Method for synthesizing O-succinyl-L-homoserine by dynamically regulating threonine pathway and application of O-succinyl-L-homoserine

Abstract

The invention discloses a method for synthesizing O-succinyl-L-homoserine (OSH) by dynamically regulating and controlling a threonine pathway and application of the O-succinyl-L-homoserine (OSH). Escherichia coli capable of effectively synthesizing OSH is used as an original strain, one of sequential promoters PflhDC, PfliA, PfliF and PfliC in an Escherichia coli flagellum three-level regulation network and a bacillus subtilis self-induction promoter PsrfA is selected to replace an original promoter of a threonine pathway key gene thrB, thrAfbr and metAfbr are overexpressed in plasmids, and the original promoter is subjected to expression to obtain a threonine pathway key gene thrB. Normal expression of a threonine pathway in the early stage of fermentation is realized, and a competitive pathway in the later stage is inhibited, so that thallus growth and OSH synthesis are balanced. The recombinant bacterium constructed by the invention accumulates 128.64 g / L of O-succinyl-L-homoserine within 85 hours of fermentation, a new method is provided for efficient synthesis of OSH, and the recombinant bacterium has important application value.

Description

Technical Field

[0001] The present invention belongs to the technical field of synthetic biology and metabolic engineering, and specifically relates to a method for dynamically regulating the threonine pathway to synthesize O-succinyl-L-homoserine and an application thereof. Background Art

[0002] Quorum sensing is a density-dependent cell signaling mechanism in bacteria. Bacteria synthesize and release signaling molecules through their own synthase genes. As cell density rises, the concentration of these signaling molecules increases. Upon reaching a specific threshold, these molecules bind to corresponding receptor proteins, forming complexes that trigger signaling cascades, altering the expression of specific genes and regulating bacterial group behavior. In synthetic biology, quorum sensing systems are widely studied as communication tools.

[0003] Escherichia coli is a typical peritrichous flagellar bacterium. Its flagellum is composed of three highly conserved substructures: the basal body, the flagellar filament, and the flagellar hook connecting the two. The entire flagellar system contains as many as 25 structural proteins. The E. coli genome contains dozens of regulatory genes related to flagellar structural proteins, forming a three-level transcriptional regulatory network. The cascade regulation of flagella subjects the synthesis and assembly of various flagellar components to strict temporal regulation and management. The operons that control flagellar synthesis are divided into primary operons, secondary operons, and tertiary operons based on the timing of their expression. The transcriptional regulatory factor flhDC is the master regulator of flagellar-related gene transcription. Its operon is the only primary transcriptional regulatory gene that can directly or indirectly activate all other flagellar structural proteins. Secondary operons are directly activated by flhDC and transcribed by RNA polymerases containing σ factors (σ70). These operons can be divided into seven categories: flgAMN, flgBCDEFGHIJ, flhBAE, fliAZY, fliE, fliFGHIJK, and fliLMNOPQR. They encode important regulatory factors and structural proteins such as the flagellar basal body. Among them, fliA encodes a selective σ factor that regulates the transition from early to late flagellar gene expression. The fliA-dependent tertiary operons can be divided into six categories: flgKL, fliDST, flgMN, fliC, tar-tap-cheRBYZ (meche), and motAB-cheAW (mocha), each of which activates its own operon, fliAZY. These tertiary genes primarily encode structural proteins of flagellar filaments and other components, as well as regulatory factors involved in chemotaxis. Because the control of the tertiary transcriptional regulatory network ensures the highly ordered, step-by-step expression of these genes according to the stages of flagellar motor assembly, this study employed this tertiary regulatory network to achieve dynamic regulation of the competing pathway.

[0004] O-succinyl-L-homoserine (OSH) is an important metabolic intermediate with broad application prospects in biosynthesis and other fields. Currently, in the process of OSH synthesis in Escherichia coli, the threonine pathway, as a competing pathway, consumes carbon flux, affecting OSH production. Therefore, how to dynamically regulate the threonine pathway and reduce carbon flux waste is a key issue in increasing OSH production. Summary of the Invention

[0005] The purpose of the present invention is to provide a method for dynamically regulating the threonine pathway to synthesize O-succinyl-L-homoserine and its application, thereby solving the problem of low yield in the prior art of synthesizing O-succinyl-L-homoserine using Escherichia coli.

[0006] In order to solve the above technical problems, the present invention adopts the following technical solutions:

[0007] According to the first aspect of the present invention, a method for dynamically regulating the threonine pathway to synthesize O-succinyl-L-homoserine (OSH) based on the three-level regulatory network of Escherichia coli flagella is provided. Escherichia coli that can effectively synthesize OSH is used as the starting strain, and the temporal promoter P in the three-level regulatory network of Escherichia coli flagella is selected. flhDC 、P fliA 、P fliF 、P fliC , and the Bacillus subtilis autoinducible promoter P srfA Replace the original promoter of thrB, a key gene in the threonine pathway, with any of the threonine pathway promoters, and simultaneously overexpress thrA in the plasmid. fbr and metA fbr , a recombinant Escherichia coli strain was constructed to achieve normal expression of the threonine pathway in the early stage of fermentation and inhibition of the competitive pathway in the later stage, so as to balance bacterial growth and OSH synthesis.

[0008] Preferably, the original promoter of the gene thrB is replaced by CRISPR / Cas9 technology, and the gene thrB in the recombinant strain is replaced by the promoter P flhDC 、P fliA 、P fliF 、P fliC or P srfA Drive expression.

[0009] According to a preferred embodiment of the present invention, the optimal promoter screened is PfliF.

[0010] According to the present invention, the promoter P flhDC The nucleotide sequence of the promoter is shown in SEQ ID NO.1. fliF The nucleotide sequence of the promoter is shown in SEQ ID NO.2. fliAThe nucleotide sequence of the promoter is shown in SEQ ID NO.3. fliC The nucleotide sequence of the promoter is shown in SEQ ID NO.4. srfA The nucleotide sequence is shown in SEQ ID NO.5.

[0011] Preferably, the starting strain is any one of MG1655, W3110, and BW25113 strains derived from Escherichia coli K12.

[0012] According to a second aspect of the present invention, a recombinant Escherichia coli strain for synthesizing OSH constructed using the above method is provided.

[0013] Preferably, Escherichia coli W3110 is used as the starting strain, and the temporal promoter P in the three-level regulatory network of Escherichia coli flagella is selected. fliF Replace the original promoter of thrB, a key gene in the threonine pathway.

[0014] According to a third aspect of the present invention, there is provided a method or use of the recombinant E. coli strain in preparing OSH. The fermentation method comprises: culturing the recombinant E. coli strain in an OSH liquid fermentation medium, centrifuging the fermentation broth, and collecting the supernatant to obtain OSH.

[0015] Preferably, the OSH liquid fermentation medium contains glucose, ammonium sulfate, yeast extract, potassium dihydrogen phosphate, magnesium sulfate and trace elements, and the residual sugar concentration is controlled to be 0.1-10 g / L by feeding during the fermentation process.

[0016] According to a preferred embodiment of the present invention, a method for dynamically regulating the threonine pathway to synthesize O-succinyl-L-homoserine based on the three-level regulatory network of Escherichia coli flagella is provided. The method uses Escherichia coli W3110 (Escherichia coli) (accession number: ATCC27325) which can effectively produce OSH as the starting strain, selects the temporal promoter P in the three-level regulatory network of Escherichia coli flagella, and flhDC 、P fliA 、P fliF 、P fliC and the commonly used autoinducible promoter P from Bacillus subtilis srfA The original promoter of thrB, a key gene cluster in the threonine pathway, was replaced. During the early fermentation phase, the bacteria normally expressed threonine; in the later fermentation phase, this was effectively reduced to optimize OSH synthesis.

[0017] In order to characterize the characteristics of the above promoter, the present invention used green fluorescent protein as a reporter gene and pkk plasmid as a vector to construct P flhDC 、P fliA 、P fliF、P fliC 、P srfA Five plasmids driving green fluorescent protein with temporal promoters, such as pkk-P flhDC -eGFP, by introducing these plasmids into the engineered strains for shake flask fermentation, the fluorescence values ​​and biomass of green fluorescent proteins driven by different promoters were compared.

[0018] However, it should be understood that the present invention is not limited to the E. coli W3110 strain as the starting strain and can also be applied to E. coli K12-derived strains such as MG1655 and BW25113.

[0019] According to the present invention, a different promoter P obtained according to the above construction method is provided. flhDC 、P fliA 、P fliF 、P fliC 、P srfA Efficient production of OSH recombinant bacteria driving gene thrB.

[0020] According to the present invention, there is also provided a different promoter P obtained according to the above construction method. flhDC 、P fliA 、P fliF 、P fliC 、P srfA The recombinant plasmid driving the green fluorescent protein gene was introduced into the engineered strain, and the fluorescence value and biomass of the green fluorescent protein at different times were detected by shake flask fermentation.

[0021] The host strain of the present invention is Escherichia coli W3110, which is an engineered strain capable of synthesizing OSH after genetic modification. In the present invention, the use of different promoters to replace the original promoter of the gene thrB is achieved through CRISPR / Cas9 technology.

[0022] It should be known that bacterial flagellar assembly is regulated by a three-level cascade, which is divided into Class Ⅰ, Ⅱ, and Ⅲ genes, which are activated step by step. The three-level regulatory mechanism of the flagellar system is as follows: Figure 1 As shown in A. Class I: The core is the "master regulator FlhDC," initiating downstream regulation and acting as the "master switch" for the entire flagellar system. Class II: Activated by FlhDC, it expresses the "flagellar hook-basal complex (such as FliF and FliM)," laying the foundation for flagellar structure. Class III: Activated by Class II products, it expresses "flagellar filaments, motors, and signaling proteins (such as FliC and MotA)" to complete the final assembly of the flagellum and confer motility. The gene clusters below (flhDC, flhB, flhC, etc.) form the molecular basis of regulation, ensuring orderly flagellar assembly through hierarchical activation.

[0023] The key point of the present invention is that by utilizing the sequential promoter in the flagellar three-level regulatory network to dynamically regulate the expression of thrB, a key gene in the threonine pathway, normal bacterial growth is achieved in the early stage and the competition pathway is effectively weakened in the later stage, thereby increasing the yield of OSH.

[0024] In summary, the present invention uses Escherichia coli that can effectively synthesize OSH as the starting strain and utilizes the self-regulating promoter P flhDC 、P fliA 、P fliF 、P fliC 、P srfA The in situ promoter replacement of the thrB gene was performed to construct a growth-production dynamic balance regulation strategy. This strategy was applied to the OSH E. coli engineered strain and achieved remarkable results. The present invention screened the optimal promoter P by testing OSH production through shake flask fermentation. fliF This promoter can dynamically regulate the threonine pathway. Shake flask fermentation increased OSH production by 10.4% compared to the control strain, reaching 22.52 g / L. In a 5-L fermentor, 128.64 g / L of O-succinyl-L-homoserine accumulated within 85 hours of fermentation. This invention provides a new method for the efficient synthesis of OSH, possessing significant application value and promising prospects in fields such as biosynthesis. BRIEF DESCRIPTION OF THE DRAWINGS

[0025] Figure 1 Shows P flhDC 、P fliA 、P fliF 、P fliC 、P srfA Promoter replacement of thrB gene. Diagram of the strategy for modifying the original promoter (A) and the application of different self-regulatory promoters to replace thrB gene in OSH production engineered strains (B).

[0026] Figure 2 The fluorescence intensity (A) and the fluorescence intensity per bacterial cell (B) at different stages of shake flask fermentation driven by different self-regulatory promoters for green fluorescent protein genes are shown;

[0027] Figure 3 LLM20 / pKK-thrA is shown fbr -metA fbr (A) and LLM20-b / pKK-thrA fbr -metA fbr (B) Fed-batch fermentation diagram of the strain;

[0028] Figure 4 pKK-thrA is shown fbr -metA fbr Plasmid map. DETAILED DESCRIPTION

[0029] The present invention will be further described below with reference to the following embodiments. The following description is merely a preferred embodiment of the present invention and does not limit the present invention in any other form. Any person skilled in the art may utilize the above disclosed technical content to make equivalent embodiments with equivalent variations. Any simple modification or equivalent variation of the following embodiments made in accordance with the technical essence of the present invention without departing from the content of the present invention shall fall within the scope of protection of the present invention.

[0030] Example 1 Components required for gene integration

[0031] 1.1 Construction of pTarget plasmid

[0032] The CRISPR / Cas9 editing system includes two plasmids, the pTarget plasmid and the pEcCas plasmid. Gene editing requires constructing the corresponding pTarget plasmid and Donor fragment. To construct the pTarget plasmid, gRNA design is required. Using the website http: / / cctop.cos.uni-heidelberg.de / , the N20 sequence is designed: TAGTAAGTATTTTTCAAAAA (SEQ ID No. 6). This 20-bp sequence is used to design primers: pTargetF-flhDC, pTargetF-fliF, pTargetF-fliA, pTargetF-fliC, and pTargetF-srfA. Using the original pTarget plasmid as a template, PCR amplification and transformation verification are performed to obtain the pTarget plasmid carrying the specific gRNA. For detailed steps of the gene editing method, see Patent No. 202410724433.5. The promoter sequences involved in the present invention are shown in the sequence listing as SEQ ID Nos. 1-5, and all primer sequences are shown in the sequence listing as SEQ ID Nos. 9-95. In this study, PhantaMax Master Mix was used to amplify gene fragments using plasmids or bacterial liquid as templates. The amplification system is shown in Table 2, and the PCR program is shown in Table 3.

[0033] 1.2 Construction of upstream and downstream homology arms of corresponding sites and integration fragments

[0034] To obtain the upstream and downstream homology arms, the genome of wild-type Escherichia coli W3110 (purchased from the China General Microbiological Culture Collection Center, accession number: ATCC27325) was used as a template to amplify the homology arms of about 500 bp upstream and downstream of the gene editing site (the sequences of the upstream and downstream homology arms are shown in SEQ ID No. 7-8). The genome of MG1655 was used as a template to amplify the promoter P flhDC 、P fliF、P fliA 、P fliC The promoter P was amplified using the genome of Bacillus subtilis as a template. srfA The above fragments were fused with PCR and purified to obtain the corresponding Donor (P flhDC -Donor, P fliF -Donor, P fliA -Donor, P fliC -Donor, P srfA -Donor) fragment.

[0035] 1.3 Construction of recombinant strains

[0036] The fusion fragment P flhDC -Donor, P fliA -Donor, P fliF -Donor, P srfA -Donor and recombinant plasmids pTargetF-flhDC, pTargetF-fliA, pTargetF-fliF, and pTargetF-srfA were electroporated into LLM20 competent cells containing the pEcCas plasmid (for the construction of competent cells, see reference Ning Y, Wu X, Zhang C, et al. Pathway construction and metabolic engineering for fermentative production ofectoine in Escherichia coli [J]. Metab Eng, 2016, 36: 10-18), and recombinant strains were obtained after screening.

[0037] Example 2 Production of OSH by Shake Flask Fermentation with Engineered Escherichia coli Strains

[0038] 2.1 Shake flask fermentation of engineered E. coli strains

[0039] Construction of pKK-thrA fbr -metA fbr Plasmid: Escherichia coli W3110 bacterial solution was used as template, metA-1 / metA-2 primers were used to clone metA fbr The gene fragment was amplified by PCR; pkk223-thrA fbr (The plasmid construction method reference patent: 202410724433.5, an acid-resistant Escherichia coli engineered strain producing L-homoserine and its construction method and application) plasmid was used as a template, and pkk-1 / pkk-2 was used to convert pkk223-thrA fbrThe backbone was PCR amplified; the plasmid backbone fragment pkk223-thrA fbr and metA fbr The fragments were seamlessly cloned and transformed to obtain pKK-thrA. fbr -metA fbr Plasmid. See the plasmid map for Figure 4 The vector plasmid of this embodiment is preferably the pkk223 plasmid, but it should be understood that the vector plasmid is not limited to the pkk223 plasmid.

[0040] The plasmid pKK-thrA was transformed into fbr -metA fbr , introduced into the engineered strain from which the pTarget and pEcCas plasmids had been eliminated, spread onto LB plates (Amp resistance) and incubated at 37°C for 12 hours to activate the bacteria. A single colony was picked and inoculated into a 5 mL LB tube, 5 μL of Amp antibiotic was added, and the culture was incubated overnight for 12 hours to obtain the primary seed. The next day, 50 μL of antibiotics, 4.5 mL of 50% glucose solution, 500 μL of 1 g / L methionine solution, and 500 μL of 40% magnesium sulfate solution were added to a baffled Erlenmeyer flask. After incubating the primary seed, the remaining culture was transferred to a shake flask and labeled. Incubate in a shaker at 30°C and 220 rpm for 48 hours.

[0041] Luria-Breed Mix (LB) medium: 10 g / L tryptone, 5 g / L yeast extract, solid LB medium supplemented with 2 g / L agar powder. Shake flask fermentation medium: 2 g / L yeast extract, 14 g / L ammonium sulfate, 45 g / L glucose, 4 g / L potassium dihydrogen phosphate, 4 g / L magnesium sulfate heptahydrate, 5 mL / L trace elements, 10 g / L calcium carbonate. Trace elements include: 2 g / L cobalt chloride hexahydrate, 1.35 g / L calcium chloride, 1 g / L copper sulfate pentahydrate, 0.5 g / L manganese sulfate tetrahydrate, 0.23 g / L borax decahydrate, 2.25 g / L zinc sulfate heptahydrate, 0.106 g / L ammonium molybdate, 10 g / L ferric sulfate heptahydrate, and 10 mL concentrated hydrochloric acid (to prevent metal ion oxidation).

[0042] 2.2 Shake flask fermentation results of thrB driven by different self-regulatory promoters

[0043] The OSH-producing strain LLM20 (genotype: E. coli W3110 △ lacI △ metB fliC-thrB △ iclR △ crrTrc-glKTrc-galPTrc-ppcykgA-ykgQ:: pycTrc-asdyjit-yjiv:: thrATrc-pntAB △ pykA △ pykF △ sthA △ add, construction method reference patent: 202410724433.5 (An engineered Escherichia coli strain with acid resistance and L-homoserine production, construction method and application thereof) was constructed in our laboratory. 8 strain, further knocked out the metB gene encoding O-succinylhomoserine lyase, introduced the pyruvate carboxylase pyc gene from Corynebacterium glutamicum, integrated the thrA gene encoding aspartate kinase / homoserine dehydrogenase 1 into the genome, strengthened the pntAB gene encoding pyridine nucleotide transhydrogenase, knocked out the pykA gene encoding pyruvate kinase 2, knocked out the pykF gene encoding pyruvate kinase 1, knocked out the sthA gene encoding pyridine nucleotide transhydrogenase, and knocked out the add gene encoding adenosine deaminase. The elements required for the above gene editing are shown in the sequence listing. The gene editing method refers to the above-mentioned patents. Based on this, the self-inducible promoter P flhDC 、P fliF 、P fliA 、P fliC 、P srfA The original promoter of thrB gene in LLM20 strain was replaced to obtain the corresponding engineered strain. fliC 、P fliF 、P fliA 、P flhDC 、P srfA The engineered strains after replacing the original thrB promoter were named LLM20-a~e respectively.

[0044] The results are as follows Figure 1 As shown in B, P fliC The promoter was used as the control. Without the addition of L-threonine, the biomass of the other strains decreased slightly, especially P srfA The biomass of the strain driven by the thrB promoter decreased more significantly, suggesting that the overall transcription level of these promoters was lower than that of the P fliC Only strain LLM20-b / pKK-thrA fbr -metA fbr (P fliF The promoter-driven thrB) production of O-succinyl-L-homoserine successfully increased the shake flask yield from 20.40 g / L to 22.52 g / L, an increase of approximately 10.4%, achieving a significant increase. fliA 、P flhDC 、PsrfA The yield of the engineered strain driven by the gene was reduced by 46.8%, 65.7% and 84.6% respectively compared with the control strain.

[0045] Example 3 Characterization of green fluorescent protein expression driven by a self-regulated promoter

[0046] 3.1 Construction of green fluorescent protein pkk plasmids driven by different self-regulatory promoters

[0047] pkk-P flhDC -eGFP, pkk-P fliF -eGFP, pkk-P fliC -eGFP, pkk-P fliA -eGFP, pkk-P srfA -eGFP plasmid construction method is similar to that of pkk-P flhDC -eGFP plasmid as an example. PCR amplification of P flhDC Promoter fragment and pkk-eGFP plasmid backbone, gel recovery PCR product, seamless cloning, transformation experiment, coating (Amp resistance), overnight culture at 37℃ for 12 hours, and bacterial picking verification the next day. flhDC Promoter fragment: The template contains E. coli MG1655 bacterial solution, and the primer is P flhDC -1 and P flhDC -2. Amplify the pkk-eGFP plasmid backbone: the template is the bacterial solution containing the pkk-eGFP plasmid, and the primer is P flhDC -eGFP-1 and P flhDC -eGFP-2.P flhDC The sizes of the promoter fragment and pkk-eGFP plasmid backbone fragment are 210 bp and 5653 bp, respectively.

[0048] 3.2 Shake flask fermentation of recombinant strains

[0049] The constructed pkk-P flhDC -eGFP, pkk-P fliF -eGFP, pkk-P fliC -eGFP, pkk-P fliA -eGFP, pkk-P srfA-eGFP was introduced into the engineered strain LLM20. A single colony was picked and inoculated into a 5 mL LB tube. 5 μL of Amp antibiotic was added and cultured overnight for 12 h to obtain primary seeds. The next day, 50 μL of antibiotics, 4.5 mL of 50% glucose solution, 500 μL of 1 g / L methionine solution, and 500 μL of 40% magnesium sulfate solution were added to a baffled Erlenmeyer flask. After the primary seeds were incubated, the remaining culture was transferred to a shake flask and labeled. Culture was carried out in a shaker at 30°C and 220 rpm. Every two hours, 100 μL of a sample was collected and centrifuged at 8000 rpm for 10 min. The cells were harvested and resuspended three times in PBS. A certain volume of the cells was diluted 20-fold and 200 μL was transferred to a 96-well plate. The absorbance and fluorescence of the sample were measured using a microplate reader with an excitation wavelength of 485 nm and an emission wavelength of 528 nm.

[0050] 3.3 Shake flask fermentation results of recombinant green fluorescent protein strain

[0051] The results are as follows Figure 2 As shown, the fluorescence intensity expression curves of different auto-inducible promoters are similar. In the lag phase and the early logarithmic growth phase, the bacterial fluorescence intensity is weak, but shows an upward trend; in the middle and late exponential phase and the early stable phase, the bacterial fluorescence intensity increases rapidly and reaches a maximum value, indicating that during this stage, the transcription level of these promoters is high, which is consistent with the rapid growth trend of the bacteria; in the middle and late stable phase, the bacterial fluorescence intensity remains basically stable. During this period, these promoters are in a state of basically no expression or low expression level. The unit bacterial fluorescence intensity also reaches the maximum value in the logarithmic growth phase. The fluorescence expression trend shows that the expression activity of these promoters is cell density-dependent, and the expression range is from the early cell exponential phase to the stable phase. Promoter expression level: From the total fluorescence ( Figure 2 From the perspective of A), the expression levels of these promoters from high to low are as follows: P fliC >P srfA >P flhDC >P fliF >P fliA ; From the fluorescence intensity of the unit cell ( Figure 2 In B), compared with P fliC , P flhDC 、P fliF and P fliA The maximum fluorescence intensity per unit cell was reached faster, which may be due to the fact that P fliC It is a third-order operon and requires first- and second-order operons for activation.

[0052] It is speculated that under the premise of maintaining normal bacterial growth, in the early stage of shake flask fermentation, compared with P fliC promoter, P fliFThe transcription level was higher, and P fliF P fliC Faster to reach maximum transcription level, P fliF The fluorescence value of the green fluorescent protein driven by the bacteria reached its peak at 12 h. fliC The fluorescence value of the green fluorescent protein driven by the enzyme reached its peak value at about 15 h, and the expression level of the threonine pathway was high, which was beneficial to the growth of the bacteria. fliF The transcription level was lower than that of P fliC , which can effectively weaken the competing threonine pathway and make L-homoserine synthesize more O-succinyl-L-homoserine. fliA 、P flhDC 、P srfA These promoters did not show any positive results in dynamically regulating the threonine pathway. From the fluorescence intensity of the cells, P fliA 、P flhDC The transcription level was lower than that of P fliC , which may not achieve the effect of weakening the threonine pathway; P srfA Transcription level and P fliC Similar, but with much lower production of O-succinyl-L-homoserine, from Bacillus subtilis P srfA The promoter can drive the normal expression of green fluorescent protein gene, but the dynamic regulation of thrB gene is not effective; during the whole fermentation cycle, P fliA The transcription level was significantly lower than that of P fliC Although E. coli can synthesize threonine through metL gene, P fliA The transcription level is too low, the threonine pathway is greatly restricted, which is insufficient to maintain normal bacterial growth and is not conducive to the synthesis of the product O-succinyl-L-homoserine.

[0053] Example 4 P fliF Driving thrB Escherichia coli engineered strain to produce OSH in tank fermentation

[0054] 4.1P fliF Driving the fermentation of thrB Escherichia coli engineered strains

[0055] Preparation of the fermenter: First, add an appropriate amount of ultrapure water to the tank and sterilize it at 115℃ for 20 min for air disinfection; after the empty tank is sterilized, clean the fermenter and rinse the tank body with ultrapure water; then install and calibrate the pH electrode, calibrating the pH to 6.86 and pH 4.0 in turn; after the calibration is completed, pour the prepared fermentation medium and 1 mL of defoamer, and install the fermenter; sterilize the fermenter and the medium therein at high temperature (115℃, 20 min); after sterilization, install the fermenter on the fermentation equipment, connect the pH electrode and ammonia solution, wait for the fermenter temperature to drop to 37℃, and adjust the pH to 7.0; connect the stirring paddle, and set the initial speed to 300 rpm / min; install the aerator, and set the initial ventilation volume to 1 vvm; install the dissolved oxygen electrode and circulating water, and set the temperature to 37℃.

[0056] Fermentation strain culture: First, activate the strain: streak the glycerol bacteria stored at -40°C onto a solid culture medium plate containing ampicillin and incubate it in a 37°C incubator for 12 hours. The next day, pick a single colony from the plate, inoculate it into a 5 mL test tube, and incubate it in a 37°C shaker for 12 hours to obtain the first-level seed. Subsequently, transfer the first-level seed into a 1 L baffled shake flask containing 100 mL of seed culture medium and continue to incubate it at 37°C for 9 hours. The bacterial solution OD 600 About 6, complete the secondary seed preparation.

[0057] Fermentation tank inoculation: prepare the inoculation loop, ensure aseptic operation, quickly add the bacteria, other nutrients (glucose solution and magnesium sulfate solution), and antibiotics after ignition, and seal the fermentation tank immediately after inoculation.

[0058] Parameter control: The dissolved oxygen electrode was calibrated to 100%, the dissolved oxygen was set to 30% and associated stirring; the fermentation pH was automatically adjusted to 7.0; the fermentation temperature was set to 37°C; and the residual sugar was controlled between 0.1 and 10 g / L.

[0059] Fermentation tank seed culture medium: yeast powder 3 g / L, peptone 4 g / L, glucose 35 g / L, potassium dihydrogen phosphate 2 g / L, magnesium sulfate heptahydrate 1.5 g / L, trace element solution 5 mL / L.

[0060] Fermentation medium in the fermenter: peptone 4 g / L, yeast powder 3.5 g / L, glucose 15 g / L, potassium dihydrogen phosphate 2 g / L, magnesium sulfate heptahydrate 1.5 g / L, trace element solution 5 mL / L.

[0061] Trace element solution (1 L): Na2B4O7·10H2O 0.23 g, MnSO4·4H2O 0.5 g, CaCl2 1.35 g, ZnSO4·7H2O 2.25 g, CoCl2·6H2O 2 g, CuSO4·5H2O 1 g, FeSO4·7H2O 10 g, (NH4)6Mo7O 24 ·4H2O 0.106 g, 35% HCl 10 mL.

[0062] Feed: 800 g / L glucose, 0.2 g / L methionine, 5 g / L betaine.

[0063] 4.2 HPLC detection of O-succinyl-L-homoserine concentration

[0064] Sample pretreatment: 1 mL of fermentation broth from each shake flask was transferred to a 1.5 mL EP tube and centrifuged at 12,000 rpm for 10 minutes to remove impurities. The supernatant was diluted 20-fold with ultrapure water. Samples were derivatized with OPA solution (prepared immediately before use) and analyzed by high-performance liquid chromatography. HPLC column: Agilent Phenomenex Luna C18 SB-aq; mobile phase ratio: potassium dihydrogen phosphate solution: acetonitrile = 81:19, potassium dihydrogen phosphate solution pH = 8; UV detection wavelength: 338 nm; flow rate: 0.8 mL / min; detection time: 6 minutes.

[0065] 4.3P fliF Fermentation results of the thrB-driving Escherichia coli engineered strain

[0066] The results are as follows Figure 3 As shown in A, the control strain OSH00 / pKK-thrA fbr -metA fbr At 77.5 h of fermentation, the yield of O-succinyl-L-homoserine reached a maximum of 85.11 g / L. The bacterial biomass was basically stable at around 60 in the middle of the fermentation, about 35 h. The sugar-acid conversion rate reached 35.1%, and the space-time yield was about 1.10 g / L / h. Figure 3 As shown in B, the engineered strain LLM20-b / pKK-thrA fbr -metA fbr The accumulation of O-succinyl-L-homoserine was 128.64 g / L within 85 h of fermentation, the bacterial biomass was stabilized at around 40 after 50 h, the sugar-acid conversion rate reached 50.8%, and the space-time yield was about 1.51 g / L / h, showing good O-succinyl-L-homoserine production capacity.

[0067] Compared with the control strain, P fliF strain LLM20-b / pKK-thrA driving the thrB gene fbr -metA fbr , the bacterial biomass was significantly reduced. Combined with the results of the green fluorescent protein expression per bacterial cell driven by different self-regulatory promoters, it is speculated that P fliF The overall transcription intensity of the promoter is lower than that of P fliC The expression level of the competing pathway threonine pathway was lower, and no exogenous threonine was added during the high-density fermentation process, so the bacterial biomass was low. However, since the competing pathway was further inhibited, the metabolic flow flowed more to the synthesis pathway of the target product, and the production of O-succinyl-L-homoserine increased.

[0068] Table 2 Phanta Max Master Mix system

[0069] Reagents volume 2×Phanta Max Master Mix 25 μL Forward primer 1 μL Reverse primer 1 μL template 1 μL <![CDATA[ddH2O]]> Up to 50 μL

[0070] Table 3 Phanta Max Master Mix amplification program

[0071] Loop steps temperature time Pre-denaturation 95 °C 30 s / 3 min transsexual 95 °C 15 seconds annealing 56~72 °C 15 seconds extend 72 °C 30 sec / kb Complete extension 72 °C 5 min

[0072] Note: Denaturation-extension requires 30-35 cycles. The annealing temperature is generally 3-5 °C lower than the primer Tm value. The extension time depends on the fragment length.

[0073] The above description is merely a preferred embodiment of the present invention and is not intended to limit the scope of the present invention. Various modifications are possible. In other words, any simple, equivalent changes and modifications made in accordance with the claims and description of the present invention are within the scope of protection of the patent claims. Anything not fully described in this invention constitutes conventional technology.

Claims

1. A method for dynamically regulating the threonine pathway to synthesize OSH based on the three-level regulatory network of Escherichia coli flagella, characterized in that: Using Escherichia coli, which can effectively synthesize OSH, as the starting strain, the temporal promoter P in the three-level regulatory network of Escherichia coli flagella was selected. flhDC 、P fliA 、P fliF 、P fliC , and the Bacillus subtilis autoinducible promoter P srfA Replace key threonine pathway genes with any of thrB The original promoter of thrA fbr and metA fbr , a recombinant Escherichia coli strain was constructed to achieve normal expression of the threonine pathway in the early stage of fermentation and inhibition of the competitive pathway in the later stage, so as to balance bacterial growth and OSH synthesis.

2. The method according to claim 1, wherein Gene replacement using CRISPR / Cas9 technology thrB The original promoter of the gene in the recombinant strain thrB By promoter P flhDC 、P fliA 、P fliF 、P fliC or P srfA Drive expression.

3. The method according to claim 1, wherein The optimal promoter was P fliF .

4. The method according to claim 1, wherein Promoter P flhDC The nucleotide sequence of the promoter is shown in SEQ ID NO.

1. fliF The nucleotide sequence of the promoter is shown in SEQ ID NO.

2. fliA The nucleotide sequence of the promoter is shown in SEQ ID NO.

3. fliC The nucleotide sequence of the promoter is shown in SEQ ID NO.

4. srfA The nucleotide sequence is shown in SEQ ID NO.

5.

5. The method according to claim 1, wherein The starting strain is any one of MG1655, W3110, and BW25113 strains derived from Escherichia coli K12.

6. A recombinant Escherichia coli strain for synthesizing OSH constructed using the method according to any one of claims 1 to 5.

7. The recombinant Escherichia coli strain according to claim 6, characterized in that Using Escherichia coli W3110 as the starting strain, the temporal promoter P in the three-level regulatory network of Escherichia coli flagella was selected. fliF Replacement of key genes in the threonine pathway thrB The original promoter.

8. Use of the method according to any one of claims 1 to 5 or the recombinant Escherichia coli strain according to any one of claims 6 to 7 in the preparation of OSH, characterized in that: The fermentation method comprises: culturing the recombinant Escherichia coli strain using an OSH liquid fermentation medium, and centrifuging the fermentation liquid to collect the supernatant to obtain OSH.

9. The use according to claim 8, characterized in that The OSH liquid fermentation medium contains glucose, ammonium sulfate, yeast extract, potassium dihydrogen phosphate, magnesium sulfate and trace elements. During the fermentation process, the residual sugar concentration is controlled to be 0.1-10 g / L by feeding.

Images