngeal carcinoma cells in Example 6 of the application;

[0028] Figure 6B Expression result of IFN-γ detected by the intracellular staining method of nasopharyngeal carcinoma cells in Example 6 of the application;

[0029] Figure 6C Expression result of CD107a detected by the intracellular staining method of nasopharyngeal carcinoma cells in Example 6 of the application;

[0030] Figure 6D Expression result of Granzyme B detected by the intracellular staining method of nasopharyngeal carcinoma cells in Example 6 of the application;

[0031] Figure 7A Expression result of TNF-α detected by the intracellular staining method of cell lymphoma in Example 6 of the application;

[0032] Figure 7B Expression result of IFN-γ detected by the intracellular staining method of cell lymphoma in Example 6 of the application;

[0033] Figure 7C Expression result of CD107a detected by the intracellular staining method of cell lymphoma in Example 6 of the application;

[0034] Figure 7D Expression result of Granzyme B detected by the intracellular staining method of cell lymphoma in Example 6 of the application;

[0035] Figure 8 The results of the tumor volume test of the HK-1Luc animal model in Example 7 of the present invention are as follows;

[0036] Figure 9 This is the test result of the CD19+ ratio in the peripheral blood of the B lymphocytoma animal model in Example 7 of the present invention. DETAILED DESCRIPTION

[0037] In order to enable those skilled in the art to better understand the solutions of the present invention, the technical solutions in the embodiments of the present invention will be clearly and completely described below in conjunction with the drawings in the embodiments of the present invention. Obviously, the embodiments described are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without making creative efforts should fall within the scope of protection of the present invention.

[0038] In order to enable those skilled in the art to better understand the solution of the present application, the technical solution in the embodiments of the present application will be clearly and completely described below in conjunction with the accompanying drawings.

[0039] Example 1 Structure of chimeric antigen receptor CAR molecule targeting human Epstein-Barr virus

[0040] 1. The IL-15 / IL-15Rα fusion protein is composed of the following structures in series: human IL15 (abbreviated as IL15), connecting peptide (abbreviated as linker), and human IL15Rα (abbreviated as IL15Rα);

[0041] 2. If Figure 1 As shown, the CAR molecule of G (gH / gL scfv) is composed of the following structures in series: signal peptide CD8αsignal peptide [abbreviated as CD8 (SP)], gH / gL single-chain antibody against Epstein-Barr virus, CD8 hinge region (CD8 hinge) and transmembrane domain (CD8 TM), 4-1BB costimulatory signal domain CD137 [abbreviated as 4 1BB (ID)], signal domain CD247 of human CD3 complex ζ chain (abbreviated as CD3ζ), connected to red fluorescent protein (abbreviated as mCherry) through the cleavage site T2A (abbreviated as T2A), and the gH / gL single-chain antibody against Epstein-Barr virus is composed of gH / gL scfv-VH, linker, and gH / gL scfv-VL in series.

[0042] 3. If Figure 1As shown, the CAR molecular structure of G15 (gH / gL scfv IL-15 / IL-15Rα) adds IL-15 / IL-15Rα sequence on the basis of gH / gL scfv CAR molecule, which is connected with gH / gL scfv CAR through a furin cleavage site P2A ribosome skip sequence (P2A for short), and the IL-15 / IL-15Rα sequence is connected with a red fluorescent protein (mCherry for short) through a cleavage site T2A (T2A for short).

[0043] Table 1: Amino acid sequences of related structures

[0044] Amino acid sequence name Amino acid sequence number IL-15 / IL-15Rα SEQ ID No: 1 gH / gL scfv-VH SEQ ID No: 2 gH / gL scfv-VL SEQ ID No: 3 CD8 hinge-TM-41BB-CD3Z SEQ ID No: 4 mCherry SEQ ID No: 5

[0045] Example 2 Identification of target cells

[0046] 1. Culturing target cells

[0047] 1.1 Luciferase-expressing nasopharyngeal carcinoma HK cell line: HK-1Luc (1640 culture medium + 10% fetal bovine serum + 100 U / ml penicillin + 100 μg / ml streptomycin).

[0048] 1.2 Luciferase-expressing lymphoma cell line: B-LCL Luc (1640 culture medium + 10% fetal bovine serum + 100 U / ml penicillin + 100 μg / ml streptomycin).

[0049] 2. Identification of EB virus gH / gL expression in HK-1 and B-LCL target cells

[0050] 2.1 DNA of HK and B-LCL cells was extracted using an omega DNA extraction kit, and PCR amplification was performed, using the following primers: gH-qF upstream primer 5'-3' (SEQ ID No: 6): ATACTCGAGAT GCAGTTGCTCTGTG; gH-qR downstream primer 5'-3' (SEQ ID No: 7): CCCAAGCTTG AGTGTGCTCTTTCTTCATCA; gL-qF upstream primer 5'-3' (SEQ ID No: 8): CCCAA GCTTATGCGTGCTGTTGGTGTATT; gL-qR downstream primer 5'-3' (SEQ ID No: 9): CCCTCTAGACTAGCCCCCGCGATGCC, and Table 2 shows the concentrations and volumes of each component of the PCR reaction solution.

[0051] Table 2: Concentrations and volumes of each component of the PCR reaction solution

[0052] Reagent name Volume (μL) Cell DNA 5 Upstream primer 1 Downstream primer 1 dNTP Mixture (2.5 mM) 2 5×PrimeSTAR GXL Buffer 4 PrimeSTAR GXL DNA Polymerase 1 Dnase Free H2O 6 Total amount 20 μL

[0053] 2.2 All PCR products were identified by agarose gel electrophoresis, and the results are shown in Figure Figure 2 from left to right are HK-1 (gH), HK-1 (gL), B-LCL (gH), B-LCL (gL), HK-1 (GAPDH), B-LCL (GAPDH), blank group and DL2,000 DNA marker. The electrophoresis results are consistent with gH (2118bp), gL (411bp), GAPDH (111bp).

[0054] Example 3 Preparation of retrovirus

[0055] SFG-gH / gL CAR and SFG-IL-15 / IL-15Rα-gH / gL CAR-NK target plasmids were co-transfected with pRDF (envelope plasmid, env) and pEQ-PAM3 (-E) (packaging plasmid, gag-pol) into 293T / 17 cells to prepare retrovirus.

[0056] 1. Preparation of 293T / 17 cells: thaw one tube of frozen 293T / 17 cells in a 37°C water bath, inoculate two 10cm 2 cell dishes, with an inoculation density of about 2×10 6 cells / dish, and add 10mL of complete medium to each dish; the next day, change the medium, and when the cell state is stable, passage the 293T17 cells, and on the sixth day, passage the cells into 10cm dishes for retrovirus packaging, 2-4×10 6 293T / 17 (10mL) are inoculated into 10cm dishes, and plasmid transfection is performed 12-16h after inoculation.

[0057] 2. Retrovirus plasmid transfection of 293T / 17

[0058] 2.1 Plasmid transfection is performed using the Lipofectamine 3000 transfection kit, and Lipofectamine 3000 mix is prepared according to the instructions, and then the plasmid mixture DNA Master Mix is prepared in the order shown in Table 3 below.

[0059] Table 3: DNA Master Mix

[0060] Reagent name Amount required per portion Opti-MEM 1 mL P3000 Regent 30 μL SFG vector plasmid 3.75 μg pRDF 2.5 μg pEQ-PAM3(-E) 3.75 μg

[0061] 2.2 SFG vector plasmids include SFG-gH / gL scfv CAR, SFG-IL-15 / IL-15Rα-gH / gL scfv CAR and SFG.CNb30_opt.IRES (empty control); gH / gL CAR is marked as G, and IL-15 / IL-15Rα-gH / gL CAR is marked as G15.

[0062] 2.3 After incubating Lipofectamine 3000 mix and DNA Master Mix at room temperature for 5 min, add Lipofectamine 3000 mix dropwise to DNA Master Mix, incubate at room temperature for 20 min; add the incubated DNA-liposome mixture dropwise to 293T / 17 culture dishes, mix gently with a cross; observe GFP fluorescence under a fluorescence microscope after transfection for 48 and 72 h, collect the virus, filter with a 0.45 pm needle filter, and store at -80°C for standby use.

[0063] Example 4 Preparation and detection of CAR-NK cells

[0064] 1. Isolation and purification of NK cells

[0065] Take umbilical cord blood from healthy pregnant women, centrifuge at 300g for 10 min, aspirate the upper plasma, dilute the lower cells with PBS at 1:1, gently blow, add a 1.5 ml Purification Factor Cocktail, mix gently, incubate at room temperature for 20 min, resuspend with an equal amount of PBS, mix gently. Take another 50 ml centrifuge tube, add 15 ml of Ficoll solution to each, carefully add the umbilical cord blood to the Ficoll at a ratio of 2:1. Centrifuge at 1200g for 20 min, after centrifugation, take the white membrane layer, wash twice with PBS at more than 5 times the volume, centrifuge at 100g for 10 min, discard the supernatant, count with AO / PI, and detect the CD3 / CD56 ratio by flow cytometry.

[0066] 2. Activation of NK cells

[0067] Coat the treated Tissue Culture 24-well plate with NK cell activator OKE432, CD16, and IL15 at a certain concentration, 1 ml per well, at 4°C for 16 h or more, add 3x10 6 NK cells per well.

[0068] 3. Retrovirus infection of NK cells

[0069] 3.1 Coat the 24-well plate with RetroNectin solution of the corresponding volume prepared with PBS, prepare PBS and RetroNectin according to the instructions, seal the edges of the plate with Parafilm, and coat at 4°C overnight.

[0070] 3.2 NK activation fourth day CAR gene transduction, coated with virus liquid, take out the virus liquid 12h in advance, 4℃ thaw, recover RetroNectin solution, add 2mL virus liquid per well, adhere to add gently, Parafilm seal edge, centrifuge 2000g*60min, RT; collect activated NK cells, 0.2~0.3*10 6 6 / mL, add 2ml NK cells per well, 1000g*10min, put into 37℃ 5% CO2 incubator culture. Virus infection 72h after cell detection CAR molecule expression rate, using FlowJo software analysis, results as shown in Figure 3 , G15 group CAR molecule expression rate is about 77.8%, G group CAR molecule expression rate is about 90.1%, Non-Transduced group (NT group) CAR molecule expression rate is 0.29%.

[0071] Example 5 effector target ratio killing experiment

[0072] Inoculate target cells in 48 well plates, HK-1Luc and B-LCL Luc according to 1*10 5 / 500μL RPMI1640 complete medium per well, inoculate the plate; NT group, G group, G15 group of 14d and 21d cells according to the corresponding effector target ratio (1:1, 5:1, 10:1) into 15ml centrifuge tube after centrifugation, resuspended in 500μL NK cell culture medium respectively with HK-1Luc and B-LCL Luc co-culture 6h.

[0073] Figure 4A and 4B The killing rate of three groups of NK cells on HK-1Luc is shown, NT group at effector target ratio of 1:1, the killing rate of HK-1 is 8.91±1.12%, with the increase of effector target ratio, the killing efficiency is stable at 26.92±9.07% (5:1) and 26.85±7.98% (10:1); G group and G15 group of HK-1 killing rate is significantly higher than that of NT group (P<0.05), low effector target ratio (5:1) can reach 70%~90% of the killing rate; as shown in Figure 4A , G and G15 group of transduced NK cells cultured for 14d, co-culture with HK-1 killing effect did not show obvious difference (P>0.05). With the increase of NK cell culture time, as shown in Figure 4B , at 21d, G15 group of IL-15 / IL-15Rα fusion protein combined expression, the killing effect of HK-1 cells is unexpectedly stronger than that of corresponding second generation CAR NK cells G group (P<0.01).

[0074] Figure 5A and 5BThree groups of NK cells were shown to kill B-LCL at a rate of Figure 5A As shown, the killing rate of group G on B-LCL was 34.25±5.73% at an effector-target ratio of 1:1, and the killing efficiency stabilized at 62.3±8.06% (5:1) and 68.3±11.64% (10:1) as the effector-target ratio increased; higher than that of the NT group (P<0.05). As the culture time of NK cells increased, the killing effect of group G weakened, but unexpectedly, as shown in Figure 5B

[0075] Example 6 ICS detection

[0076] ICS was used to detect the expression of CD107a, IFN-γ, TNFα, IL-2 and Granzyme B cytokines in NK cells co-cultured with HK-1Luc and B-LCL Luc, to explore the activity and specificity of the cytokine immune response.

[0077] 1. Effector-target cell co-culture: Count the target cells, resuspend them in NK cell culture medium, and inoculate a U-bottom 96-well plate at a concentration of 1×10 5 Non-Transduced CAR-NK, G CAR-NK and G15 CAR-NK were counted, and inoculated into a U-bottom 96-well plate at an effector-target ratio of 5:1 (1×105 cells / 100 μL / well). CD107a PE-Cy7 flow antibody (1 μL / Test) and BFA solution (2 μL / Test) were added at the same time, and the cells were collected after incubation in a 1:1000 Monensin, 37°C, 5% CO2 incubator for 12 h for flow cytometry staining.

[0078] 2. Antibody incubation and flow detection

[0079] 2.1 After 12 h of co-culture, the U-shaped 96-well plate was centrifuged at 400g*5min, and the liquid in the well plate was gently shaken off after centrifugation. A clean paper towel was lightly tapped, and cell precipitates were visible at the bottom after centrifugation;

[0080] 2.2 Add 250 μL FACS buffer to each well and centrifuge at 400g*5min for washing;

[0081] ​2.3 Prepare LIVE / DEAD Fixable Dead Cell, add DMSO reconstituted fluorescent dye to PBS, add 1 μL dye to 999 μL PBS at a ratio of 1:1000, add 100 μL diluted dye to each sample, incubate at 4°C in the dark for 30 min;

[0082] 2.4 Wash once with 250 μL PBS, 400g*5min;

[0083] 2.5 Perform flow surface antibody staining steps: take 2 μL CD56 flow antibody to stain for 20 min, centrifuge at 400g*5min to discard the supernatant, wash once with 250 μL FACS buffer;

[0084] 2.6 Add 100 μL BD Fixation / Permeabilization solution to resuspend, fix at 4°C for 20 min;

[0085] 2.7 Add 250 μL 1x BD Perm / Wash buffer, centrifuge to wash twice at 400g*5min;

[0086] 2.8 Prepare cytokine antibody diluent (50 μL BD Perm / Wash + 50 μL of Brilliant Stain Buffer, 1:1), 100 μL / Test, add cytokine antibodies (IFN-γ PE, TNF-α BV510, Granzyme B PE-Texas Red) 2 μL / Test, incubate at 4°C for 30 min;

[0087] 2.9 Wash twice with 250 μL 1x BD Perm / Wash buffer, resuspend with 100 μL FACS buffer before loading onto the machine.

[0088] 2.10 Under the condition of 5:1 effector target ratio, add HK-1 and B-LCL co-culture, as shown in Figure 6A-6C and Figure 7A-7C The expression levels of TNF-α, IFN-γ, and CD107a in the G group and the G15 group were significantly higher than those in the NT group, Figure 6D and 7D The expression level of Granzyme B was significantly increased and there was no difference in the NT group, the G group and the G15 group.

[0089] Example 6 In vivo tumor inhibition experiment of CAR-NK cells

[0090] Using Saline, NT, G and G15 groups as effector cells and HK 1Luc and B-LCL Luc as target cells, the inhibitory effect on subcutaneously transplanted solid tumors and tail vein transplanted hematologic tumors in NOD.Cg-Prkdcscid IL2rgtm1Wjl / SzJ (NSG) mice was tested.

[0091] Twenty NSG mice aged 6 to 8 weeks were subcutaneously injected with 3×10 6 HK-1Luc, and wait until the average tumor volume grows to about 40mm 3 The mice were randomly divided into Saline control group, NT control group, G control group, and G15 experimental group, and Saline (100 μl / mouse) or corresponding NK cells (2×10 7 The day of injection of the test substance was recorded as treatment day 0. Tumor volume and mouse body weight were measured 4-5 times a week.

[0092] Twenty NSG mice aged 6 to 8 weeks were selected and injected with 1×10 6 When the average proportion of B-LCL cells in the peripheral blood of mice reached 2%, the mice were randomly divided into Saline control group, NT control group, G control group, and G15 experimental group, and Saline (100 μl / mouse) or corresponding NK cells (5×10 6 The day of test substance injection was recorded as treatment day 0. The proportion of B-LCL cells in the peripheral blood of mice was detected by flow cytometry three times a week.

[0093] like Figure 8 As shown, in the NSG mouse nasopharyngeal carcinoma subcutaneous model, 25 days after the CAR NK cell infusion, the tumor volume of the G15 experimental group was detected to be 372±76mm 3 The tumor volume of group G was detected to be 654±53mm 3 , which was significantly smaller than that of the blank control group (tumor volume was 1518±279mm 3 The results showed that the CAR molecule of the gH / gL single-chain antibody has the ability to target and recognize nasopharyngeal carcinoma cells, and the CAR-NK cell expressing the IL-15 / IL-15Rα fusion protein has a better ability to kill epithelial cell tumors.

[0094] like Figure 9As shown, the proportion of B-LCL cells in the peripheral blood of mice detected by G15 in the G15 experimental group was 8.84±1.06% on the 25th day after CAR NK cell transfusion in the NSG mouse B lymphoma model, and the proportion of B-LCL cells in the peripheral blood detected by G was 10.3±0.75%, which was significantly less than that of the blank group (14.86±1.51% of B-LCL cells in the peripheral blood). The results showed that the CAR molecule of the gH / gL single-chain antibody had the ability to target and recognize B-LCL cells, and the CAR-NK combined with the expression of IL-15 / IL-15Rα fusion protein had better ability to kill B lymphoma cells.

[0095] Obviously, the above-described embodiments are only a part of the embodiments of the present application, and are not all the embodiments. The preferred embodiments of the present application are shown in the drawings, but do not limit the patent scope of the present application. The present application can be implemented in many different forms, and conversely, the purpose of providing these embodiments is to make the disclosure of the present application more thorough and comprehensive. Although the present application has been described in detail with reference to the foregoing embodiments, those skilled in the art can still modify the technical solutions described in the foregoing specific embodiments, or equivalently replace some of the technical features. Any equivalent structure made by using the content of the specification and drawings, directly or indirectly used in other related technical fields, is also within the patent protection scope of the present application.

Claims

1. A chimeric antigen receptor CAR targeting human Epstein-Barr virus, characterized in that: The antibody comprises the following structures: a gH / gL single-chain antibody against EB virus, a transmembrane region and an intracellular signal transduction region.

2. The chimeric antigen receptor CAR targeting human Epstein-Barr virus according to claim 1, characterized in that The gH / gL single-chain antibody against Epstein-Barr virus contains the amino acid sequences of SEQ ID No: 2 and SEQ ID No:

3.

3. The chimeric antigen receptor CAR targeting human Epstein-Barr virus according to claim 2, characterized in that Also included is IL-15 / IL-15Rα cytokine, which contains the amino acid sequence of SEQ ID No:

1.

4. The chimeric antigen receptor CAR targeting human Epstein-Barr virus according to claim 3, characterized in that The transmembrane region is CD8 TM, and the intracellular signal transduction region is the costimulatory signaling domain CD137 of 4-1BB and the signaling domain CD247 of the ζ chain of the human CD3 complex.

5. The chimeric antigen receptor CAR targeting human Epstein-Barr virus according to claim 4, characterized in that It also includes a hinge domain located between the single-chain antibody and the transmembrane region.

6. The chimeric antigen receptor CAR targeting human Epstein-Barr virus according to claim 5, characterized in that It is composed of the following structures in series: signal peptide CD8 (SP), gH / gL single-chain antibody against Epstein-Barr virus, hinge domain, transmembrane region, intracellular signal transduction region and IL-15 / IL-15Rα.

7. A CAR-NK cell targeting human Epstein-Barr virus, characterized in that: The method is prepared by transducing NK cells with the chimeric antigen receptor CAR targeting human Epstein-Barr virus as described in any one of claims 1 to 6.

8. The CAR-NK cell according to claim 7, characterized in that The NK cells are obtained from umbilical cord blood.

9. The CAR-NK cell targeting human Epstein-Barr virus according to claim 6, characterized in that The preparation method includes: S1, constructing a retroviral vector containing a chimeric antigen receptor CAR; S2, retroviral packaging; S3, taking umbilical cord blood to separate and purify NK cells and then activate the NK cells, obtaining NK cells by enrichment method, culturing and activating them with factors CD16, OKE432 and IL15 at a certain concentration, and performing CAR gene transduction virus infection on the 4th day after activation; S4, collecting the activated NK cells through viral infection.

10. Use of the CAR-NK cell targeting human Epstein-Barr virus according to any one of claims 7 to 9 in the preparation of a drug for treating human Epstein-Barr virus infection.

Images