Primer probe composition for detecting Southeast Asia deletion type alpha-thalassemia and application thereof
By using a primer-probe combination and droplet digital PCR technology, total DNA is extracted from cervical exfoliated cells, achieving high sensitivity and high specificity for Southeast Asian deletional α-thalassemia detection, solving the problems of cumbersomeness and invasiveness of detection in existing technologies and promoting the development of non-invasive prenatal diagnosis.
Patent Information
- Application Number
- CN202511212907.9
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-08-27
- Publication Date
- 2025-10-17
AI Technical Summary
Existing non-invasive prenatal testing methods for Southeast Asian deletional α-thalassemia are cumbersome and rely on low concentrations of free fetal DNA, making it difficult to achieve high sensitivity and high specificity in testing. They cannot effectively avoid the invasiveness of traditional invasive diagnosis and the limitations of conventional non-invasive testing.
A primer-probe combination is provided for droplet digital PCR, which directly extracts total DNA from cervical exfoliated cells. Highly specific detection is performed through a combination of primers and probes, enabling analysis of samples with a mutation rate as low as 2% and 101 copies/μL, and inferring the fetal genotype based on the maternal genotype.
It has achieved high sensitivity and high specificity in detecting Southeast Asian deletional α-thalassemia, avoided the risk of miscarriage in traditional invasive diagnosis, simplified the sample collection process, and promoted the popularization of non-invasive prenatal diagnosis and early screening for genetic diseases.
Smart Images

Figure CN120796466A_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The present application relates to the technical field of disease screening, and in particular to a primer probe composition for detecting Southeast Asian deletion type alpha-thalassemia and application thereof. BACKGROUND
[0002] Thalassemia can bring great burden to patient families and society. At present, there is no effective cure for thalassemia, and only by means of standardized premarital screening, pre-pregnancy screening and prenatal diagnosis can the birth of children with severe thalassemia be avoided; especially for children with severe thalassemia, effective screening and prenatal diagnosis can significantly reduce the incidence. Therefore, attaching importance to relevant prenatal screening and prenatal diagnosis has important significance for reducing the birth of children with severe thalassemia and reducing the spiritual and economic burden of society and patient families.
[0003] In recent years, the research on non-invasive prenatal diagnosis by obtaining fetal trophoblast cells from cervical exfoliated cells of pregnant women has attracted much attention. However, most of such detection methods require enrichment operation and complicated steps, and put high requirements on experimental operators, and the large-scale popularization and application in clinics still needs to be explored. Therefore, developing a new non-invasive prenatal genetic disease detection method for effective analysis of trophoblast cells existing in cervical exfoliated cells has important significance for realizing non-invasive prenatal diagnosis and earlier prenatal genetic screening. SUMMARY
[0004] The present application aims to provide a primer probe composition for detecting Southeast Asian deletion type alpha-thalassemia and application thereof, which can be used for detecting samples with a mutation rate as low as 2% and a mutation gene concentration as low as 10 1 copies / μL, and is suitable for trace sample analysis.
[0005] In order to achieve the above-mentioned application purposes, the present application provides the following technical solutions:
[0006] The present application provides a primer probe composition for detecting Southeast Asian deletion type alpha-thalassemia, which comprises a primer set and a probe;
[0007] The primer set comprises primer set 1 consisting of an upstream primer as shown in SEQ ID No. 1 and a downstream primer as shown in SEQ ID No. 2, and primer set 2 consisting of an upstream primer as shown in SEQ ID No. 3 and a downstream primer as shown in SEQ ID No. 4;
[0008] The probe comprises probe 1 as shown in SEQ ID No. 5 and probe 2 as shown in SEQ ID No. 6.
[0009] Preferably, the 5' end of the probe 1 and the probe 2 are both modified with a fluorescent reporter group, and the 3' end of the probe 1 and the probe 2 are both modified with a fluorescent quencher group.
[0010] Preferably, the fluorescent reporter group comprises FAM and HEX, and the fluorescent quencher group comprises BHQ1.
[0011] Preferably, the primer set 1 and the probe 1 are both used for detecting normal alpha globin gene, and the primer set 2 and the probe 2 are both used for detecting Southeast Asian deletion breakpoint gene.
[0012] The application also provides use of the primer probe composition in preparation of a reagent or kit for detecting Southeast Asian deletion alpha-thalassemia.
[0013] The application also provides a method for detecting Southeast Asian deletion alpha-thalassemia for non-diagnostic and non-therapeutic purposes, comprising the following steps:
[0014] (1) extracting total DNA of cervical exfoliated cells;
[0015] (2) using the primer probe composition to perform microdroplet digital PCR on the cervical exfoliated cells to determine whether the subject has Southeast Asian deletion alpha-thalassemia.
[0016] Preferably, the amplification program of the microdroplet digital PCR in step (2) is 95℃ enzyme activation for 10 min, 94℃ denaturation for 30 s for 40 cycles, 55.7℃ annealing for 1 min for 40 cycles, 98℃ enzyme inactivation for 10 min, and 4℃ holding for an unlimited time.
[0017] Preferably, the reaction system of the microdroplet digital PCR in step (2) is 20 μL, containing ddPCR Supermix for Probes (No dUTP) 10 μL, 100 μM upper and lower primers of primer set 1 each 0.18 μL, 100 μM upper and lower primers of primer set 2 each 0.18 μL, 10 μM probe 1 10.6 μL, 10 μM probe 2 6.06 μL, total DNA of cervical exfoliated cells 2 μL, and nuclease-free water 6.08 μL.
[0018] Compared with the prior art, the application has the following beneficial effects:
[0019] The primer probe composition for detecting Southeast Asian deletion alpha-thalassemia provided by the application can be used to detect samples with a mutation rate as low as 2% and a mutation gene concentration as low as 10 1 copies / μL, and is suitable for trace sample analysis.
[0020] The present application takes the Southeast Asian type alpha-thalassemia with the highest carrying rate as a breakthrough, proposes that total DNA of a cervical exfoliated cell sample without enrichment can be directly extracted, and the content of mutant and wild type alpha gene clusters in the sample is absolutely quantified and the ratio is calculated by using ddPCR (digital droplet PCR), and the ratio is used to realize the purpose of identifying the fetal thalassemia genotype of the cervical exfoliated cell sample without enrichment. Specifically, the present application realizes the indirect inference of the fetal genotype by dynamic analysis of the wild type / deletion type gene ratio combined with the mother's genotype.
[0021] The present application avoids the abortion risk of traditional invasive prenatal diagnosis (such as amniocentesis) by collecting total DNA of a cervical exfoliated cell sample, breaks through the limitation of traditional non-invasive detection relying on low concentration of free fetal DNA, makes the sample collection more simple, does not need complex operations of enriching fetal cells or DNA, and is less invasive, thereby providing a new strategy for non-invasive prenatal diagnosis and promoting the popularization of early screening of genetic diseases.
[0022] The present application overcomes the limitation of non-specific combination of dye method by detecting Southeast Asian type alpha-thalassemia by using a high specificity (sensitivity and specificity both reach 100%) probe method, completes the prenatal genotyping of thalassemia in a non-invasive and efficient manner, and breaks through the invasive risk of traditional invasive diagnosis and the technical bottleneck of conventional non-invasive detection relying on low concentration of free fetal DNA. BRIEF DESCRIPTION OF DRAWINGS
[0023] In order to more clearly illustrate the technical solutions in the embodiments of the present application or the prior art, the drawings needed in the embodiments will be briefly introduced below. Obviously, the drawings in the following description are only some embodiments of the present application, and other drawings can be obtained by those skilled in the art without creative labor.
[0024] Figure 1 Flow chart for detecting Southeast Asian deletion type alpha-thalassemia by using ddPCR;
[0025] Figure 2 Schematic diagram of primer design for Southeast Asian deletion type alpha-thalassemia deletion type and wild type;
[0026] Figure 3 Specificity determination result of the deletion type primer of Southeast Asian deletion type alpha-thalassemia;
[0027] Figure 4 Specificity determination result of the wild type primer;
[0028] Figure 5 Amplification curve of ddPCR, from left to right, the amplification curve of the deletion type, the amplification curve of the wild type;
[0029] Figure 6 A line graph showing the optimization of the annealing temperature;
[0030] Figure 7 The one-dimensional fluorescence intensity scatter plot when the annealing temperature is optimized;
[0031] Figure 8 The results of the detection limit of quantification are as follows: from left to right, the dynamic detection range results of the deletion type and the dynamic detection range results of the wild type;
[0032] Figure 9 is the sensitivity test result;
[0033] Figure 10 Statistical heatmap of simulated samples with different ratios of wild type:deletion type. DETAILED DESCRIPTION
[0034] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as limiting the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.
[0035] It should be understood that the terms described herein are intended only to describe particular embodiments and are not intended to limit the present invention. In addition, for numerical ranges herein, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Each smaller range between any intermediate value within a stated value or stated range and any other stated value or intermediate value within the stated range is also encompassed by the present invention. The upper and lower limits of these smaller ranges may be independently included or excluded within the scope.
[0036] Unless otherwise indicated, all technical and scientific terms used herein have the same meaning as commonly understood by those skilled in the art. Although only preferred methods and materials are described herein, any methods and materials similar or equivalent to those described herein may also be used in the practice or testing of the present invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials associated with the documents. In the event of any conflict with any incorporated document, the contents of this specification shall prevail.
[0037] It will be apparent to those skilled in the art that various modifications and variations may be made to the specific embodiments described herein without departing from the scope or spirit of the invention. Other embodiments will be apparent to those skilled in the art from the description of the invention. The description and examples are intended to be exemplary only.
[0038] As used herein, "comprise", "comprising", "including", "include", "contain", "containing", "have" or "having", "engage" or "engaging", "provide" or "providing", and the like can have the meaning ascribed to them by the US Patent Office's Interpretation Rule 55 and thus include "but not limited to".
[0039] The present application provides a primer probe composition for detecting Southeast Asian deletion type α-thalassemia, which comprises a primer set and a probe;
[0040] The primer set comprises primer set 1 consisting of an upstream primer as shown in SEQ ID No. 1 and a downstream primer as shown in SEQ ID No. 2, and primer set 2 consisting of an upstream primer as shown in SEQ ID No. 3 and a downstream primer as shown in SEQ ID No. 4;
[0041] The probe comprises probe 1 as shown in SEQ ID No. 5 and probe 2 as shown in SEQ ID No. 6.
[0042] In the present application, the nucleotide sequence of the upstream primer of the primer set 1 is GAGAACTGCAGGGAGTATGG (SEQ ID No. 1), the nucleotide sequence of the downstream primer of the primer set 1 is TTCAGCACCTTCTCTTGAGC (SEQ ID No. 2), the nucleotide sequence of the upstream primer of the primer set 2 is GAGGGGAGAAGCTGAGTGA (SEQ ID No. 3), the nucleotide sequence of the downstream primer of the primer set 2 is GCCTTGAACTCCTGGACTTA (SEQ ID No. 4), the nucleotide sequence of the probe 1 is AGGGGAAGCTGAGGTGGGCC (SEQ ID No. 5), the nucleotide sequence of the probe 2 is TCCCCACTGTCGTCGCGGCC (SEQ ID No. 6); the 5' end of the probe 1 and the probe 2 is preferably modified with a fluorescent reporter group, and the 3' end of the probe 1 and the probe 2 is preferably modified with a fluorescent quencher group; the fluorescent reporter group preferably comprises FAM and HEX, and the fluorescent quencher group preferably comprises BHQ1; the 5' end of the probe 1 is modified with FAM, and the 3' end is modified with BHQ1; the 5' end of the probe 2 is modified with HEX, and the 3' end is modified with BHQ1; the primer set 1 and the probe 1 are preferably both for detecting normal α-globin gene; the primer set 2 and the probe 2 are preferably both for detecting Southeast Asian deletion type α-thalassemia.
[0043] The present application also provides the use of the primer probe composition in the preparation of a reagent or kit for detecting Southeast Asian deletion type α-thalassemia.
[0044] The application also provides a method for detecting Southeast Asian deletion type alpha-thalassemia for non-diagnostic and non-treatment purposes, comprising the following steps:
[0045] (1) extracting total DNA of cervical exfoliated cells;
[0046] (2) using the primer probe combination to perform microdroplet digital PCR on the cervical exfoliated cells to determine whether the subject has Southeast Asian deletion type alpha-thalassemia.
[0047] In the application, the amplification procedure of the microdroplet digital PCR in step (2) is preferably 95℃ enzyme activation for 10 min, 94℃ denaturation for 30 s, 40 cycles, 55.7℃ annealing for 1 min, 40 cycles, 98℃ enzyme inactivation for 10 min, 4℃ holding, and the holding time is unlimited; the reaction system of the microdroplet digital PCR is preferably 20 μL, containing ddPCR Supermix for Probes (No dUTP) 10 μL, 100 μM upper and lower primers of primer group 1, each 0.18 μL, 100 μM upper and lower primers of primer group 2, each 0.18 μL, 10 μM probe 10.6 μL, 10 μM probe 20.6 μL, total DNA of cervical exfoliated cells 2 μL, and nuclease-free water 6.08 μL.
[0048] Example 1: Design and optimization of primers and probes
[0049] Design of deletion type primers and probes: for the deletion region breakpoint (i.e. from the 155th base of the gene) of Southeast Asian type alpha-thalassemia patients (NCBI number KX458114.1), design a deletion type specific primer probe group, i.e. the upper primer is located on one side of the deletion region, and the lower primer is located on the other side of the deletion region. Ensure that the deletion type primer probe amplification fragment contains the target gap region.
[0050] Design of wild type (i.e. normal healthy person) primers and probes: for the sequence of healthy people (NCBI number NC000016.10), design wild type primers and probes in the Southeast Asian type alpha-thalassemia large fragment deletion region.
[0051] The sequences of the designed primers and probes are shown in Table 1.
[0052] Table 1: Sequences of wild type and deletion type primer groups and probes for Southeast Asian type alpha-thalassemia
[0053] Primer / Probe Sequence (5'→ 3') Wild type upstream primer GAGAACTGCAGGGAGTATGG (SEQ ID No. 1) Wild type downstream primer TTCAGCACCTTCTCTTGAGC (SEQ ID No. 2) Deletion type upstream primer GAGGGGAGAAGCTGAGTGA (SEQ ID No. 3) Deletion type downstream primer GCCTTGAACTCCTGGACTTA (SEQ ID No. 4) Wild type probe FAM-AGGGGAAGCTGAGGTGGGCC-BHQ1 (SEQ ID No. 5) Deletion type probe HEX-TCCCCACTGTCGTCGCGGCC-BHQ1 (SEQ ID No. 6)
[0054] To verify the specificity of the primers, the two sets of primers screened were subjected to melting curve analysis. Melting curve refers to the curve of the degradation degree of DNA double helix structure with temperature rising. In melting curve analysis, specific products show single peak shape at characteristic temperature, which can be effectively distinguished from non-specific products such as primer dimers, because the melting temperatures of products of different lengths differ significantly. Specifically, a program of gradually increasing temperature from 60°C to 90°C was set. With the gradual increase of temperature, DNA double strands gradually dissociate into single strands, and the fluorescent dye molecules embedded in the double strands also gradually fall off, and the fluorescence signal intensity gradually decreases. At a certain temperature, the double strands rapidly and massively dissociate, and the fluorescence signal intensity suddenly decreases. At this temperature, the temperature at which half of the double strands dissociate is called the melting temperature (i.e. Tm value). Finally, the DNA double strands completely dissociate into single strands, and the fluorescence value decreases to a background level. The curve of the fluorescence signal during this whole process with the change of temperature is the melting curve, which is called the original graph. After negative derivative conversion, the derivative graph of the melting curve is obtained, and the derivative graph will appear a melting peak, and the temperature corresponding to the melting peak is the Tm value. The results are shown in Figure 3 and Figure 4 .
[0055] The results show that the wild type and deletion type primer melting curves all show single peak, and there is no primer dimer characteristic peak, indicating that the primers have good specificity.
[0056] Example 2 Preparation of standard quality plasmid
[0057] 2.1 Amplification and electrophoresis identification of target fragment
[0058] The target fragment was amplified using the primers screened in Example 1. The target was selected from a healthy person sample without α-thalassemia as the wild type target, and a patient sample with Southeast Asian type deletion of α-thalassemia as the deletion type target. NEB (New England Biolabs) high fidelity enzyme was used for PCR amplification. Before amplification, NEB Tm Calculator (https: / / tmcalculator.neb.com / ) was used to calculate the annealing temperature of the amplification reaction. The calculated annealing temperature of the wild type primer reaction was 66°C, and the annealing temperature of the deletion type primer reaction was 65°C. The PCR reaction program is shown in Tables 2 and 3. After amplification, electrophoresis identification was performed to determine whether the target fragment was correct and there was no non-specific band.
[0059] Table 2 Reaction system
[0060]
[0061] Table 3 Amplification program
[0062]
[0063] 2.2 Product recovery and purification
[0064] The amplified product was purified and recovered using TAKARA MiniBEST DNA Fragment Purification Kit Ver 4.0, and the operation steps were as follows:
[0065] Add 3 times the amount of Buffer DC to the PCR reaction solution (or other enzymatic reaction solution), and then mix uniformly. Place the Spin Column in the Collection Tube. Transfer the mixed solution obtained in the above operation to the Spin Column, centrifuge at 12,000 rpm for 1 min at room temperature, and discard the filtrate (Note: If the filtrate is added to the Spin Column and centrifuged once again, the DNA recovery rate can be improved). Add 700 μL of Buffer WB to the Spin Column, centrifuge at 12,000 rpm for 30 s at room temperature, and discard the filtrate. Repeat the above step. Place the Spin Column on the Collection Tube, and centrifuge at 12,000 rpm for 1 min at room temperature. Place the Spin Column on a new 1.5 mL centrifuge tube, add 25 μL of sterilized water or Elution Buffer at the center of the Spin Column membrane, and stand at room temperature for 1 min (Note: Heating the sterilized water or Elution Buffer to 60°C can improve the elution efficiency). Centrifuge at 12,000 rpm for 1 min at room temperature to elute the DNA. Aliquot the DNA and store it in a -20°C refrigerator for long-term preservation.
[0066] 2.3 Connection and transformation of target fragments and vectors
[0067] The DNA product eluted in the above step was connected and transformed using Transgen pEASY-Blunt Cloning Kit, and the operation steps were as follows:
[0068] Add 1 μL of Cloning Vector and 4 μL of PCR product were mixed gently, and the reaction was carried out at room temperature (25°C) for 10 min according to the instructions, and the amplified product was not more than 1 kb. After the reaction, the centrifuge tube was placed on ice; the ligation product was added to 50 μL Trans-T1 competent cells (the ligation product was added to the competent cells just after thawing), and mixed gently, and then incubated on ice for 30 min; 42°C water bath heat shock for 30 s, immediately placed on ice for 2 min; add 250 μL balanced to LB medium (purchased from Sangon Biotech), 200 rpm, 37°C culture for 1 h. Room temperature 2000 rpm centrifugation for 1 min, discard part of the supernatant (150 μL), light swing suspended bacteria, take all the bacterial liquid and plate on the medium containing ampicillin (Amp), and put into 37°C constant temperature incubator overnight culture 16 h.
[0069] 2.4 Screening of positive clones
[0070] Ten single colonies were picked from the plate and inoculated into 500 μL of LB culture solution with antibiotic Amp (purchased from Merck Sigma Aldrich), and mixed by blowing, and cultured at 37°C, 200 rpm for 4 h until the bacterial solution was turbid. Then, the bacterial solution was centrifuged at 5000 rpm for 5 min at room temperature, and a small amount of colonies were gently dipped with a pipette gun head as the target for PCR amplification, and M13 primers were used for amplification (the reaction system for amplification is shown in Table 4, and the reaction procedure is shown in Table 5). After amplification, the product length was analyzed by gel electrophoresis to confirm the successful transfer of the target fragment.
[0071] Table 4 Reaction system
[0072] Component Volume Final Concentration 2 x EasyPfu PCR SuperMix 5 μL 1× M13 Forward Primer 0.3 μL 300 nM M13 Reverse Primer 0.3 μL 300 nM Template DNA - - Nuclease-Free Water Upto 10 μL -
[0073] Table 5 Reaction procedure
[0074]
[0075] 2.5 Gene sequencing
[0076] According to the PCR electrophoresis results of M13 primers, 50 μL of bacterial solution of several successful clones were sent to Huada Gene for Sanger sequencing, and the sequencing results were compared with the sequence of the target gene. After comparison, glycerol and bacterial solution were mixed in a ratio of 3:2, and stored in a -80°C ultra-low temperature refrigerator for long-term preservation.
[0077] 2.6 Extraction of recombinant plasmid
[0078] Take 10 μL of bacteria solution obtained in step 2.4, add 3 mL of LB culture solution containing Amp, mix well, and place the mixed bacteria solution in a 200 rpm, 37°C constant temperature incubator for overnight culture. Extract plasmid DNA using Easypure Plasmid MiniPrep Kit, and the steps are as follows:
[0079] Centrifuge at 5000 rpm for 10 min at room temperature, discard all supernatant; add 250 μL of RNase A-free colorless solution RB, oscillate to suspend the bacterial pellet, and do not leave small bacterial clumps; add 250 μL of blue solution LB, gently mix 5 times by turning up and down, fully lyse the bacterial cells to form a blue transparent solution, the color changes from semi-transparent to transparent blue, indicating complete lysis (do not exceed 5 min); add 350 μL of yellow solution NB, mix gently 5 times, the solution color changes from blue to yellow, indicating uniform mixing and complete neutralization, until a compact yellow pellet is formed, stand for 2 min at room temperature; centrifuge at 12000 rpm for 5 min, carefully aspirate the supernatant and add it to the centrifugal column, centrifuge at 12000 rpm for 1 min, discard the effluent; add 650 μL of solution WB, centrifuge at 12000 rpm for 1 min, discard the effluent; centrifuge at 12000 rpm for 1 min to completely remove solution WB; place the centrifugal column in a new centrifugal tube, add 30 μL of solution EB (solution EB is preheated in a 60-70°C water bath for better results) to the center of the column, stand for 1 min at room temperature; centrifuge at 10000 rpm for 1 min to elute the DNA, and obtain wild-type and deletion standard plasmids. Divide the DNA and store it in a -20°C refrigerator for long-term preservation.
[0080] 2.7 Determination of primer amplification efficiency
[0081] Dilute the standard plasmids prepared as described above by 10 times in series, and the target of each plasmid is diluted from 10 7 copies / μL to 10 1 copies / μL, with nuclease-free water as a negative control target. Use the fluorescence quantitative PCR (qPCR) method to verify the amplification efficiency and specificity of the designed wild-type and deletion primers. The results are shown in Figure 5 .
[0082] The sequence of the deletion-type primer probe amplification product is: GAGGGGAGAAGCTGAGTGATGGGTCCGGGGGCTTCGCAGGAACTCGGTCGTCCCCACTGTCGTCGCGGCCTGGGGTTCACTTGGGGGGCGCCTTGGGGAGGTTCACTTGGAGGCTGGGGCAGGAGGATCACTTAAGTCCAGGAGTTCAAGGC (SEQ ID No. 7).
[0083] The sequence of the wild-type (i.e. normal healthy person) primer probe amplification product is GAGAACTGCAGGGAGTATGGGAGGGGAAGCTGAGGTGGGCCTGCTCA AGAGAAGGTGCTGAA (SEQ ID No. 8).
[0084] The results show that the amplification efficiency of the wild-type and deletion-type primers is 109.55% and 101.84%, respectively, both of which are within the ideal range, and the linear regression analysis shows that R 2 are greater than 0.99, indicating that Ct and target concentration show a high linear correlation, further indicating that the wild-type and deletion-type probe amplification efficiency is excellent.
[0085] Example 3 Extraction of Cervical Exfoliated Cell DNA
[0086] QIAGEN Blood & Tissue Kit (50) kit (purchased from Qiagen (51304)) was used to extract cervical exfoliated cells, and the extraction method was as follows:
[0087] centrifuged at 190 rpm for 5 min, resuspended with 200 μΐ^of PBS, added with 20 μΐ^of protease K; added with 200 μΐ^of Buffer AL (without ethanol), oscillated thoroughly, incubated at 56°C for 10 min; added with 200 μΐ^of anhydrous ethanol, oscillated thoroughly; the mixed solution was moved to a spin column, the spin column was placed on a 2 ml collection tube, rotated at 8000 rpm for 1 min, the filtrate and the collection tube were discarded; the spin column was placed in a new collection tube, added with 500 μΐ^of Buffer AW1, rotated at 8000 rpm for 1 min, the filtrate and the collection tube were discarded; the spin column was placed in a new collection tube, added with 500 μΐ^of Buffer AW2, rotated at 14000 rpm for 3 min, the filtrate and the collection tube were discarded; the spin column was placed in a new collection tube, added with 200 μΐ^of Buffer AE, incubated at room temperature (15-25°C) for 1 min, rotated at 8000 rpm for 1 min, and cervical exfoliated cell DNA was obtained.
[0088] Example 4 Optimization of ddPCR conditions
[0089] Based on the probe method ddPCR technology to detect Southeast Asia type α-thalassemia wild type and deletion type of annealing temperature optimization, and the introduction of separation degree (formula I) concept, the quantitative visualization of the optimization results.
[0090]
[0091] The detection method of probe ddPCR is: all reagents are thawed to room temperature. Vortex the test tube to ensure uniformity, as concentration gradients can form during storage at -20℃, and finally centrifuge briefly to collect the contents at the bottom of the test tube; before setting up the reaction mixture, prepare the sample at the required concentration according to Table 6; according to the reaction mixture prepared in Table 7 to prepare the required number of reactions, aliquot the mixed sample into each reaction tube, and add the sample to the reaction tube, the initial preparation of the reaction system volume is 22 μL; mix well by vortexing the reaction tube, briefly stir to ensure that all components are at the bottom of the reaction tube, and let the reaction tube equilibrate at room temperature for about 3 min; when the reaction mixture is ready, load 20 μL of each reaction mixture into the sample wells of the droplet generation card, add 70 μL of droplet generation oil to the bottom row of wells in the droplet generation card, cover the droplet generation card with a rubber pad, and place it in the droplet generation instrument; after generating droplets in the droplet generation instrument, the droplets generated in the top row of wells of the generation card are sucked and transferred to the PCR reaction plate, a layer of puncturable heat-seal film is covered on the surface, and a heat-sealing instrument is used for heat-sealing; place the PCR reaction plate in the PCR instrument for amplification; use QX200 Droplet Reader droplet reader to detect and read the droplet fluorescence. The results are shown in Figure 6 and Figure 7 .
[0092] Table 6 Probe method droplet digital PCR system
[0093]
[0094]
[0095] Table 7 Probe method droplet digital PCR system amplification program
[0096] Step Temperature Time Enzyme activation 95℃ 10 min Denaturation 94℃ 30 s, 40 cycles Annealing 55.7℃ 1 min, 40 cycles Enzyme deactivation 98℃ 10 min Hold 4℃ ∞
[0097] The results showed that at low temperatures (55-60°C), resolution was high, but nonspecific amplification was significant. At high temperatures (≥63°C), resolution of both systems decreased simultaneously. The line graph showed that at an annealing temperature of 55.7°C, resolution of both systems reached a maximum, indicating better amplification efficiency. Furthermore, analysis of the droplet distribution patterns using a one-dimensional fluorescence intensity scatter plot showed consistency with the trends shown in the corresponding line graph. Taking into account both resolution and system stability, 55.7°C was ultimately selected as the optimal annealing temperature for the system.
[0098] Example 5 ddPCR performance analysis
[0099] 5.1 LOQ (Limit of Quantitation)
[0100] In order to determine the LOQ of the optimized ddPCR system in Example 3 for detecting Southeast Asian α-thalassemia wild type and deletion type, two plasmids (based on the full-length gold The plasmids containing wild-type and deletion sequences prepared by the Blunt Gene Cloning Kit (double resistance, blunt end) were used as targets, and the initial concentration of each target was 10 3 copies / μL, final concentration 10 0 The CV value was calculated and the lowest target concentration with a detected CV < 20% was defined as the quantitative limit of the dye-based ddPCR system for the target. Figure 8 shown.
[0101] The results showed that the LOQ values of ddPCR for detecting Southeast Asian α-thalassemia wild type and deletion type were 1.47 and 2.59 copies / μL, respectively.
[0102] 5.2 Sensitivity
[0103] The wild-type plasmid and deletion plasmid DNA prepared in Example 2 were mixed at a volume ratio of 100:1 (1%), 1000:1 (0.1%), 2000:1 (0.05%), and 10000:1 (0.01%). At this time, the low concentration of the target was taken as the lowest value of the quantitative lower limit, and the established probe method ddPCR system was used to detect the mixed DNA at different ratios. Three replicates were performed for each ratio, and the CV value was calculated. The results are shown in Figure 2. Figure 9 shown.
[0104] The results show that the probe-based ddPCR detection system for thalassemia can detect one ten-thousandth of the mutation rate (0.01%), and the sensitivity curve of the system has a relatively narrow 95% confidence interval, and the 95% confidence interval is [0.9382, 0.9854], and the ratio of wild-type and deletion-type DNA obtained is consistent with the expectation. In addition, the probe system still maintains a low CV value (≤20%) at the 0.01% mutation rate level, indicating that the detection feasibility of the system in lower mutation rate samples.
[0105] Test Example 1
[0106] The ddPCR method optimized in Example 3 was used to detect 30 clinical samples to verify the ratio hypothesis proposed in Test Example 1 and verify the clinical applicability of the detection system. The 30 clinical samples included 21 wild-type samples and 9 deletion-type samples. The experimental results are shown in Tables 8 and 9.
[0107] Table 830 clinical sample ddPCR determination results
[0108]
[0109]
[0110] Table 95 wild-type / deletion-type ratio results of 5 deletion-type samples
[0111] Deletion type sample number Wild type / deletion type (probe method) 1 2.76 2 2.98 3 2.78 4 3.02 5 4.07
[0112] The results show that the sensitivity and specificity of ddPCR probe method are both 100%. However, we found in the experiment that the ratio of wild-type and deletion-type in the sample is not theoretically 2:1, but has individual differences, so it is necessary to introduce a control group, namely the subsequent maternal sample. Among them, the data of 5 representative deletion-type samples show that the ratio distribution presents obvious sample-to-sample variation. This phenomenon may be due to the following two factors: first, the pathogenesis of mild, intermediate and severe α-thalassemia is complex, and the ratio of deletion-type and wild-type α-gene cluster in different clinical types changes dynamically; second, the mixed maternal genomic DNA in whole blood samples may interfere with the accurate quantification of the target sequence.
[0113] Test Example 2
[0114] Healthy people, Southeast Asian α-thalassemia patient whole blood samples and deletion-type plasmid simulating fetal DNA were used, and the performance of ddPCR in detecting Southeast Asian type α-thalassemia in prenatal was evaluated by adding standard experiments.
[0115] According to the law of free combination of genes, when the mother is a wild homozygote AA, the genotype of the next generation will be a wild homozygote AA (healthy) or a heterozygote Aa (including a silent gene carrier, an alpha-thalassemia characteristic and an intermediate HbH patient); only when both parents are alpha-thalassemia gene carriers, the next generation has a 25% probability of being a severe thalassemia patient, that is, a homozygote aa. Therefore, according to the genotype of the mother and the fetus, the following three cases will occur: ① the mother is a heterozygote Aa and the fetus is a wild homozygote AA, denoted as Aa+AA; ② the mother is a heterozygote Aa and the fetus is a heterozygote Aa, denoted as Aa+Aa; ③ the mother is a heterozygote Aa and the fetus is a mutant homozygote aa, denoted as Aa+aa. Therefore, the present application uses ddPCR to absolutely quantify the content of the deletion type and wild type alpha gene cluster in the cervical exfoliated cell sample, calculates the ratio, compares the ratio with the content ratio of the deletion type and wild type alpha gene cluster contained in the mother herself, and infers the thalassemia genotype of the fetus. The specific performance is shown in Table 10.
[0116] According to the method in Example 2, the cervical exfoliated cell DNA of 10 pregnant women diagnosed as Southeast Asian alpha-thalassemia was extracted (the cervical exfoliated cell samples and the subsequent whole blood samples were provided by the Nanshan District People's Hospital of the Sixth Affiliated Hospital of Shenzhen University; there is no special requirement for the selection standard of the cervical exfoliated cell sample of the pregnant woman, only the mother is a Southeast Asian thalassemia gene carrier, and the father is not required; the whole blood sample only requires the patient to be diagnosed as Southeast Asian thalassemia, and the age and gender information is not required), and it is used as a base sample (the concentration is about 10 2 copies / μL); the strictly quantified wild type whole blood DNA (AA, extracted according to the method in Example 3), the deletion type whole blood DNA (Aa, extracted according to the method in Example 3) and the deletion type plasmid standard (aa, prepared and extracted according to the method in Example 2) are added respectively. By accurately regulating the addition concentration, different genotype combinations (Aa+AA, Aa+Aa, Aa+aa) of mother and fetus are simulated. The standard added is: when the simulated mother DNA: fetus DNA concentration ratio is 10:1 (high concentration fetus DNA group, 10%), the mother source base sample concentration is 10 2 copies / μL, and the concentration of other added DNA is 10 1 copies / μL; when the simulated mother DNA: fetus DNA concentration ratio is 50:1 (low concentration fetus DNA group, 2%), the mother source base sample concentration is 10 2copies / μL, and other added DNA concentration was about 2 copies / μL. (Concentration is the final concentration). Each ratio and concentration gradient set three biological replicates, with 10 samples as the base sample to construct a total of 70 groups of simulated samples, which can verify the quantitative accuracy of the method and the stability in the detection of low-abundance fetal DNA at the same time.
[0117] The quantitative values of wild-type and deletion-type genes were detected by the ddPCR method optimized in Example 3, and the wild-type / deletion-type ratio value was calculated and compared with the control group for correlation analysis, and the p value was calculated.
[0118] Table 10 Spiked experiment
[0119]
[0120]
[0121] The ddPCR results were analyzed using QuantaSoftTMAnalysis Pro software. Reaction wells with droplet number <10000 were considered invalid data. For reaction wells meeting the requirements, threshold lines could be viewed and drawn manually or automatically in a one-dimensional (1-D) scatter plot, showing the number of droplets obtained by the sample and the fluorescence intensity value of each droplet. Droplets above the threshold line were defined as 1, and droplets below the threshold line were defined as 0. The target concentration was calculated by dividing the positive and negative droplet clusters.
[0122] The absolute quantitative concentration of wild-type and deletion-type gene clusters of the sample was obtained by the above operation, and the wild-type concentration / deletion-type concentration was made to obtain the wild-type gene cluster / deletion-type gene cluster ratio value of the sample. When comparing the two ratios, the two-tailed test was used to analyze whether there was a significant difference between the means of the two independent samples. The results are shown in Figure 10 and Table 11.
[0123] Table 11 10 simulated sample probe method detection statistical results
[0124]
[0125] The results show that in cervical exfoliated cell samples, when the deletion-type gene cluster content is more than 10%, the detection rate of the method can reach more than 70%, and when the deletion-type gene cluster content is more than 2%, the detection rate of the method can reach more than 50%.
[0126] From the above examples, the application provides a primer probe composition for detecting Southeast Asia deletion type alpha-thalassemia and application thereof, and the application realizes the purpose of not needing to enrich DNA and fetal thalassemia genotyping by quantifying wild type and deletion type alpha gene clusters in a pregnant woman's cervical exfoliative cell sample and calculating the ratio of the two.
[0127] The above only describes the preferred embodiments of the present application, and it should be noted that, for those skilled in the art, several improvements and refinements can be made without departing from the principles of the present application, and these improvements and refinements should also be considered as the protection scope of the present application.
Claims
1. A primer-probe combination for detecting Southeast Asian deletion α-thalassemia, characterized in that: The primer-probe combination includes a primer set and a probe; The primer set includes a primer set 1 consisting of an upstream primer as shown in SEQ ID No. 1 and a downstream primer as shown in SEQ ID No. 2, and a primer set 2 consisting of an upstream primer as shown in SEQ ID No. 3 and a downstream primer as shown in SEQ ID No. 4; The probes include probe 1 as shown in SEQ ID No. 5 and probe 2 as shown in SEQ ID No.
6.
2. The primer-probe combination according to claim 1, wherein The 5' ends of the probe 1 and the probe 2 are both modified with a fluorescent reporter group, and the 3' ends of the probe 1 and the probe 2 are both modified with a fluorescent quencher group.
3. The primer-probe combination according to claim 2, characterized in that The fluorescent reporter group includes FAM and HEX, and the fluorescent quencher group includes BHQ1.
4. The primer-probe combination according to claim 1, wherein The primer set 1 and probe 1 are both used to detect the normal α-globin gene; the primer set 2 and probe 2 are both used to detect the Southeast Asian deletion and breakage gene.
5. Use of the primer-probe combination according to any one of claims 1 to 4 in the preparation of a reagent or kit for detecting Southeast Asian deletion α-thalassemia.
6. A method for detecting Southeast Asian deletion α-thalassemia for non-diagnostic and non-therapeutic purposes, characterized in that: The steps include: (1) Extraction of total DNA from cervical exfoliated cells; (2) Using the primer-probe combination according to any one of claims 1 to 4, droplet digital PCR is performed on the cervical exfoliated cells to determine whether the patient has Southeast Asian deletion α-thalassemia.
7. The method according to claim 6, characterized in that The amplification program of the droplet digital PCR in step (2) is as follows: enzyme activation at 95°C for 10 min, denaturation at 94°C for 30 s, 40 cycles, annealing at 55.7°C for 1 min, 40 cycles, enzyme inactivation at 98°C for 10 min, and holding at 4°C. The holding time is unlimited.
8. The method according to claim 6, characterized in that The droplet digital PCR reaction system in step (2) is 20 µL and contains 10 µL of ddPCR Supermix for Probes (No dUTP), 0.18 µL each of the upstream and downstream primers of 100 µM primer set 1, 0.18 µL each of the upstream and downstream primers of 100 µM primer set 2, 0.6 µL of 10 µM probe 1, 0.6 µL of 10 µM probe 2, 2 µL of total DNA from cervical exfoliated cells, and 6.08 µL of nuclease-free water.