Recombinant escherichia coli, construction method thereof and application of recombinant escherichia coli in production of 3-dehydroshikimic acid

Abstract

The invention discloses recombinant escherichia coli, a construction method thereof and application of the recombinant escherichia coli in production of 3-dehydroshikimic acid, and belongs to the technical field of bioengineering. According to the recombinant escherichia coli, escherichia coli FMME-DHS03 is used as an original strain, pyruvate kinase gene pykA is knocked out, excessive 3-dehydroquinic acid synthase gene aroB, transketolase gene tktA and galactose permease gene galP are added, the finally obtained recombinant strain is fermented for 40 h, the yield of 3-dehydroshikimic acid reaches 130.9 g / L, and the yield of glucose reaches 0.55 g / g. The process for producing the 3-dehydroshikimic acid through fermentation is simple and easy to operate, free of additional antibiotics, short in period, high in yield, low in culture medium cost and suitable for industrial production.

Description

Technical Field

[0001] This invention relates to a recombinant Escherichia coli and its construction method, as well as its application in the production of 3-dehydroshikimic acid, belonging to the field of bioengineering technology. Background Technology

[0002] 3-Dehydroshikimic acid (DHS) possesses unique molecular properties, enabling it to be converted into various phenolic compounds. Phenolic compounds, rich in reactive hydroxyl groups, can inhibit free radical chain reactions by donating hydrogen atoms, thus exhibiting excellent antioxidant properties. Furthermore, 3-Dehydroshikimic acid is a key hydroaromatic intermediate in the biocatalytic conversion of glucose into aromatic bioproducts and various industrial chemicals. Due to its six-membered carbon ring structure containing two asymmetric carbon atoms, the chemical synthesis of 3-Dehydroshikimic acid is extremely challenging and costly. Given its status as a natural metabolite in the shikimic acid pathway, current research focuses heavily on producing 3-Dehydroshikimic acid through microbial modification.

[0003] Existing technology 1 ("Cell factory design and culture process optimization for dehydroshikimate biosynthesis in Escherichia coli") uses Escherichia coli AB2834 as the host, integrates and knocks out the tyrR gene, knocks out pykA, and uses plasmids to integrate aroB, aroD, ppsA, galP, aroG and aroF genes under the control of the promoter to generate strain Inha103. After fermentation for 120 hours, the 3-dehydroshikimic acid titer is 117 g / L, and the production yield is 0.39 g / g glucose. However, the scheme in literature 1 has the following defects: (1) The blocking of the competitive pathway disrupts the original metabolic network of the strain, making the cells unable to synthesize certain essential nutrients autonomously, thus forming a auxotrophic strain. This requires the addition of corresponding nutrients to the fermentation medium, increasing the raw material cost and process complexity. (2) The change in metabolic pathway reduces the growth and metabolic efficiency of the strain, prolongs the fermentation time required to reach the target yield, and leads to reduced equipment utilization and limited production efficiency. (3) The glucose conversion efficiency was only 0.4 g / g, which means that a large amount of carbon source was not effectively used for the synthesis of the target product, resulting in a waste of raw materials. The low conversion rate not only increased the production cost, but also hindered the economic viability and feasibility of the industrial production of 3-dehydroshikimic acid.

[0004] Prior art 2 (Chinese patent publication number CN117004545A) uses Escherichia coli WJ060 as the starting strain and enhances the genes aroF and aroB. optThe aroD gene was knocked out, and the pykF gene was removed. After 52 hours of fermentation, the DHS titer was 105.6 g / L, and the glucose molar conversion rate was 40.8%. However, this method also suffers from low yield, long production time, and increased production costs due to the need to add vitamins to the culture medium.

[0005] It is evident that in existing technologies for producing DHS from Escherichia coli, the low metabolic flux of the shikimic acid pathway in Escherichia coli and the unclear key rate-limiting target further restrict the improvement of DHS production performance, resulting in low yield, low production rate, long fermentation time, low production intensity, and high production cost of 3-dehydroshikimic acid produced by Escherichia coli. Summary of the Invention

[0006] In view of the above-mentioned deficiencies in the existing technology, this application provides a new DHS production strain and a DHS production method to improve DHS yield, production rate and production intensity.

[0007] This invention first provides a recombinant Escherichia coli that, compared with the original strain, has any of the following characteristics (1) to (4):

[0008] (1) Enhanced enzyme activity of galactose permease and / or expression level of its encoding gene;

[0009] (2) Enhanced enzyme activity encoded by 3-dehydroquinic acid synthase and / or expression level of its encoding gene;

[0010] (3) Reduced or absent enzyme activity encoded by pyruvate kinase and / or expression level of its encoding gene;

[0011] (4) Enhanced enzyme activity encoded by transketolase and / or expression level of its encoding gene.

[0012] In one embodiment, the starting strain includes Escherichia coli FMME-DHS03, which is disclosed in patent application publication number CN116426455A.

[0013] In one embodiment, the galactose permease, 3-dehydroquinic acid synthase, pyruvate kinase, and transketolase have the amino acid sequences shown in NCBI accession numbers NP_417418.1, NP_417848.1, NC_000913.3, and YP_026188.1, respectively.

[0014] In one embodiment, the nucleotide sequences of the genes encoding the galactose permease, 3-dehydroquinic acid synthase, pyruvate kinase, and transketolase are shown as Gene IDs: 947434, 947927, 946527, and 947420, respectively.

[0015] In one implementation, promoter P is used. j23119 The expression of the encoding genes of the galactose permease, 3-dehydroquinic acid synthase, and transketolase is driven to enhance the enzyme activity of the enzymes and / or the expression level of their encoding genes.

[0016] In one implementation, the promoter P j23119 The nucleotide sequence is shown in SEQ ID NO.1.

[0017] In one embodiment, pyruvate kinase is knocked out on the genome of the starting strain to reduce or eliminate the expression level of the corresponding protein or enzyme, and / or its encoding gene.

[0018] In one embodiment, the encoding genes for the galactose permease, 3-dehydroquinic acid synthase, and transketolase are integrated into the genome of the starting strain.

[0019] In one embodiment, the gene encoding the galactose permease, galP, is integrated into the ydjK site (GeneID: 946293).

[0020] In one embodiment, the 3-dehydroquinic acid synthase encoding gene aroB is integrated into the yeeL site (GeneID: 2847764).

[0021] The present invention also provides a method for producing 3-dehydroshikimic acid, wherein the recombinant Escherichia coli is fermented with glucose as a substrate.

[0022] In one embodiment, the concentration of glucose in the culture medium is 5–15 g / L.

[0023] In one implementation, the method includes the following steps:

[0024] (1) Seed culture: The recombinant bacteria are inoculated into a seed culture medium and cultured to obtain seed liquid;

[0025] (2) Fermentation: The seed liquid obtained in step (1) is transferred to the fermentation medium to produce 3-dehydroshikimic acid.

[0026] In one implementation, the method includes the following steps:

[0027] (1) Primary seed culture: The recombinant bacteria are inoculated into a seed culture medium and cultured to obtain a primary seed liquid;

[0028] (2) Secondary seed culture: The primary seed culture obtained in step (1) is transferred to the secondary seed culture medium and cultured to obtain the secondary seed culture;

[0029] (3) Fermentation: The secondary seed liquid obtained in step (2) is transferred to the fermentation medium to produce 3-dehydroshikimic acid.

[0030] In one embodiment, during the fermentation, after the fermentation begins and the glucose concentration in the fermentation medium is below 1 g / L, glucose is added until the glucose concentration in the fermentation system is not higher than 10 g / L; alternatively, glucose is added until the glucose concentration in the fermentation system is not higher than 5 g / L.

[0031] In one embodiment, the fermentation medium also contains vitamins; the vitamins include, but are not limited to, thiamine.

[0032] In one embodiment, the fermentation medium contains: 5-15 g / L glucose, 1-10 g / L yeast extract, 1-5 g / L citric acid monohydrate, 1-5 g / L dipotassium hydrogen phosphate, 1-10 g / L ammonium sulfate, 0.5-2 g / L magnesium sulfate heptahydrate, 0.5-2 g / L sodium chloride, 0.1-0.6 g / L tryptophan, 0.1-0.6 g / L tyrosine, 0.1-0.6 g / L phenylalanine, and 0.5-2 mL / L metal ion solution.

[0033] In one embodiment, the fermentation medium contains: 10 g / L glucose, 5 g / L yeast extract, 2 g / L citric acid monohydrate, 3 g / L dipotassium hydrogen phosphate, 5 g / L ammonium sulfate, 1 g / L magnesium sulfate heptahydrate, 1 g / L sodium chloride, 0.3 g / L tryptophan, 0.3 g / L tyrosine, 0.3 g / L phenylalanine, and 1 mL / L metal ion solution.

[0034] In one embodiment, the metal ionic liquid contains: FeCl2·6H2O 1-5 g / L, CoCl2·6H2O 0.1-0.5 g / L, CuCl2 0.05-0.5 g / L, ZnCl2·4H2O 0.1-0.5 g / L, NaMnO4 0.1-0.5 g / L, H3BO3 0.05-0.1 g / L, and MnCl2·4H2O 0.1-1 g / L.

[0035] In one embodiment, the metal ionic liquid contains: FeCl2·6H2O 2.4 g / L, CoCl2·6H2O 0.3 g / L, CuCl2 0.15 g / L, ZnCl2·4H2O 0.3 g / L, NaMnO4 0.3 g / L, H3BO3 0.075 g / L and MnCl2·4H2O 0.495 g / L.

[0036] In one embodiment, the dissolved oxygen level during fermentation is controlled to be no less than 10%; alternatively, it can be no less than 20%, or 20%–50%, or 20%–40%.

[0037] In one embodiment, the pH of the fermentation is 5 to 8, optionally 6.75 to 7.25.

[0038] In one embodiment, the amount of seed culture transferred to the fermentation medium is 1% to 10%.

[0039] In one embodiment, the fermentation temperature is 20–40°C, optionally 30–35°C.

[0040] In one embodiment, the OD of the seed solution 600 The range is 2 to 8, and can be 4 to 6.

[0041] The present invention also provides the use of the recombinant Escherichia coli, or the method thereof, in the preparation of 3-dehydroshikimic acid or products containing 3-dehydroshikimic acid.

[0042] Beneficial effects:

[0043] (1) The recombinant strains FMME-DHS03, FMME-DHS06 to FMME-DHS09 constructed in this invention produced 16.23, 17.68, 19.42, 20.65 and 22.03 g / L of 3-dehydroshikimic acid in the supernatant after 40 h of shake flask fermentation, respectively. Furthermore, strain FMME-DHS09 was used for scale-up fermentation in a tank, and the yield of 3-dehydroshikimic acid in the supernatant after 40 h of fermentation was 130.9 g / L, with a glucose yield of 0.55 g / g.

[0044] (2) The fermentation process for producing 3-dehydroshikimic acid of the present invention is simple and easy to operate, requires no additional antibiotics, has a fermentation cycle of 40 hours, a short cycle and high yield, and low culture medium cost, making it suitable for industrial production. Attached Figure Description

[0045] Figure 1 This invention provides a pathway for the production of 3-dehydroshikimic acid from Escherichia coli based on target modification.

[0046] Figure 2 The results of shake-flask fermentation of recombinant strains FMME-DHS03, FMME-DHS06 to FMME-DHS09 are shown.

[0047] Figure 3 The results of fed-batch fermentation of recombinant strain FMME-DHS09 in a 5L fermenter. Detailed Implementation

[0048] The present invention will now be described in further detail with reference to specific embodiments. The given embodiments are merely illustrative of the invention and not intended to limit its scope. The embodiments provided below can serve as a guide for further improvements by those skilled in the art and do not constitute a limitation of the invention in any way.

[0049] Unless otherwise specified, the experimental methods used in the following examples are conventional methods, performed according to the techniques or conditions described in the literature in this field or according to the product instructions. Unless otherwise specified, the materials and reagents used in the following examples are commercially available.

[0050] Materials and methods involved in the embodiments of the present invention:

[0051] (1) Culture medium:

[0052] Solid culture medium: peptone 10 g / L, yeast extract 5 g / L, sodium chloride 10 g / L, agar powder 20 g / L.

[0053] Primary seed culture medium: 10 g / L peptone, 5 g / L yeast extract, 10 g / L sodium chloride.

[0054] Secondary seed culture medium: peptone 10 g / L, yeast extract 5 g / L, sodium chloride 10 g / L.

[0055] Fermentation medium: glucose 10g / L, yeast powder 5g / L, citric acid monohydrate 2g / L, dipotassium hydrogen phosphate 3g / L, ammonium sulfate 5g / L, magnesium sulfate heptahydrate 1g / L, sodium chloride 1g / L, tryptophan 0.3g / L, tyrosine 0.3g / L, phenylalanine 0.3g / L, metal ion solution 1mL / L.

[0056] Metal ionic solution: FeCl2·6H2O 2.4g / L, CoCl2·6H2O 0.3g / L, CuCl2 0.15g / L, ZnCl2·4H2O 0.3g / L, NaMnO4 0.3g / L, H3BO3 0.075g / L, MnCl2·4H2O 0.495g / L, prepared by dissolving in 0.1M HCl.

[0057] (2) Glucose determination:

[0058] Centrifuge the fermentation broth at 12,000 rpm for 10 min and collect the supernatant. Dilute to an appropriate ratio and use an M-100 biosensor analyzer to detect the glucose concentration of the fermentation broth.

[0059] (3) Determination of 3-dehydroshikimic acid:

[0060] High-performance liquid chromatography (HPLC): A 1 g / L solution of 3-dehydroshikimic acid was prepared and diluted to 0.1, 0.3, 0.4, 0.5, and 0.6 g / L. The solution was detected using HPLC, and the peak times and peak areas corresponding to different concentrations of 3-dehydroshikimic acid were obtained. A standard curve was plotted with the concentration of the 3-dehydroshikimic acid solution as the x-axis and the peak area as the y-axis to obtain the linear regression equation. The regression coefficient of the linear regression equation should be above 0.990 to be valid. The instrument used was a Waters HPLC system, with an Aminex HPX-87H column (7.8 × 300 mm; Bio-Rad Laboratories, Inc., Hercules, CA, USA); the mobile phase was 5 mM dilute sulfuric acid; the flow rate was set to 0.6 mL / min; the detector was a UV detector with a detection wavelength of 210 nm; and the column temperature was 55 °C.

[0061] The calculation method for glucose yield is: 3-dehydroshikimic acid yield × lower tank volume / glucose consumption.

[0062] Fermentation broth pretreatment: Centrifuge the fermentation broth at 12000 rpm for 10 min and collect the supernatant. After dilution to an appropriate factor, pass the sample through a membrane and perform HPLC detection. Substitute the obtained peak area into the linear regression equation, and multiply the result by the dilution factor to obtain the concentration of 3-dehydroshikimic acid in the fermentation broth.

[0063] Plasmid loss method: The strain was inoculated into LB medium and IPTG was added for induction to eliminate the pTargetF targeting plasmid containing gRNA-N20. The strain was cultured in LB medium at 42℃ to eliminate the pCas9 plasmid.

[0064] The pCas plasmid used in the gene knockout in the following examples was purchased from addgene, catalog number 60847.

[0065] Example 1: Construction of expression vector

[0066] The expression vector pM01 used in this embodiment is plasmid pUC57, and the promoter of the expressed gene is P. j23119 (as shown in SEQ ID NO.1).

[0067] (1) Construction of expression vector pM01-galP

[0068] The galactose permease has the amino acid sequence shown in NCBI accession number NP_417418.1. Its encoding gene galP is derived from Escherichia coli MG1655, and the gene ID of galP is 947434.

[0069] Genomic DNA was extracted from *E. coli* FMME-DHS03. Based on the published genomic sequence, amplification primer pair galP-F / galP-R (Table 1) was designed. Using the extracted *E. coli* genomic DNA as a template, the galP gene was amplified by PCR. The galP obtained by PCR was recovered by agarose gel electrophoresis. The expression vector pM01 was double-digested with restriction endonucleases ApaI and SalI for 3 h, and the digestion products were recovered by agarose gel electrophoresis. The galP gene and the digested pM01 plasmid were ligated using ClonExpress II One Step Cloning Kit at 37℃ for 30 min. The ligation was then transformed into JM109 competent cells. Single colonies were picked and PCR was performed using TEST-pM01-F / TEST-pM01-R (Table 1) for verification. Positive transformants were selected for sequencing, and the alignment was correct, confirming the successful construction of the expression vector. The plasmid was named pM01-galP.

[0070] (2) Construction of expression vector pM01-aroB

[0071] 3-Dehydroquinic acid synthase has the amino acid sequence shown in NCBI accession number NP_417848.1. Its encoding gene aroB is derived from Escherichia coli MG1655, and the gene ID of gene aroB is 947927.

[0072] The specific method is the same as step (1) above. The difference is that the 3-dehydroquinic acid synthase gene aroB is amplified with primers aroB-F / aroB-R (Table 1), ligated with the enzyme-digested vector pM01, and transformed into JM109 competent cells. The primers TEST-pM01-F / TEST-pM01-R are used for verification. The alignment is correct, which proves that the expression vector has been successfully constructed. The plasmid is named pM01-aroB.

[0073] (3) Construction of expression vector pM01-tktA

[0074] The transketolase has the amino acid sequence shown in NCBI accession number YP_026188.1. Its encoding gene tktA is derived from Escherichia coli MG1655, and the gene ID of gene tktA is 947420.

[0075] The specific method is the same as step (1) above. The difference is that the transketolase gene tktA is amplified with primers tktA-F / tktA-R (Table 1), and after being ligated with the enzyme-digested vector pM01, it is transformed into JM109 competent cells. The primers TEST-pM01-F / TEST-pM01-R are used for verification. The alignment is correct, which proves that the expression vector is successfully constructed. The plasmid is named pM01-tktA.

[0076] Table 1: Relevant Primer Sequences

[0077] Primer name Primer sequences (5′-3′) galP-F GGGCCCATGCCTGACGCTAAAAAAC galP-R GTCGACTTAATCGTGAGCGCCTATTTC TEST-pM01-F GCCACCTGACGTCTAAG TEST-pM01-R CTGTATCAGGCTGAAA aroB-F GGGCCCATGTCCAACAATGGCTCG aroB-R GGTCGACTTATTTCTTCAGTTC tktA-F GGGCCCATGGAGAGGATTGTCG tktA-R GTCGACTTACGCTGATTGACAATCGGC

[0078] Example 2: Construction of recombinant strain FMME-DHS06

[0079] Using FMME-DHS03 (disclosed in patent application CN116426455A) as the starting strain, the galactose permease encoding gene galP was overexpressed to construct the recombinant strain FMME-DHS06. The gene ID of galP is 947434.

[0080] The specific method for constructing the strain is as follows:

[0081] Using the *E. coli* MG1655 genome as a template, the upstream and downstream homologous arms of ydjK were amplified using primers ydjK-up-F / ydjK-up-R and ydjK-down-F / ydjK-down-R (Table 2), and then recovered via gel electrophoresis. Using primers KZ-galP-F / KZ-galP-R, the pM01-galP plasmid constructed in Example 1 was used as a template to amplify P... j23119 -galP expression cassette. Using primers ydjK-up-F / ydjK-down-R, overlap PCR was performed to express the upstream and downstream homologous arms of ydjK and P. j23119 -galP expression frames were fused to obtain ydjK-P j23119 -galP integration box.

[0082] Using the commercial plasmid pTargetF as a template, and primers N20-ydjK-F / N20-ydjK-R (Table 2), the N20-ydjK plasmid targeting the ydjK gene was constructed by reverse PCR.

[0083] ydjK-P j23119 The -galP integration box and N20-ydjK plasmid were introduced into K12RH competent cells containing pCas plasmid via electroporation. The N20-ydjK plasmid, pTargetF targeting plasmid, and pCas plasmid were lost, resulting in the FMME-DHS06 strain.

[0084] Table 2: Relevant Primer Sequences

[0085] Example 3: Construction of recombinant strain FMME-DHS07

[0086] Using FMME-DHS06, constructed in Example 2, as the starting strain, the transketolase encoding gene tktA was overexpressed to construct the recombinant strain FMME-DHS07. The Gene ID of gene tktA is 947420.

[0087] The specific method for constructing the strain is as follows:

[0088] Using the *E. coli* MG1655 genome as a template, the upstream and downstream homologous arms of *yghX* were amplified using primers *yghX-up-F / yghX-up-R* and *yghX-down-F / yghX-down-R* (Table 3), and then recovered via gel extraction. Using primers *KZ-tktA-F / KZ-tktA-R*, the pM01-tktA plasmid constructed in Example 1 was used as a template to amplify *P*. j23119 -tktA expression cassette. Using primers yghX-up-F / yghX-down-R, overlap PCR was performed to express the upstream and downstream homologous arms of yghX and P. j23119 -tktA expression box fusion yields yghX-P j23119 -tktA Integration Box.

[0089] Using the commercial plasmid pTargetF as a template, and primers N20-yghX-F / N20-yghX-R (Table 3), the N20-yghX plasmid targeting the yghX gene was constructed by reverse PCR.

[0090] yghX-P j23119 The -tktA integration box and N20-yghX plasmid were introduced into K12RH competent cells containing pCas plasmid via electroporation. The N20-yghX plasmid, pTargetF targeting plasmid, and pCas plasmid were lost, resulting in the FMME-DHS07 strain.

[0091] Table 3: Relevant Primer Sequences

[0092] Example 4: Construction of recombinant Escherichia coli FMME-DHS08 with pykA knocked out

[0093] Using the *E. coli* FMME-DHS07 strain constructed in Example 3 as the starting strain, the pyruvate kinase encoding gene pykA was knocked out to construct the recombinant strain FMME-DHS08. The Gene ID of the pykA gene is 946527.

[0094] The specific method for constructing the strain is as follows:

[0095] Using the E. coli MG1655 genome as a template, primers pykA-up-F / pykA-up-R and pykA-down-F / pykA-down-R were used to amplify 500 bp upstream and downstream of pykA, followed by gel recovery. The upstream and downstream homologous arms of pykA were then fused using overlap PCR with primers pykA-up-F / pykA-down-R to obtain the pykA knockout cassette.

[0096] Using the commercial plasmid pTargetF as a template, and primers N20-pykA-F / N20-pykA-R (Table 4), the N20-pykA plasmid targeting the pykA gene was constructed by reverse PCR.

[0097] The pykA knockout box and N20-pykA plasmid were introduced into E. coli SA01 competent cells containing pCas plasmid via electroporation (electroporation voltage and time were 2100V and 5ms, respectively). The pTargetF target plasmid and pCas plasmid were lost, resulting in the recombinant strain FMME-DHS08 with pykA knockout.

[0098] Table 4: Relevant Primer Sequences

[0099]

[0100]

[0101] Example 5: Construction of recombinant strain FMME-DHS09

[0102] Using FMME-DHS08, constructed in Example 4, as the starting strain, the recombinant strain FMME-DHS09 was constructed by overexpressing the 3-dehydroquinic acid synthase encoding gene aroB. The Gene ID of gene aroB is 947927.

[0103] The specific method for constructing the strain is as follows:

[0104] Using the *E. coli* MG1655 genome as a template, the upstream and downstream homologous arms of *yeeL* were amplified using primers *yeeL-up-F / yeeL-up-R* and *yeeL-down-F / yeeL-down-R* (Table 5), and then recovered via gel extraction. Using primers *KZ-aroB-F / KZ-aroB-R*, the pM01-aroB plasmid constructed in Example 1 was used as a template to amplify *P*. j23119 -aroB expression cassette. Using primers yeeL-up-F / yeeL-down-R, overlap PCR was performed to express the upstream and downstream homologous arms of yeeL and P... j23119 -aroB expression frame fusion yields yeeL-P j23119 -aroB integration box.

[0105] Using the commercial plasmid pTargetF as a template, and primers N20-yeeL-F / N20-yeeL-R (Table 5), an N20-yeeL plasmid targeting the yeeL gene was constructed by reverse PCR.

[0106] yeeL-P j23119 The -aroB integration box and N20-yeeL plasmid were introduced into K12RH competent cells containing pCas plasmid via electroporation. The N20-yeeL plasmid, pTargetF targeting plasmid, and pCas plasmid were lost, resulting in the FMME-DHS09 strain.

[0107] Table 5: Relevant Primer Sequences

[0108]

[0109] Example 6: Production of 3-dehydroshikimic acid by shake-flask fermentation of recombinant strains

[0110] The recombinant strains FMME-DHS03, FMME-DHS06 (constructed in Example 2), FMME-DHS07 (constructed in Example 3), FMME-DHS08 (constructed in Example 4), and FMME-DHS09 (constructed in Example 5) were subjected to shake-flask fermentation to detect the yield of 3-dehydroshikimic acid. The specific steps are as follows:

[0111] (1) Seed activation and culture

[0112] Primary seed culture: Select a single colony and inoculate it into primary seed culture medium, and incubate at 37℃ in a shaker for 12-14 hours;

[0113] Secondary seed culture: Take 1 mL of primary seed culture and inoculate it into a 500 mL Erlenmeyer flask containing 50 mL of secondary seed culture medium. Incubate at 37°C for approximately 6-8 hours using a reciprocating shaker at 220 rpm. OD 600 The concentration is controlled between 4 and 6 to obtain seed solution.

[0114] (2) Fermentation culture

[0115] Recombinant strains FMME-DHS03, FMME-DHS06, FMME-DHS07, FMME-DHS08, and FMME-DHS09 were fermented in 500 mL shake flasks under the following conditions:

[0116] Add 8 mg / L of phenol red (pH indicator) to the fermentation medium to adjust the pH to 7.0. Sterilize at 115°C for 15 min. After cooling to 33°C, prepare for inoculation.

[0117] Inoculation amount: 5% of the seed liquid prepared in step (1) was inoculated into a 500 mL shake flask; the fermentation temperature was 33℃ and the horizontal shaker speed was 220 rpm;

[0118] Fermentation pH: Adjust the pH with ammonia water every 4 hours. The amount of ammonia water added should be finely adjusted according to the color of the fermentation medium shown by the pH indicator, and the pH should be maintained at 7.

[0119] During fermentation, the residual sugar concentration in the fermentation broth was measured every 4 hours. Once the glucose concentration in the fermentation medium was below 1 g / L, glucose was added until the final concentration was 10 g / L. The fermentation cycle was 40 hours.

[0120] The final 3-dehydroshikimic acid yields in the supernatant of the fermentation broths of recombinant strains FMME-DHS03, FMME-DHS06, FMME-DHS07, FMME-DHS08, and FMME-DHS09, determined by high-performance liquid chromatography (HPLC), were 16.23 g / L, 17.68 g / L, 19.42 g / L, 20.65 g / L, and 22.03 g / L, respectively. Figure 2 ).

[0121] Example 9: Fed-batch fermentation of recombinant strain FMME-DHS09 in a fermenter

[0122] The recombinant strain FMME-DHS09 was fermented in a 5L fermenter under the following conditions:

[0123] (1) Seed activation and culture

[0124] Primary seed culture: Select a single colony and inoculate it into primary seed culture medium, and incubate at 37℃ in a shaker for 12-14 hours;

[0125] Secondary seed culture: Take 1 mL of primary seed culture and inoculate it into a 500 mL Erlenmeyer flask containing 50 mL of secondary seed culture medium. Incubate at 37°C for approximately 6-8 hours using a reciprocating shaker at 220 rpm. OD 600 The concentration is controlled between 4 and 6 to obtain seed solution.

[0126] (2) Fermentation culture

[0127] Sterilize the fermentation medium at 115℃ for 15 minutes. After sterilization, install it on the control panel, turn on the automatic temperature control, and wait for the temperature to cool to 33℃. Then, add ammonia water to adjust the pH to 7.0 and prepare for inoculation.

[0128] Inoculation amount: 5% of the prepared seed liquid was inoculated into a 5L fermenter with a liquid volume of 1.95L;

[0129] Fermentation temperature: During the fermentation process, the automatic temperature control is activated to maintain the fermentation temperature at 33℃;

[0130] Fermentation pH: Adjust the pH to between 6.75 and 7.25 using ammonia water;

[0131] Dissolved oxygen conditions: Initial conditions: aeration rate 2 vvm, stirring speed 300 rpm; During fermentation, the dissolved oxygen was maintained above 20% by adjusting the aeration rate and stirring speed.

[0132] During fermentation, once the initial glucose concentration in the fermentation medium is below 1 g / L, an 800 g / L glucose solution is added in a pulsed manner to control the glucose concentration below 5 g / L. The fermentation cycle is 40 hours.

[0133] The highest yield of 3-dehydroshikimic acid in the fermentation broth supernatant was determined by high performance liquid chromatography (HPLC) at 40 h, reaching 130.9 g / L. Figure 3 The glucose yield reached 0.55 g / g.

[0134] Example 10:

[0135] The specific implementation method is the same as in Example 3, except that the transketolase gene tktA is overexpressed only in strain FMME-DHS03 to obtain recombinant strain FMME-DHS03-1. The recombinant strain is fermented according to the method in Example 6. The final 3-dehydroshikimic acid yield in the supernatant of the fermentation broth of recombinant strain FMME-DHS03-1 is 18.17 g / L, as determined by high performance liquid chromatography.

[0136] Example 11:

[0137] The specific implementation method is the same as in Example 4, except that the pyruvate kinase gene pykA is knocked out only in strain FMME-DHS03 to obtain recombinant strain FMME-DHS03-2. The recombinant strain is fermented according to the method in Example 6. The final 3-dehydroshikimic acid yield in the supernatant of the fermentation broth of recombinant strain FMME-DHS03-2 is 17.32 g / L, as determined by high performance liquid chromatography.

[0138] Example 12:

[0139] The specific implementation method is the same as in Example 5, except that the 3-dehydroquinic acid synthase gene aroB is overexpressed only in strain FMME-DHS03 to obtain recombinant strain FMME-DHS03-3. The recombinant strain is fermented according to the method in Example 6. The final 3-dehydroshikimic acid yield in the supernatant of the fermentation broth of recombinant strain FMME-DHS03-3 is 18.49 g / L, as determined by high performance liquid chromatography.

[0140] Although the present invention has been disclosed above with reference to preferred embodiments, it is not intended to limit the present invention. Anyone skilled in the art can make various modifications and alterations without departing from the spirit and scope of the present invention. Therefore, the scope of protection of the present invention should be determined by the claims.

Claims

1. Recombinant Escherichia coli, characterized in that, Compared with the starting strain, it has any of the characteristics shown in (1) to (4) below: (1) Enhanced enzyme activity of galactose permease and / or expression level of its encoding gene; (2) Enhanced enzyme activity encoded by 3-dehydroquinic acid synthase and / or expression level of its encoding gene; (3) Reduced or absent enzyme activity encoded by pyruvate kinase and / or expression level of its encoding gene; (4) Enhanced enzyme activity encoded by transketolase and / or expression level of its encoding gene; The starting strain was Escherichia coli FMME-DHS03.

2. The recombinant Escherichia coli according to claim 1, characterized in that, The nucleotide sequences of the genes encoding the galactose permease, 3-dehydroquinic acid synthase, pyruvate kinase, and transketolase are shown in Gene IDs: 947434, 947927, 946527, and 947420, respectively.

3. The recombinant Escherichia coli according to claim 1 or 2, characterized in that, With promoter P j23119 The expression of the encoding genes for the galactose permease, 3-dehydroquinic acid synthase, and transketolase is driven.

4. The recombinant Escherichia coli according to claim 3, characterized in that, The promoter P j23119 It has the nucleotide sequence shown in SEQ ID NO.

1.

5. The recombinant Escherichia coli according to any one of claims 1 to 4, characterized in that, The gene encoding the galactose permease, galP, is integrated into the ydjK site; the gene encoding the 3-dehydroquinic acid synthase, aroB, is integrated into the yeeL site.

6. A method for producing 3-dehydroshikimic acid, characterized in that, Using glucose as a substrate, fermentation is carried out using the recombinant Escherichia coli according to any one of claims 1 to 5.

7. The method according to claim 6, characterized in that, The glucose concentration is 5–15 g / L.

8. The method according to claim 6 or 7, characterized in that, Feeding is carried out during the fermentation process; the feeding is when glucose is lower than 1g / L, glucose is added until the glucose concentration in the fermentation system is ≤5g / L.

9. The method according to claim 5, characterized in that, Ferment at 30℃~35℃.

10. The use of the recombinant Escherichia coli according to any one of claims 1 to 5, or the method according to any one of claims 6 to 9, in the preparation of 3-dehydroshikimic acid.

Images