Recombinant adenovirus carrying porcine circovirus type 3 Cap gene as well as construction method and application thereof

Abstract

The invention discloses a recombinant adenovirus carrying a porcine circovirus type 3 Cap gene as well as a construction method and application thereof. The recombinant adenovirus is obtained by homologous recombination of a replication-defective adenovirus skeleton plasmid and a recombinant adenovirus shuttle plasmid carrying a target gene, a replication-defective adenovirus skeleton plasmid is pBHGlox [delta] E1, 3Cre; the target gene comprises one or more copied PCV3 Cap genes, the sequence of the PCV3 Cap genes is obtained through codon optimization and is as shown in SEQ ID NO.1, tPA signal peptide is fused at the N end of the PCV3 Cap genes, and the sequence of the target gene is as shown in SEQ ID NO.2. The vaccine prepared from the recombinant adenovirus not only can effectively promote mice to generate strong body fluid and cellular immunity, but also can induce the mice to generate high-level SIgA, thereby helping to resist the attack of the porcine circovirus type 3, and having a wide application prospect.

Description

Technical Field

[0001] This invention belongs to the field of genetic engineering technology, specifically relating to a recombinant adenovirus carrying the Cap gene of porcine circovirus type 3, its construction method, and its application. Background Art

[0002] Porcine circovirus disease (PCV) has become a major concern in the global swine industry in recent years. With the development of molecular detection technologies, in addition to porcine circovirus type 1 (PCV1) and the widely prevalent pathogenic type 2 (PCV2), scientists first discovered porcine circovirus type 3 (PCV3) in diseased pig samples in the United States in 2016, and its presence has since been reported in many countries in Europe, Asia, and the Americas. Current research indicates that PCV3 is associated with various clinical manifestations, including reproductive disorders, myocarditis, dermatitis-nephropathy syndrome (PDNS), and multiple systemic wasting syndrome (MSF), suggesting that it may have significant pathogenic potential in pig farms.

[0003] PCV3 is a member of the genus *Circovirus* in the family Circoviridae. Its genome is a single-stranded circular DNA, approximately 2000 nt in length, primarily encoding two open reading frames: ORF1 encodes the replication-associated protein (Rep), and ORF2 encodes the capsid protein (Cap). The Cap protein is not only a major structural protein of the virus but also a key antigen inducing the host to produce neutralizing antibodies, and is widely used as an important target for vaccine and diagnostic reagent development.

[0004] Currently, research on PCV3 is still in its early stages, and there are no commercially available vaccines. Existing prevention and control measures mainly rely on biosafety measures and adjuvant drugs, but these measures are very limited in their effectiveness under conditions of high viral load, high immune pressure, or co-infection. Therefore, developing a safe, effective, and immunogenic PCV3 vaccine has become an important issue that urgently needs to be addressed.

[0005] With the continuous development of vaccine technology, vector vaccines, especially adenovirus vector vaccines, have shown great application potential in the field of veterinary vaccines. Human adenovirus type 5 (Ad5) is a non-integrating, non-replicating virus whose genome has been modified to remove the E1 and E3 regions, thereby losing its replication ability and allowing for the insertion of exogenous target genes for efficient expression. Ad5 vectors have good immunogenicity, can induce strong cellular and mucosal immune responses, and can be administered via multiple routes such as nasal or oral administration, making them easy to promote in large-scale farming environments.

[0006] Existing studies have shown that exogenous antigens expressed by the Ad5 vector can effectively induce high levels of IgG and SIgA antibodies in animal models such as mice and pigs, while simultaneously activating CD4⁺ and CD8⁺ T cell-mediated cellular immune responses, providing multi-layered immune protection against viral infection. Furthermore, adenovirus vector vaccines can achieve highly efficient immunization without the addition of traditional adjuvants, simplifying vaccine preparation processes and reducing application costs, making them particularly suitable for vaccine development in economically important animals such as pigs.

[0007] Against this backdrop, constructing a recombinant vaccine using human Ad5 replication-deficient adenovirus as a vector to express the PCV3 Cap gene not only aligns with the direction of modern vaccine development but also holds promise as a new strategy for controlling PCV3 infection. In this context, this invention develops a safe, efficient, and widely applicable PCV3 adenovirus vector vaccine through molecular cloning, virus construction, and immunological evaluation. Summary of the Invention

[0008] To address the shortcomings of existing technologies, this invention provides a recombinant adenovirus carrying the Cap gene of porcine circovirus type 3, its construction method, and its application. This invention overcomes the limitations of existing porcine circovirus type 3 (PCV3) vaccines in terms of safety, immunogenicity, and large-scale application, especially the current lack of effective commercial vaccines against PCV3. This vaccine can induce strong humoral, cellular, and mucosal immunity in the host while possessing good biocompatibility and industrialization potential.

[0009] The technical solution provided by this invention is as follows:

[0010] This invention provides a recombinant adenovirus carrying the porcine circovirus type 3 Cap gene, characterized in that the recombinant adenovirus is obtained by homologous recombination of a replication-defective adenovirus backbone plasmid and a recombinant adenovirus shuttle plasmid carrying the target gene; the replication-defective adenovirus backbone plasmid is pBHGlox ΔE1,3Cre; the target gene includes one or more copies of the PCV3 Cap gene, the sequence of the PCV3 Cap gene is a sequence obtained by codon optimization as shown in SEQ ID NO.1, the N-terminus of the PCV3 Cap gene is fused with a tPA signal peptide, and the sequence of the target gene is shown in SEQ ID NO.2.

[0011] The present invention also provides a method for using a recombinant adenovirus carrying the Cap gene of porcine circovirus type 3 as described above, comprising the following steps: (1) The target gene shown in SEQ ID NO.2 is ligated into a shuttle plasmid to obtain a recombinant shuttle plasmid; (2) The above recombinant shuttle plasmid and backbone plasmid pBHGlox ΔE1,3Cre were transfected into host cells using Lipofectamine 3000; (3) Cultivate the host cells described in step (2); (4) The recombinant adenovirus was obtained after plaque purification, screening and identification.

[0012] Furthermore, the shuttle plasmid is pAd5.

[0013] Furthermore, the host cell is HEK293A.

[0014] The present invention also provides the application of the recombinant adenovirus carrying the Cap gene of porcine circovirus type 3 as described above in the preparation of a vaccine for the prevention of porcine circovirus type 3 infection.

[0015] Furthermore, the method for preparing the vaccine includes inoculating HEK293A cells that have grown into a monolayer with the recombinant adenovirus carrying the Cap gene of porcine circovirus type 3 as described in claim 1, which is stored at low temperature, at a 7.5 infection multiple. When the cytopathic effect reaches 70-90%, the virus is harvested, and the vaccine for preventing porcine circovirus type 3 infection can be obtained by repeated freeze-thaw cycles.

[0016] Furthermore, the recombinant adenovirus carrying the Cap gene of porcine circovirus type 3 is prepared as an injection, nasal drop, spray, or inhaler.

[0017] Furthermore, the recombinant adenovirus carrying the Cap gene of porcine circovirus type 3 was prepared as a nasal drop.

[0018] The present invention also provides a vaccine for preventing porcine circovirus type 3 infection, comprising the recombinant adenovirus carrying the Cap gene of porcine circovirus type 3 as described above, and an adjuvant.

[0019] Furthermore, the adjuvant includes one or more of stabilizers, complexing agents, immune enhancers, and water.

[0020] Beneficial effects

[0021] The Ad5-Cap provided by this invention can effectively induce cellular and mucosal immune responses. In a mouse model immunized by intranasal administration, a significant increase in various effector T cells, including CD4+, was detected in lung tissue. + IFN-γ + CD4 + TNF-α + CD4 + GrB + CD8 + IFN-γ + CD8 + TNF-α+ and CD8 + GrB + Meanwhile, Tfh cell levels were also significantly enhanced, indicating that the vaccine can elicit strong helper T cell and killer T cell responses.

[0022] The Ad5-Cap provided by this invention can induce local mucosal immunity. By detecting the bronchoalveolar lavage fluid of immunized mice, a significant increase in the level of specific secretory IgA (SIgA) was found, indicating that it can effectively activate the mucosal immune barrier of the upper respiratory tract and lungs, which helps to clear the virus early and block its transmission.

[0023] The Ad5-Cap provided by this invention can also elicit a significant humoral immune response. After immunization, the level of PCV3-Cap-specific IgG in mouse serum significantly increased and exhibited neutralizing ability, indicating that it performs well in inducing humoral immunity and has potential protective properties.

[0024] In summary, this invention provides a novel strategy for constructing PCV3 recombinant adenovirus and vaccine using human Ad5 as a vector, which can effectively induce multi-level immune protective responses. It is particularly suitable for the immune prevention of PCV3 infection in pig farms and has good application prospects and industrial promotion value. Attached Figure Description

[0025] Figure 1 The diagram shows the construction strategy of the recombinant adenovirus Ad5-Cap plasmid of this invention.

[0026] Figure 2 The results shown are the verification results of the recombinant adenovirus Ad5-Cap of the present invention, including Cap gene PCR amplification (A), Western blotting of Cap protein expression in HEK-293A cells (B), and indirect immunofluorescence detection (C).

[0027] Figure 3 The image shows CD4 in the lungs of mice immunized with Ad5-Cap according to this invention. + T cells secrete the cytokine IFN-γ. + TNF-α + and granzyme GrB + The expression level is represented by flow cytometry plots and statistical bar charts.

[0028] Figure 4 The image shows CD8+ in the lungs of mice immunized with Ad5-Cap according to this invention. + T cells secrete the cytokine IFN-γ. + TNF-α + and granzyme GrB + The expression level is represented by flow cytometry plots and statistical bar charts.

[0029] Figure 5 The image shows Tfh cells (CXCR5) in the lungs of mice immunized with Ad5-Cap according to this invention. + PD-1 + Flow cytometry and statistical bar charts of the expression level of Th).

[0030] Figure 6 The image shows germinal center B cells (B220) in the mediastinal lymph nodes of mice immunized with Ad5-Cap according to this invention. + CD95 + GL7 + The expression level of the flow cytometry and statistical bar chart.

[0031] Figure 7 The figure shown is a longitudinal monitoring curve of the specific SIgA content in the body fluid (bronchoalveolar lavage fluid) of mice immunized with Ad5-Cap according to the present invention.

[0032] Figure 8 The figure shown is a longitudinal monitoring curve of specific IgG content in the serum of mice immunized with Ad5-Cap according to the present invention.

[0033] Figure 9 The figure shown is a curve illustrating the change in the level of neutralizing antibodies in mouse serum after immunization with Ad5-Cap according to the present invention. Detailed Implementation

[0034] Example 1

[0035] 1. Construction of recombinant adenovirus Ad5-Cap

[0036] like Figure 1 As shown, this embodiment of the invention provides a method for constructing a recombinant adenovirus carrying the Cap gene of porcine circovirus type 3. The Cap gene recombinant adenovirus is constructed using the 5AdMax system, which contains E1 and E3 deletions. The specific steps are as follows:

[0037] The PCV3 Cap gene (MF318451) was codon-optimized using UpGene software to obtain the sequence shown in SEQ ID NO.1. A tPA signal peptide was added to the N-terminus of the PCV3 Cap gene to enhance its expression in mammalian cells, resulting in the sequence shown in SEQ ID NO.2. Subsequently, homologous recombination technology was used to insert the sequence shown in SEQ ID NO.2 into the pAd5 shuttle plasmid. The N-terminus of the Cap gene sequence is fused with the tPA signal peptide, and its expression is regulated by the CMV promoter. Figure 1The aforementioned shuttle plasmid, along with the E1 / E3-deficient adenovirus backbone plasmid (pBHGlox ΔE1,3Cre), was co-transfected into HEK-293A cells. Lipofectamine 3000 transfection reagent (Thermo, L3000015) was used for liposome-mediated transfection. After transfection, cells were cultured at 37°C and 5% CO2. Following three rounds of plaque purification, the cells were purified by ultracentrifugation over a cesium chloride gradient. The titer (ifu / ml) in HEK-293A cells was determined using the Spearman-Karber method after staining with horseradish peroxidase (HRP)-conjugated anti-Ad5 pentanone antibody and 3,3'-diaminobenzidine (DAB) substrate. In summary, HEK-293A cells were infected with serially diluted recombinant adenovirus, and adenovirus DNA-binding proteins were detected by immunocytochemistry 24 hours post-infection. Positive cells were counted using fluorescence microscopy, and IFU per milliliter was determined using dilution factors and microscopic constants. The cells were then frozen and stored at -80°C for later use.

[0038] SEQ ID NO.1: ATGGAGCACAGAGCTATATTCAGAAGAGACCCCGCCCAAGGAGACGACGACGCCACAGAGGCGCTATGTCAGAAGAAAACTATTCATTAGGAGGCCCACAGCTGGCACATACTACACAAGAAATACTCCACCATGAACGTCATTTCCGTTGGAACCCTCAGAATAACAAGCCCTGGCACGCCAACCACTTCATTACCCGCCTAAACGAATGGGAAACTGCAATTAGCTTTGAATATTATAAGATACTAAAGATGAAAGTTACACTCAGCCCTGTAATTTTCCGGCTCAGCAAACAAAAACTATGTTCGGGCACACAGCCATAGATCTAGACGGCGCCTGGACCACAAACACTGGCTCCAAGACGACCCTTACGGAAAGTTCCACTCGTAAAGTTATGACTTCTAAAAAAAAACACAGCCGTTACTTCACCCAAAACCACTTCTGGCGGGAACTACCAGCGCTCACCCAGGACAAAGCCTCTTCTTTTCCCAGACCCACCCCATGGCTCAACACATATGACCCACCGTTCAATGGGGAGCACTGCTTTGGAGCATTTATGTCCCGGAAAAAACTGGAATGACAGACTTCTACGGCACCAAAGAAGTTTGGATCGTTACAAGTCCGTTCTCTTAA;

[0039] SEQ ID NO.2: .

[0040] 2. Identification and titer determination of recombinant adenovirus Ad5-Cap

[0041] 2.1 Identification of inserted foreign genes.

[0042] Following the instructions of the viral DNA extraction kit (Tiangen Biotech Co., Ltd., DP315), the adenovirus genome was extracted from the amplified viral solution and used as a template for PCR amplification. The amplified products were then verified by nucleic acid gel electrophoresis and sequencing.

[0043] 2.2 Indirect immunofluorescence identification

[0044] HEK-293A cells were seeded into 6-well plates 18-24 h before infection. On day 2, the culture medium was aspirated, and each well was inoculated with recombinant adenovirus and control adenovirus. After incubation for 2 h, the virus solution was aspirated, and the cells were replaced with 2% cell maintenance medium. The cells were then cultured at 37°C in a 5% CO2 incubator for another 24 h. Cells were fixed with 4% paraformaldehyde at room temperature for 20 min, followed by 3 washes with PBS; incubated with 0.2% Triton X-100 at room temperature for 5 min, followed by 3 washes with PBS; blocked with 3% BSA at room temperature for 1 h, followed by 3 washes with PBS; the Cap protein antibody prepared in our laboratory was used as the primary antibody, incubated overnight at 4°C, followed by 3 washes with PBS; and Alexa Flour 488-labeled goat anti-mouse secondary antibody (Thermo, A11001) was used, incubated at 37°C for 1 h (protected from light), followed by 3 washes with PBS, and observed under a fluorescence microscope.

[0045] 2.3 Identification of proteins by Western blot

[0046] HEK-293A cells were seeded into 6-well plates 18-24 h before infection. On day 2, the culture medium was aspirated, and each well was inoculated with recombinant adenovirus and control adenovirus. After incubation for 2 h, the virus solution was aspirated, and the cells were replaced with 2% cell maintenance medium. The cells were then cultured at 37°C in a 5% CO2 incubator for another 24 h. After discarding the culture medium, total cell protein was extracted, separated by SDS-PAGE electrophoresis, and transferred to a membrane. Immunoassay was performed using anti-Cap protein primary antibody and HRP-labeled secondary antibody (Sangon Biotech, D110087).

[0047] 2.4 Determination of recombinant adenovirus titer

[0048] HEK-293A cells were seeded in 96-well cell culture plates for the determination of recombinant adenovirus titers. The specific procedures are as follows:

[0049] (1) Remove the virus from the -80℃ ultra-low temperature freezer and dilute it 10-fold continuously with cell maintenance medium containing 2% serum. -14 ;

[0050] (2) Add 100 μL of virus dilution to each well, with 9 replicates for each dilution. Replace the remaining wells with maintenance solution and use them as negative controls.

[0051] (3) Place the cell plate in a 37°C, 5% CO2 incubator for 3-4 days. Count the wells containing lesions and calculate the virus titer using the Reed-Muench method.

[0052] 3. Experimental Results

[0053] To verify whether the Cap gene was successfully inserted and stably expressed, adenovirus genomic DNA was extracted from the amplified viral fluid, and PCR amplification was performed using Cap gene-specific primers. Agarose gel electrophoresis showed a specific band at approximately 630 bp, consistent with the theoretical length of the Cap gene. The amplified product was sent for Sanger sequencing, and the sequencing results were completely identical to the target sequence, with no base mutations detected, confirming successful Cap gene insertion and correct sequence. Figure 2 A).

[0054] Furthermore, the expression of Cap protein was detected using indirect immunofluorescence. A significant green fluorescent signal was observed in the cytoplasm of the experimental group cells, while no fluorescence was observed in the control group cells, indicating that Cap protein could be successfully expressed in host cells. Figure 2 C).

[0055] Meanwhile, Western blot analysis was used to further verify the expression of the Cap protein. A specific band with a molecular weight of approximately 27 kDa was detected in the experimental group, consistent with the theoretical molecular weight of the PCV3 Cap protein, while this band was absent in the control group, further confirming that the Cap protein can be stably expressed in the adenovirus system. Figure 2 B).

[0056] Finally, the Spearman-Karber method was used to determine the infectious titer of the recombinant virus. The tissue infection units (IFU / mL) of the virus were calculated based on the number of positive wells and the dilution factor. The results showed that the Ad5-Cap titer of the recombinant adenovirus prepared in this invention could stably reach 10. 8 IFU / mL or higher, meeting the requirements for vaccine preparation and animal immunization experiments.

[0057] Example 2: Immunogenicity detection of Ad5-Cap in mice

[0058] The recombinant adenovirus described in Example 1, which was stored at low temperature, was inoculated into HEK293A cells that had grown into a monolayer at a 7.5-fold infection ratio. When the cytopathic effect reached 70-90%, the virus was harvested. The recombinant adenovirus vaccine could be obtained by repeating the freeze-thaw cycle once.

[0059] 1. Grouping of experimental animals

[0060] Six-week-old female Balb / C mice were randomly divided into three groups: PBS, Ad5-Control, and Ad5-Cap, and were injected with 1.0 × 10⁻⁶ mg / L of PBS, PBS, and Ad5-Control. 8The vaccine was administered via intranasal droplets at a dose of CFU / 50 μL. The first immunization was recorded as day 1, and booster immunizations were given on day 14 following the same dose and immunization method. Blood samples were collected weekly thereafter for long-term antibody titer monitoring, and flow cytometry was performed on day 28 to determine the immunogenicity of the vaccine. The animal immunization protocol and grouping are shown in Table 1.

[0061] Table 1 Animal experimental grouping and immunization strategy

[0062]

[0063] 2. Experimental Methods

[0064] 2.1 Flow cytometry

[0065] After euthanizing the mice according to the ethics committee-approved protocol, they were disinfected with 75% alcohol and transferred to a biosafety cabinet. Lungs and mediastinal lymph nodes were collected. Lung and mediastinal lymph node samples were prepared separately, and after cell counting, they were seeded into 24-well plates, incubated with the corresponding antibodies, and then analyzed using flow cytometry. The detailed steps of flow cytometry are as follows:

[0066] (1) Add the purified antigen to each well to a final concentration of 5 μg / mL and add complete culture medium, and incubate at 37°C for 5 hours;

[0067] (2) Add 1 μL of blocking agent to each well and continue incubation at 37°C for 6 hours;

[0068] (3) After incubation, rinse once with PBS, then add fresh PBS to resuspend the cells, and then add blocking solution for blocking. The blocking conditions and time are: 4°C in the dark for 15 min.

[0069] (4) Add 10 μL each of CD3-PE-Cy7 (Abcam, ab81992), CD4-PerCP (Abcam, ab210374), and CD8-APC-Cy7 (Abcam, ab233300) antibodies to the resuspended cells and incubate at 4°C in the dark for 30 min.

[0070] (5) Wash once with 1 mL PBS, centrifuge at 4℃, 2000 rpm for 5 min, discard the supernatant, and keep 50 μL of liquid;

[0071] (6) Add 250 μL of formaldehyde, incubate at 4°C in the dark for 20 min. Add 1 mL of membrane-penetrating buffer, centrifuge at 2500 rpm and 25°C for 5 min, and discard the supernatant;

[0072] (7) Add 1 mL of membrane penetration solution, let stand at room temperature for 5 min, centrifuge at 2500 rpm and 25℃ for 5 min, and retain 100 μL;

[0073] (8) Resuspend the cells and add 10 μL each of GrB-FITC (Thermo, 11593182), IFN-γ-APC (Thermo, 17731941), and TNF-α-PE (Elabscience, AN00567M). Incubate at 4°C in the dark for 30 min.

[0074] (9) Wash once with 1 mL PBS, centrifuge at 2500 rpm for 5 min, keep 50 μL, add 300 μL PBS to pass through the membrane, and then perform the detection.

[0075] 2.2 Detection of expression levels of mouse-specific immunoglobulins (IgG and IgA)

[0076] 100 μL of purified PCV3 Cap protein (1 μg / mL) was coated onto 96-well polystyrene ELISA plates and incubated overnight at 4°C. After coating, the plates were washed three times with PBS containing 0.05% Tween-20 (PBST), followed by blocking with 200 μL of PBS containing 5% bovine serum albumin (BSA) at room temperature for 1 hour to block non-specific binding. After blocking, the plates were washed again with PBST. 100 μL of diluted mouse serum or mouse bronchoalveolar lavage fluid was added to each well, and the plates were incubated at 37°C for 1 hour to bind PCV3-specific antibodies. Negative and positive controls were included in each experiment to ensure experimental validity. After incubation, the plates were washed five times with PBST. HRP-labeled goat anti-mouse IgG antibody or IgA antibody was added to each well (100 μL / well), and the plates were incubated at 37°C for 1 hour. After five washes, 100 μL of TMB substrate solution was added to each well, and the plates were incubated at room temperature in the dark for 15 min. The reaction was terminated by adding 100 μL of 12.5% ​​H2SO4, and the absorbance was measured at 450 nm using an ELISA reader.

[0077] 2.3 Detection of neutralizing antibodies in mouse serum

[0078] The collected mouse serum was inactivated by incubating in a 56°C water bath for 30 min, serially diluted with DMEM medium, and filtered through a 0.22 μM filter before storage. The serially diluted serum was then mixed with an equal volume of 100 TCID50 solution. 50Mix the PCV3 strain at / mL, set up a negative control group, and incubate at 37℃ for 1 hour. Wash the PK-15 cells in the 96-well plate with PBS three times to form a monolayer. Add the serum-virus mixture into the cells and incubate at 37℃ and 5% CO2 for 1 hour. Discard the virus solution and add DMEM cell culture maintenance medium with 2% FBS. Continue culturing for 72-96 hours. Fix with 4% paraformaldehyde at room temperature for 20 min, wash 3 times with PBS; incubate with 0.2% Triton X-100 at room temperature for 5 min, wash 3 times with PBS; block with 3% BSA at room temperature for 1 hour, wash 3 times with PBS; use the Cap protein antibody prepared in our laboratory as the primary antibody, incubate overnight at 4℃, wash 3 times with PBS; label with Alexa Flour 488 goat anti-mouse secondary antibody, incubate at 37℃ for 1 hour (protected from light), wash 3 times with PBS, and observe under a fluorescence microscope.

[0079] 2.4 Statistical Analysis

[0080] The collected experimental data were analyzed using GraphPad Prism 7.0. Independent samples t-test was used for comparisons between two groups, and F-test was used for comparisons among multiple groups. P < 0.05 was considered statistically significant.

[0081] 3. Experimental Results

[0082] Flow cytometry analysis revealed that, under specific antigen stimulation, compared with the control group, the lung CD4 counts of mice immunized with recombinant adenovirus expressing PCV3 Cap protein were significantly higher. + T and CD8 + IFN-γ secreted by T cells + TNF-α + and GrB + The level of CXCR5 was significantly increased, and the number of Tfh cells in the lungs of mice in the Ad5-Cap group was significantly increased. Compared with the PBS group and the Ad5-Control group, the CXCR5 level in the Ad5-Cap intranasal immunization group was significantly higher. + PD-1 + The number of Tfh cells increased significantly. Simultaneously, germinal center B cells in mouse pulmonary mediastinal lymph nodes could be promoted by recombinant adenovirus expressing PCV3 Cap protein and control adenovirus, and Ad5-Cap promoted B220. + CD95 + GL7 + The cell differentiation rate was higher in adenovirus compared to the control group. Figure 3-Figure 6 ).

[0083] To detect the humoral immune response in mice, the levels of specific IgG and IgA antibodies were measured using an indirect ELISA method. ELISA results showed that the expression levels of IgG in the serum and SIgA in the bronchoalveolar lavage fluid of mice immunized with Ad5-Cap intranasally were significantly higher than those in the PBS and Ad5-Control groups, indicating that the vaccine successfully activated humoral and mucosal immunity in mice. Figure 7 and Figure 8 ).

[0084] The activity of neutralizing antibodies in mouse serum was detected by a virus neutralization assay. Results showed that neutralizing antibodies began to appear in mice after immunization with the Ad5-Cap recombinant adenovirus vector vaccine, reaching their peak at week 5 post-immunization, and then slowly declining. No neutralizing antibodies were detected in the control group. Figure 9 ).

[0085] The description of the above embodiments is intended to facilitate understanding and implementation of the present invention by those skilled in the art. It will be apparent to those skilled in the art that various modifications and adjustments can be made to the above embodiments without departing from the principles and scope of the present invention, and that the general principles described herein can be applied to other implementation schemes without inventive effort. Therefore, the present invention is not limited to the specific embodiments described above. Any improvements and changes made by those skilled in the art based on the principles of the present invention should be covered within the protection scope of the present invention.

Claims

1. A recombinant adenovirus carrying the Cap gene of porcine circovirus type 3, characterized in that, The recombinant adenovirus was obtained by homologous recombination of a replication-defective adenovirus backbone plasmid and a recombinant adenovirus shuttle plasmid carrying the target gene; the replication-defective adenovirus backbone plasmid is pBHGlox ΔE1,3Cre; the target gene includes one or more copies of the PCV3Cap gene, the sequence of which is a codon-optimized sequence as shown in SEQ ID NO.1, and the N-terminus of the PCV3Cap gene is fused with a tPA signal peptide, the sequence of which is shown in SEQ ID NO.

2.

2. A method for preparing the recombinant adenovirus carrying the Cap gene of porcine circovirus type 3 as described in claim 1, characterized in that, Includes the following steps: (1) The target gene shown in SEQ ID NO.2 is ligated into a shuttle plasmid to obtain a recombinant shuttle plasmid; (2) The above recombinant shuttle plasmid and backbone plasmid pBHGlox ΔE1,3Cre were transfected into host cells using Lipofectamine 3000; (3) Cultivate the host cells described in step (2); (4) The recombinant adenovirus was obtained after plaque purification, screening and identification.

3. The method according to claim 2, characterized in that, The shuttle plasmid is pAd5.

4. The method according to claim 2, characterized in that, The host cell was HEK293A.

5. The use of the recombinant adenovirus carrying the Cap gene of porcine circovirus type 3 as described in claim 1 in the preparation of a vaccine to prevent porcine circovirus type 3 infection.

6. The application according to claim 5, characterized in that, The method for preparing the vaccine includes taking the recombinant adenovirus carrying the Cap gene of porcine circovirus type 3 as described in claim 1, which is stored at low temperature, and inoculating HEK293A cells that have grown into a monolayer at a 7.5 infection multiple. When the cytopathic effect reaches 70-90%, the virus is harvested, and the vaccine for preventing porcine circovirus type 3 infection can be obtained by repeated freeze-thaw cycles.

7. The application according to claim 5, characterized in that, The recombinant adenovirus carrying the Cap gene of porcine circovirus type 3 was prepared as an injection, nasal drop, spray, or inhaler.

8. The application according to claim 5, characterized in that, The recombinant adenovirus carrying the Cap gene of porcine circovirus type 3 was prepared as nasal drops.

9. A vaccine for preventing porcine circovirus type 3 infection, characterized in that, Includes the recombinant adenovirus carrying the Cap gene of porcine circovirus type 3 as described in claim 1, and an adjuvant.

10. The vaccine for preventing porcine circovirus type 3 infection according to claim 9, characterized in that, The adjuvant includes one or more of stabilizers, complexing agents, immune enhancers, and water.

Images