Solid fermentation method of piriformospora indica solid fungicide
By using a solid-state fermentation process with crushed rapeseed straw as a substrate, the problems of low fermentation yield and unstable storage activity of *Pyrhodotorula praecox* have been solved, enabling efficient preparation and stable storage of *Pyrhodotorula praecox* inoculant, promoting tobacco growth and increasing tobacco leaf yield, and suitable for field application in tobacco.
Patent Information
- Application Number
- CN202511084162.2
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-08-04
- Publication Date
- 2025-11-07
AI Technical Summary
Existing liquid fermentation technologies suffer from low fermentation yield, high cost, severe loss of activity during storage, and inconvenience in field application. There is a lack of research and optimization on solid-state fermentation of *Pyrrosia lingua* suitable for tobacco cultivation systems.
Using crushed rapeseed straw as the fermentation substrate, combined with an optimized nutrient formula and a one-step solid fermentation process, a solid inoculum agent of *Pyrrosia lingua* was prepared, which is suitable for floating seedling raising and field transplanting of tobacco.
The efficient preparation of Indian pyriformis inoculant has been achieved, which promotes tobacco seedling growth and increases tobacco leaf yield. The inoculant maintains high activity stability after one year of storage in a cool and ventilated environment. It is easy to operate and suitable for field application in tobacco.
Smart Images

Figure CN120905035A_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The present application relates to a solid fermentation method of Piriformospora indica solid inoculum, and belongs to the technical field of Piriformospora indica. BACKGROUND
[0002] Tobacco is an important economic crop. Utilizing beneficial microorganisms to promote tobacco growth and increase tobacco yield has become a key strategy for developing green tobacco agriculture. Among them, Piriformospora indica, as a root symbiotic fungus with great application potential, has attracted much attention in the field of sustainable agriculture and ecological restoration due to its significant plant growth-promoting effects, enhanced host stress resistance (such as drought, salt stress, and pathogen infection), and induced systemic resistance.
[0003] Compared with arbuscular mycorrhizal fungi (AMF), Piriformospora indica has a wider host range and can be cultured in vitro. Compared with rhizobia that mainly colonize nodules, it also has a wider host range. Compared with Trichoderma fungi that mainly colonize rhizosphere, Piriformospora indica can colonize intracellularly in plant roots, forming a stable mutualistic symbiotic relationship and showing stronger growth-promoting effects. Although Piriformospora indica has shown great application potential in the laboratory and some crops, it still faces major challenges in large-scale field application, especially in tobacco production. There is currently no mature field application example, which is mainly limited by insufficient fermentation yield and lack of supporting application techniques in the field.
[0004] Currently, Piriformospora indica mainly relies on liquid fermentation technology for fermentation, but this method has significant bottlenecks. Due to the limitation of fermentation tank volume, the fermentation yield is low and the price is relatively high, making it difficult to meet the needs of field application. The activity of fermentation products (mycelium or spores) is severely lost during long-term storage. Liquid formulations are also very inconvenient for transportation, storage, and field application. In addition, there are few reports on solid fermentation of Piriformospora indica, and there is a lack of systematic optimization for tobacco field application (including inoculum formulation, application method, and effect evaluation).
[0005] The existing document (CN 114107070A) discloses a Pyricularia indica agent and a preparation method thereof, which uses sorghum grains as a solid fermentation substrate, and is prepared into a powder through steps such as seed liquid culture, solid fermentation, drying by airing, and adding additives (such as xanthan gum and NNO). Although this method solves the problem of long-term preservation of spores, it still has obvious defects: 1. The fermentation process is complicated, and it needs to be divided into liquid and solid fermentation steps, and after solid fermentation, it must be dried by airing and crushed, which is high in energy consumption and long in cycle; 2. The agent formula is designed for wheat soil-borne diseases, and its applicability in the tobacco cultivation system has not been verified, and its application methods (such as seed soaking and root irrigation) do not match the tobacco floating seedling or well cellar transplanting mode; 3. The cost of the substrate with sorghum grains as the core is high, and the resource utilization of agricultural waste has not been explored.
[0006] Based on the above, it is necessary to break through the limitations of the existing liquid fermentation technology, develop a fermentation process that can realize efficient and high-yield of Pyricularia indica, and develop a preparation that is stable in activity, easy to store for a long time, and convenient for storage and application in the field of tobacco, which has become a key link and urgent need to promote this beneficial fungus from the laboratory to large-scale application in the green production of tobacco. SUMMARY
[0007] Based on the above, the present application provides a solid fermentation method of Pyricularia indica solid agent, which uses crushed rape straw as a fermentation substrate, combines an optimized nutrient formula and a one-step solid fermentation process, and can realize efficient preparation of Pyricularia indica agent and is suitable for application in tobacco floating seedling and field transplanting.
[0008] The technical scheme of the present application is: a solid fermentation method of Pyricularia indica solid agent, comprising:
[0009] S1 activating Pyricularia indica spores;
[0010] S2 inoculating Pyricularia indica spores into a solid fermentation medium, fully mixing, adding sterile water to adjust the moisture content, and performing solid fermentation in a cool and ventilated environment;
[0011] The solid fermentation medium is composed of a solid fermentation substrate, a carbon source, a nitrogen source and inorganic salts, the solid fermentation substrate is crushed rape straw, the carbon source includes glucose, sucrose, corn starch and glycerol, the nitrogen source includes peptone, urea, ammonium sulfate and potassium nitrate, the inorganic salts include potassium dihydrogen phosphate, magnesium sulfate, sodium chloride and calcium sulfate, and the moisture content of the solid fermentation medium is 40% to 70%, and the initial pH value is 4 to 7.
[0012] Preferably, the activated Indian pear-shaped spore seed is inoculated into the solid fermentation medium for fermentation, wherein the rape straw is used in an amount of 30 kg, the carbon source is added in an amount of 2% to 6%, the nitrogen source is added in an amount of 0.5% to 1.5%, and the inorganic salt is added in an amount of 0.05% to 0.15%.
[0013] Preferably, in the solid fermentation medium, the rape straw is used in an amount of 30 kg, the carbon source is corn starch and is added in an amount of 4%, the nitrogen source is peptone and is added in an amount of 0.5%, the inorganic salt is magnesium sulfate and is added in an amount of 0.15%, and the water content of the solid fermentation medium is 60%, and the initial pH value is 6.
[0014] Preferably, the conditions of the cool and ventilated environment are as follows: the temperature is 15 to 25 DEG C, the relative humidity is 65% plus or minus 5%, and the fermentation time is 30 days.
[0015] The present application has the following beneficial effects: the present application realizes the low-cost and large-scale production of high-activity Indian pear-shaped spore agent by using rape straw as the substrate, combining with the optimized nutritional formula (corn starch + peptone + magnesium sulfate) and the simplified process, and verifies the growth promotion effect and storage resistance of the Indian pear-shaped spore agent for tobacco application scenarios, and breaks through the limitations of the prior art in process complexity, substrate universality and crop adaptability.
[0016] Specifically, the application significantly improves the biomass proliferation efficiency of the Indian pear-shaped spore (ΔCt value of 6.32) by optimizing the solid fermentation substrate mainly composed of crushed rape straw and the nutritional formula, and synergistically regulating the appropriate water content, pH and temperature and humidity conditions. The method breaks through the dependence of liquid fermentation on the volume of fermentation tank, and can realize the low-cost large-scale production of the bacterial agent. Compared with the method in the existing literature which uses sorghum particles as a solid fermentation substrate, needs to boil with water and add sucrose, the process is complex and the cost is high. The application creatively selects crushed rape straw as a solid fermentation substrate, which is an agricultural waste, low cost and easy to obtain. Through qPCR quantitative analysis, it is confirmed that the support effect of rape straw on the growth of Indian pear-shaped spore is significantly better than that of other substrates such as wheat bran and soybean meal, solving the problem of low bacterial growth efficiency caused by poor substrate air permeability in the existing literature. Compared with the existing literature which needs to dry for 2-3 days and crush after solid fermentation, the process is complicated and the energy consumption is high. The application adopts one-step solid fermentation, directly inoculates the activated strain into the optimized medium, and ferments in a cool and ventilated environment for 30 days, saving the drying step, and the process is simpler and energy-saving. Compared with the existing literature which needs to add xanthan gum, NNO and other aids to maintain activity, the spore germination rate is 98% after 2 years of storage, but the limitation of not verifying in tobacco environment, the solid bacterial agent of the application does not add any aid, after 1 year of storage in a cool and ventilated environment, the colonization rate of tobacco seedlings is still 67.89%, and the PiTEF gene abundance only decreases by 26.47%. In addition, the bacterial agent is directly mixed into the tobacco seedling substrate or applied in the field, which is simple to operate and matches the tobacco cultivation system. It is proved through seedling and field tests that the bacterial agent can improve the plant height (28.50%), leaf length (18.79%), biomass (45.30%), and yield per mu (6.74%) of tobacco seedlings. BRIEF DESCRIPTION OF DRAWINGS
[0017] Figure 1 . The abundance change of Indian pear-shaped spore PiTEF gene in different fermentation substrates after 30 days, ΔCt value represents the difference of PiTEF gene qPCR amplification threshold value per weight of fermentation substrate between the 30th day and the 1st day after inoculation;
[0018] Figure 2 . The effect of different carbon sources on the growth of Indian pear-shaped spore, (A) colony diameter; (B) biomass (dry weight);
[0019] Figure 3 . The effect of different nitrogen sources on the growth of Indian pear-shaped spore, (A) colony diameter; (B) biomass (dry weight);
[0020] Figure 4 . The effect of different inorganic salts on the growth of Indian pear-shaped spore, (A) colony diameter; (B) biomass (dry weight);
[0021] Figure 5The effect of fermentation agents on tobacco seedling growth;
[0022] Figure 6 The field growth-promoting effect of solid fermentation inoculants. Detailed Implementation
[0023] To make the above-mentioned objects, features, and advantages of the present invention more apparent and understandable, specific embodiments of the present invention will be described in detail below with reference to the accompanying drawings. Many specific details are set forth in the following description to provide a thorough understanding of the present invention. However, the present invention can be practiced in many other ways different from those described herein, and those skilled in the art can make similar modifications without departing from the spirit of the present invention. Therefore, the present invention is not limited to the specific embodiments disclosed below.
[0024] Detection method:
[0025] 1. qPCR quantitative analysis of fermentation efficiency:
[0026] The samples were freeze-dried, and 0.25g of the sample was weighed for DNA extraction using a soil genomic DNA extraction kit (cat#: DP336, Tiangen Biotech (Beijing) Co., Ltd.). Quantitative real-time PCR was performed using a TB... Premix Ex Taq TM II (Tli RNaseH Plus), cat#: RR820A, Baori Biotechnology (Beijing) Co., Ltd., in AppliedBiosystems ViiA TM 7. The housekeeping gene PiTEF of *Pyrhodotorula praecox* was quantitatively detected using a real-time quantitative PCR instrument. The reaction system and procedure were set according to the kit instructions. The amplification cycle threshold (Ct value) of the PiTEF gene was used as an indicator of its relative abundance; the lower the Ct value, the higher the copy number of the PiTEF gene in the sample, indirectly reflecting the biomass of *Pyrhodotorula praecox*. The qPCR primers for the PiTEF gene are shown in Table 1.
[0027] 2. Colonization efficiency detection of *Pyriformis indicus*
[0028] Fresh root segments were collected and stained with 0.05% (w / v) trypan blue solution. The morphology of the stained chlamydospores of *Pyrophyllus indusia* in the root tissue was observed under an optical microscope, and the root segment colonization rate was calculated as (number of root segments containing chlamydospores / total number of observed root segments × 100%).
[0029] Tobacco seedling roots were collected, washed with deionized water, and then dried. Total DNA was extracted from the roots using a Plant Genomic DNA Extraction Kit (cat#: DP305, Tiangen Biotech (Beijing) Co., Ltd.). TB [likely a typo, should be "TB"]. Premix Ex Taq TM II kit (same as above), on ViiA TM 7 The abundance of PiTEF gene of P. indica and NtACTIN gene of tobacco were synchronously detected on real-time quantitative PCR instrument. The primer sequences are shown in Table 1. The relative abundance of PiTEF gene to NtACTIN gene in root samples was calculated by 2 -ΔΔCt method, and the value was used as a quantitative index of the colonization efficiency of P. indica in tobacco roots.
[0030] Table 1. qPCR primers used in the experiment
[0031] Gene Forward primer Reverse primer PiTEF PiTEF-f: GGCCACCGTGACTTTATCAAGAAC PiTEF-r: TTCCTTGACGATTTCGTTGAAGCG NtActin NtActin-f: TCACAGAAGCTCCTCCTAATCCA NtActin-r: GAGGGAAAGAACAGCCTGAATG
[0032] The nucleotide sequences of the above primers are shown in SEQ ID NO. 1-4, respectively.
[0033] Example 1: Screening of solid fermentation medium formula
[0034] 1. Screening of solid fermentation substrate
[0035] Four kinds of easily accessible agricultural organic solid waste, i.e. rape straw, wheat bran, soybean meal and tobacco straw, were selected and crushed to pass through a 10-mesh sieve (particle size ≤2 mm). Each 10.0 kg of crushed sample was used as a fermentation substrate, inoculated with 500 mL of P. indica suspension (OD 600 = 1) cultured in potato dextrose broth (PDB) by shaking, and mixed thoroughly. Then 5.5 L of sterile water was added to adjust the water content to 60% (w / w). The inoculated substrate was placed in a cool and ventilated environment (25±2℃; relative humidity 65%±5%) for solid fermentation, and the center temperature of the substrate was controlled at ≤35℃. The sample was taken on the 30th day of fermentation for subsequent quantitative analysis based on qPCR.
[0036] The results are shown in Table 2. Figure 1 As shown in Table 2, among the fermentation experiments with different substrates (wheat bran, soybean meal, tobacco straw, rape straw), only in the rape straw substrate, the amplification threshold of P. indica PiTEF gene was detected to decrease on the 30th day after inoculation. This result indicates that rape straw can be used as an effective fermentation substrate to support the growth and reproduction of P. indica.
[0037] 2. Screening of optimal fermentation carbon source
[0038] Four solid media (Formulas 1-4) and four liquid media (Formulas 5-8) containing different carbon sources were prepared based on SDA medium, in which the carbon source component was replaced by glucose, sucrose, corn starch or glycerol, respectively (Table 2). The central part of each plate of solid media (Formulas 1-4) was inoculated with a piece of P. indica cake (5 mm in diameter), and the colony diameter (mm) was measured on the 3rd, 6th and 9th day after inoculation, respectively. Meanwhile, the same pieces of P. indica cake were inoculated into liquid media (Formulas 5-8), and the mycelium was collected by filtration after 9 days of continuous culture at 28°C and 150 rpm. The mycelium was dried at 60°C to constant weight and then weighed. The effects of different carbon sources on the growth of P. indica were evaluated by comparing the colony diameter and biomass. The significance of data difference was tested by one-way ANOVA.
[0039] Table 2. Formulas of media containing different carbon sources
[0040]
[0041] The results, as shown in Figure 2 , indicated that corn starch was the best carbon source for promoting the growth of P. indica. In solid media, the colony diameter was the largest ( Figure 2 A) when corn starch was used as the carbon source. In liquid media, the mycelial biomass was also the highest ( Figure 2 B). Therefore, corn starch was the best choice among the tested carbon sources.
[0042] 3. Screening of optimal fermentation nitrogen source
[0043] Four solid media (Formulas 1-4) and four liquid media (Formulas 5-8) containing different nitrogen sources were prepared based on SDA medium, in which the nitrogen source component was replaced by urea, ammonium sulfate or potassium nitrate, respectively (Table 3). The inoculation method, culture conditions and determination of growth indicators (colony diameter and mycelial dry weight) were the same as before (screening of optimal fermentation carbon source). The effects of different nitrogen sources on the growth of P. indica were evaluated by comparing the colony diameter and biomass.
[0044] Table 3. Formulas of media containing different nitrogen sources
[0045]
[0046] The results of nitrogen source screening experiment ( Figure 3 ) showed that P. indica exhibited the best growth state when peptone was used as the nitrogen source. The colony diameter was the largest ( Figure 3 A) in solid media, and the mycelial biomass was the highest ( Figure 3 B) in liquid media. Accordingly, it was determined that peptone was the best nitrogen source among the tested nitrogen sources.
[0047] 4. Screening of optimal inorganic salts for fermentation
[0048] To the basal formula of SDA medium, 1 g / L of potassium dihydrogen phosphate (KH2PO4), dipotassium hydrogen phosphate (K2HPO4), sodium chloride (NaCl) or calcium sulfate (CaSO4) was added, respectively, to prepare four solid media (formula 1-4) and four liquid media (formula 5-8) containing different inorganic salts (Table 4). The inoculation method, culture conditions and growth index determination were the same as before (screening of optimal carbon sources for fermentation). The effects of different inorganic salts on the growth of M. indica were evaluated by comparing the colony diameter and biomass.
[0049] Table 4. Formula of media containing different inorganic salts
[0050]
[0051] The results of inorganic salt screening experiment (Table 6) showed that the addition of magnesium sulfate was the most beneficial to the growth of M. indica. In the solid medium containing magnesium sulfate, the colony diameter was the largest (A); in the corresponding liquid medium, the mycelial biomass was also the highest (B). Therefore, among the tested inorganic salts, magnesium sulfate was the best choice. Figure 4 Figure 4 Figure 4
[0052] 5. Design of solid fermentation system
[0053] Based on the results of the single-factor experiments described above, crushed rape straw (30 kg) was used as the solid fermentation substrate. The moisture content (%), initial pH value, corn starch (carbon source) addition amount (%), peptone (nitrogen source) addition amount (%) and magnesium sulfate (inorganic salt) addition amount (%) were selected as the key factors, and an L 16 (4 5 ) orthogonal experimental design was used for optimization (Table 5). The fermentation substrate was prepared according to the design parameters for each treatment group, inoculated with 1 L of M. indica suspension (OD 600 = 1) and mixed well. The substrate was placed in a cool and ventilated environment (25 ± 2°C; relative humidity 65% ± 5%) for solid fermentation, and the temperature at the center of the substrate was controlled at ≤ 35°C. Sampling was performed at the 1st day of fermentation and the 30th day after fermentation, respectively, for qPCR-based quantitative analysis. The data difference significance test used one-way analysis of variance (ANOVA).
[0054] Table 5. L 16 (4 5 ) orthogonal experimental design for optimization of solid fermentation system
[0055]
[0056] Table 6. L 16 (4 5 )orthogonal test results
[0057]
[0058]
[0059] The results of the orthogonal test (as shown in Table 6) analysis showed that the degree of influence of each factor on the abundance of PiTEF gene was in the order of water content > carbon source > nitrogen source > pH value > inorganic salt (Table 6). Accordingly, the optimal solid fermentation system conditions were determined as follows: water content 60%, pH 6, corn starch 4.00%, peptone 0.50%, and magnesium sulfate 0.15% (Table 6). Verification experiments confirmed that the difference in the abundance of PiTEF gene of P. indica cultured under the optimized conditions was significantly higher than that of other combinations, fully confirming that the optimized conditions were most conducive to the proliferation of P. indica.
[0060] Example 2: Verification of the seedling raising efficacy of the solid fermentation microbial agent
[0061] The solid fermentation microbial agent of P. indica prepared after optimization in Example 1 was mixed with a commercial tobacco floating seedling raising substrate at a weight ratio of 1:20. Seedling raising was performed by using the floating seedling raising method (referring to GB / T 25241.1-2010 “Tobacco Intensive Seedling Raising Technical Regulations”). The seedling raising substrate without the addition of the microbial agent was used as a control (CK). The growth indicators of the tobacco seedlings were observed and recorded regularly. The t-test was used for the significant difference analysis of the data.
[0062] In addition, the root systems of the tobacco seedlings of the treatment group (inoculated with the microbial agent) and the control group (not inoculated) were harvested, and the colonization efficiency was detected.
[0063] Table 7. Effect of the solid fermentation microbial agent on the growth of tobacco seedlings
[0064]
[0065] The results are shown in Figure 5 A, the microbial agent obtained by optimization fermentation was applied to the tobacco seedling raising substrate, which could significantly promote the early growth of the tobacco seedlings. The plant height, maximum leaf length, and dry weight of the seedlings of the treatment group were significantly higher than those of the control group (Table 7). Root colonization analysis further confirmed that P. indica successfully colonized the roots of the tobacco seedlings, and the colonization rate was as high as 85.49% (B-C). This indicates that the microbial agent produced by the solid fermentation system is rich in P. indica with high activity, and the direct mixing of the microbial agent into the seedling raising substrate can effectively achieve the colonization of P. indica in the roots of the tobacco seedlings, thereby promoting the growth of the tobacco seedlings. Figure 5
[0066] Example 3: Field efficacy verification of the solid fermentation microbial agent
[0067] The field experiment was conducted at the Fuquan Base of the Guizhou Provincial Tobacco Science Research Institute (107°52'E; 26°75'N). The experimental site was a sunny, well-drained, and level dryland plot at an altitude of 800-1000 meters. Two treatments were included, covering a total area of 2 mu (approximately 0.13 hectares): (a) Control (CK): conventional seedling raising and transplanting without the application of fermentation agents; (b) Solid fermentation agent treatment (T1): 20g of optimized *Pyrophyllus indicus* solid fermentation agent was applied to seedlings in a pit during transplanting. All other agricultural operations (including the type, amount, and timing of basal and topdressing fertilizers) were strictly performed according to local high-quality tobacco production standards. A t-test was used to analyze the significant differences in the data.
[0068] Table 8. Field growth-promoting effects of solid fermentation inoculants
[0069]
[0070] Field trial results showed that ( Figure 6 The treatment group, in which solid fermentation inoculant was applied in pits within the transplanting well, exhibited superior overall tobacco growth in the field compared to the control group. Specifically, by day 70 post-transplanting, the key agronomic traits of the treated tobacco plants (including plant height, maximum leaf length, maximum leaf width, and stem circumference) were significantly better than those of the control group (Table 8). Furthermore, the yield per acre of tobacco leaves in the treated group increased by 6.74% compared to the control group. These results fully demonstrate that the inoculant produced by this solid fermentation system can be directly applied to field production, offering not only convenient application but also effective promotion of tobacco growth and increased yield per acre.
[0071] Example 4: Storage Tolerance Assessment of Fermentation Agent
[0072] Solid-state fermentation inoculum of *Pyrhodopsinus* was prepared using optimal fermentation conditions (60% water content, pH 6.0, 4.00% corn starch, 0.50% peptone, and 0.15% magnesium sulfate). After 30 days of fermentation, it was stored indoors in a cool, ventilated environment (15-25℃) for one year. Liquid fermentation broth of *Pyrhodopsinus* was fermented for 5 days using potato broth (PDB) as the culture medium at 28℃, pH 5.8, dissolved oxygen (DO) 30%, and tank pressure 0.04 MPa. The broth was then dispensed into autoclaved polypropylene tanks for storage. The activity assessment method for the bacterial cells is as follows:
[0073] (a) Solid fermentation agent: Samples were taken every 3 months, and the agent was mixed into the tobacco floating seedling substrate according to Example 2. The biomass of the tobacco seedlings was counted, and the root colonization efficiency of Indian piriformis was tested.
[0074] (b) Liquid fermentation bacterial liquid: every 3 months, sample, mix with commercial tobacco floating seedling substrate at 1:20 (v / w), refer to GB / T 25241.1-2010 "Tobacco Intensive Seedling Technology Regulations" for floating seedling, count tobacco seedling biomass, and detect root colonization efficiency of P. indica.
[0075] Significant difference analysis of data was performed using one-way ANOVA and t-test, and the results are shown in Table 9.
[0076] Table 9. Evaluation of storage stability of fermentation agents
[0077]
[0078] As shown in Table 9, application of liquid fermentation bacterial liquid and solid fermentation bacterial agent in seedling substrate can effectively promote tobacco seedling growth, and the biomass of tobacco seedlings and the colonization rate of P. indica in the roots of the two treatments are comparable. However, the shelf life of the liquid fermentation bacterial liquid is short, and the liquid fermentation bacterial liquid stored for 90 days has completely lost activity. In sharp contrast, the solid fermentation bacterial agent still maintains high activity during a storage period of up to one year. Even after 360 days of storage, the colonization rate of the core functional strain P. indica in the roots of tobacco seedlings can still reach 67.89%, and the relative abundance of the PiTEF gene has only decreased by 26.47% compared with the first day of production. These results fully demonstrate that the solid fermentation bacterial agent has good long-term storage stability, providing strong support for its large-scale application in the field.
[0079] The above-described embodiments only express several embodiments of the present application, which are described in detail and specifically, but should not be understood as limiting the scope of the patent of the present application. It should be noted that for ordinary skilled persons in the art, several modifications and improvements can be made without departing from the concept of the present application, which all belong to the protection scope of the present application. Therefore, the protection scope of the patent of the present application should be subject to the appended claims.
Claims
1. A solid fermentation method of Pyricularia indica solid inoculum, characterized in that, The application relates to a method for producing a biofungicide of a gongylodes strain of a pythium myriophylum. S1: taking a pythium myriophylum strain for activation; S2: inoculating the pythium myriophylum strain into a solid fermentation medium, mixing thoroughly, adding sterile water to adjust the water content, and carrying out solid fermentation in a cool and ventilated environment. The solid fermentation medium is composed of a solid fermentation substrate, a carbon source, a nitrogen source and inorganic salts, the solid fermentation substrate is selected from crushed rape straw, the carbon source includes glucose, sucrose, corn starch and glycerol, the nitrogen source includes peptone, urea, ammonium sulfate and potassium nitrate, the inorganic salts include potassium dihydrogen phosphate, magnesium sulfate, sodium chloride and calcium sulfate, the water content of the solid fermentation medium is 40-70%, and the initial pH value is 4-7.
2. The solid fermentation process of the Myrothecium indicum solid inoculant according to claim 1, characterized in that, The pythium myriophylum strain activated by a potato glucose broth oscillation culture is inoculated into the solid fermentation medium for fermentation, in the solid fermentation medium, the amount of the rape straw is 30 kg, the adding amount of the carbon source is 2-6%, the adding amount of the nitrogen source is 0.5-1.5%, and the adding amount of the inorganic salts is 0.05-0.15%.
3. The solid fermentation process of the Myrothecium indicum solid inoculant according to claim 2, characterized in that, In the solid fermentation medium, the amount of the rape straw is 30 kg, the carbon source is corn starch with an adding amount of 4%, the nitrogen source is peptone with an adding amount of 0.5%, the inorganic salts are magnesium sulfate with an adding amount of 0.15%, the water content of the solid fermentation medium is 60%, and the initial pH value is 6.
4. The solid fermentation process of the Myrothecium indicum solid inoculant according to claim 1, characterized in that, The conditions of the cool and ventilated environment are as follows: the temperature is 15-25 DEG C, the relative humidity is 65%+ / -5%, and the fermentation time is 30 days.
Citation Information
Patent Citations
Piriformospora indica microbial agent and preparation method thereof
CN114107070A