Application of inflammatory mediator combined collagenase in construction of animal corneal thinning model

Abstract

The invention provides application of inflammatory mediator combined collagenase in construction of an animal corneal thinning model, and belongs to the technical field of construction of animal models. According to the method, an inflammatory mediator and collagenase are combined, a novel mouse keratoconus model with the thinned cornea is constructed and obtained, and the deficiency of a keratoconus animal model is made up. Researches show that after the inflammatory mediator is combined with collagenase to construct a mouse cornea thinning model, the cornea thickness of a mouse can be obviously thinned, and the occurrence and development of keratoconus are promoted.

Description

Technical Field

[0001] This invention relates to the field of animal model construction technology, and in particular to the application of inflammatory mediators combined with collagenase in constructing animal corneal thinning models. Background Technology

[0002] Keratoconus is a bilateral, non-inflammatory corneal disease characterized by corneal ectasia and thinning, leading to irregular astigmatism and myopia. In severe cases, it can cause vision loss or even blindness. Keratoconus is a serious condition, but its pathogenesis is not fully understood, and therefore, relevant animal models are lacking.

[0003] Currently, the construction of animal models of keratoconus mainly relies on collagenase treatment, and given the complexity of keratoconus, there is still no optimal animal model to accurately replicate the corneal phenotype and potential pathophysiology. Summary of the Invention

[0004] The purpose of this invention is to provide the application of inflammatory mediators combined with collagenase in constructing an animal model of corneal thinning. This invention utilizes the combination of inflammatory mediators and collagenase to construct a new mouse model of corneal thinning, thus filling the gap in animal models of keratoconus.

[0005] To achieve the above-mentioned objectives, the present invention provides the following technical solution: This invention provides the application of inflammatory mediators combined with collagenase in constructing an animal model of corneal thinning.

[0006] Preferably, the inflammatory mediators include IL-6 and TNF-α.

[0007] Preferably, the collagenase includes type II collagenase.

[0008] Preferably, the animal includes a mouse.

[0009] The present invention also provides a method for constructing an animal corneal thinning model, wherein the corneal stroma of an animal is treated with inflammatory mediators and collagenase eye drops to obtain the animal corneal thinning model.

[0010] Preferably, the inflammatory mediators include IL-6 and TNF-α.

[0011] Preferably, the collagenase includes type II collagenase.

[0012] Preferably, the animal includes a mouse.

[0013] Preferably, the frequency of the eye drop treatment is 1 to 2 times per day.

[0014] The beneficial effects of this invention compared to the prior art are as follows: This invention establishes an animal model of corneal thinning, namely a keratoconus animal model, by binding collagenase with inflammatory mediators. Observations show that inflammatory mediators can induce the upregulation of matrix metalloproteinases, accelerating the thinning of the corneal stroma in keratoconus and causing changes in corneal biomechanical parameters. This series of changes largely simulates the process of corneal thinning.

[0015] This invention is based on a mouse model constructed using inflammatory mediators and collagenase. Increased release of MMPs was detected in the mouse cornea. It provides a good simulation of the core mechanism of keratoconus based on the pathogenesis of this disease and can be considered a more mature and complete method for constructing animal models. Attached Figure Description

[0016] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0017] Figure 1 The release of MMPs from human corneal stromal cells under different treatments was measured. Figure 2 The changes in the elastic modulus of human corneal stroma after treatment with IL-6; Figure 3 The changes in elastic modulus of human corneal stroma after treatment with TNF-α; Figure 4 To construct a slit-lamp approximation of mouse corneas using collagenase in conjunction with inflammatory mediators; Figure 5 To construct OCT images of changes in mouse corneal thickness using collagenase and inflammatory mediators; Figure 6 The changes in corneal thickness in mice under different treatments; Figure 7 To observe images of stained mouse corneal sections under different treatments using a confocal microscope; Figure 8 The expression levels of MMPsRNA in mouse corneal tissue under different treatments. Detailed Implementation

[0018] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as a limitation of the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0019] It should be understood that the terminology used in this invention is merely for describing particular embodiments and is not intended to limit the invention. Furthermore, with respect to numerical ranges in this invention, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Every smaller range between any stated value or intermediate value within a stated range, and any other stated value or intermediate value within said range, is also included in this invention. The upper and lower limits of these smaller ranges may be independently included or excluded from the range.

[0020] Unless otherwise stated, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. While only preferred methods and materials have been described herein, any methods and materials similar or equivalent to those described herein may be used in the implementation or testing of this invention. All references to this specification are incorporated by way of citation to disclose and describe methods and / or materials associated with those references. In the event of any conflict with any incorporated reference, the content of this specification shall prevail.

[0021] Various modifications and variations can be made to the specific embodiments described in this specification without departing from the scope or spirit of the invention, as will be apparent to those skilled in the art. Other embodiments derived from this specification will also be apparent to those skilled in the art. This specification and embodiments are merely exemplary.

[0022] The terms “include,” “including,” “have,” “contain,” etc., used in this article are all open-ended terms, meaning that they include but are not limited to.

[0023] This invention provides the application of inflammatory mediators combined with collagenase in constructing an animal model of corneal thinning.

[0024] In this invention, the inflammatory mediators preferably include IL-6 and TNF-α; the collagenase preferably includes type II collagenase; and the animal is preferably a mouse.

[0025] In this invention, the inflammatory mediators have good safety and can promote the release of MMPs from corneal stromal cells, which is the core mechanism of keratoconus pathogenesis. They also reduce the elastic modulus of corneal tissue, which is consistent with the trend of keratoconus from a biomechanical perspective. After constructing a mouse corneal thinning model by combining the inflammatory mediators with collagenase, the corneal thickness of mice can be significantly reduced, promoting the occurrence and development of keratoconus, which is consistent with the core concept of keratoconus modeling.

[0026] The present invention also provides a method for constructing an animal corneal thinning model, wherein the corneal stroma of an animal is treated with inflammatory mediators and collagenase eye drops to obtain the animal corneal thinning model.

[0027] In this invention, the inflammatory mediators preferably include IL-6 and TNF-α; the collagenase preferably includes type II collagenase; the animal preferably includes mice; the frequency of the eye drops is preferably 1-2 times / day; the duration of the eye drops is preferably 25-35 minutes after epithelial curettage, more preferably 28-32 minutes, and even more preferably 30 minutes.

[0028] Example 1

[0029] A method for constructing a mouse corneal thinning model involves treating the corneal stroma of mice with inflammatory mediators IL-6 and type II collagenase once a day for 30 minutes after epithelial scraping, for a total of one treatment; thus obtaining the corneal thinning model.

[0030] Example 2

[0031] A method for constructing a mouse corneal thinning model involves treating the corneal stroma of mice with inflammatory mediators TNF-α and type II collagenase via eye drops twice daily for a total of two treatments, 25 minutes after epithelial curettage; thereby obtaining the corneal thinning model.

[0032] Example 3

[0033] Isolation of corneal stromal cells: In a 6cm culture dish, corneal stromal tissue (derived from corneal stromal tissue obtained via femtosecond laser, with informed consent from the patient and ethical approval from Qingdao Eye Hospital) was washed with phosphate-buffered saline (PBS) and then cut into 1mm pieces. 3 Small pieces of cells were placed in 0.2% type II collagenase (purchased from Gibco) at 37℃ for 10 min to digest, filtered through a 40 μm filter, centrifuged at 1200 r / min for 5 min, and the cells were collected. After resuspending, the collected cell suspension was seeded into DuPont modified Eagle medium / F-12 (purchased from Gibco) containing 10% serum, and 5% carbon dioxide solution was added to the medium. The cells were then cultured in a 37℃ incubator for 3 days to obtain primary human corneal stromal cells.

[0034] The primary human corneal stromal cells obtained above were seeded in DF12 medium with 10% fetal bovine serum and cultured. The medium was changed daily, and passages were performed every 5 days. At the third generation, cells were treated with no treatment (Normal), IL-6 20 ng / ml, IL-6 50 ng / ml, TNF-α 20 ng / ml, and TNF-α 50 ng / ml, respectively. Cell morphological changes were observed, and total RNA was extracted from the cells using the PrimeScript first-strand cDNA synthesis kit (purchased from Takara Bio Inc.). The purity of the extracted RNA (A260 / 280 and A260 / 230 ratios: 1.9-2.1) was determined using a Nanodrop One spectrophotometer (purchased from Thermo Fisher Scientific). cDNA was synthesized using the Vazyme HiScript III qPCR kit. SYBR Green quantitative PCR was performed using SYBR Green fluorescent dye (purchased from Nanjing Novizan Biotechnology Co., Ltd.). The reaction volume was 10 µl (containing extracted RNA, primers GAPDH, MMP1, and MMP3). Primer GAPDH consisted of a forward primer with the nucleotide sequence CATGTTCGTCATGGGTGTGAA (SEQ ID No. 1) and a reverse primer with the nucleotide sequence GGCATGGACTGTGGTCATGAG (SEQ ID No. 2). Primer MMP1 consisted of a forward primer with the nucleotide sequence AATTTGCCGACAGAGATGAAGTC (SEQ ID No. 3) and a reverse primer with the nucleotide sequence TCAGAAAGAGCAGCATCGATATG (SEQ ID No. 4). Primer MMP3 consisted of a forward primer with the nucleotide sequence TGATGGACCTGGAAATGTTTTG (SEQ ID No. 5) and a reverse primer with the nucleotide sequence AGGGAGTGGCCAATTTCATG (SEQ ID No. 5). (Reverse primer No. 6); reaction conditions were: 95℃ pre-denaturation for 10 s, 40 cycles, each cycle consisting of 95℃ denaturation for 15 s and 60℃ annealing extension for 60 s. The expression levels of MMP1 (matrix metalloproteinase 1a) and MMP3 (matrix metalloproteinase 3) were detected. Each treatment group was performed in triplicate. Quantitative data were analyzed using sequence detection software provided by Biosystems. The results are shown in Table 1 and... Figure 1 As shown.

[0035] Table 1. Release of MMPs from human corneal stromal cells under different treatments

[0036] The results showed that inflammatory mediators IL-6 and TNF-α could promote the release of MMPs (matrix metalloproteinases) from corneal stromal cells, which is consistent with the pathogenesis of keratoconus (increased MMP release) and is correlated with the concentrations of inflammatory mediators IL-6 and TNF-α.

[0037] Example 4

[0038] Human corneal stroma tissue (derived from corneal stroma tissue obtained by femtosecond laser, with informed consent from patients and ethical approval from Qingdao Eye Hospital) was cultured in 6cm culture dishes using DF12 medium + 10% fetal bovine serum. The culture medium was changed daily, and the tissues were treated with IL-6 at 20 ng / ml, IL-6 at 50 ng / ml, TNF-α at 20 ng / ml, and TNF-α at 50 ng / ml, respectively. After 24 hours of treatment, the elastic modulus of the tissue was measured (elastic modulus = stress parameter / strain parameter). For testing, a CellScale BioTester (BioTester 5000; purchased from CellScale, Canada) equipped with a 5N force sensor was used to perform biaxial tensile tests on each group of samples. The testing direction was consistent with the horizontal direction of the microlens, and the samples were fixed using BioRakes connectors. A 3×3mm central square region was selected for testing, and a tensile rate of approximately 0.02 mm / s was maintained to ensure quasi-static loading conditions. The biomechanical properties of the samples were analyzed based on stress-strain curves within the strain range of 0–0.05. Both the pre-stretching and formal tests employed the displacement control method, with a stretching rate of approximately 0.02 mm / s. Horizontal force and displacement data were precisely recorded, and stress and strain parameters were calculated. The results are as follows: Figure 2 and Figure 3 As shown.

[0039] The results showed that inflammatory mediators IL-6 and TNF-α could promote a decrease in the elastic modulus of the corneal stroma, making the cornea softer and closer to the pathological state of keratoconus, which is consistent with the pathological stroma of keratoconus from a biomechanical perspective.

[0040] Example 5

[0041] Male C57BL / 6 mice (5-6 months old, weighing 18-23g, purchased from Shandong Taike Biotechnology Co., Ltd.) were divided into 3 groups: control group (Normal group), type II collagenase group (CLS II group), and inflammation combined group (CLS II + IL-6 group), with 6 mice in each group.

[0042] Eyeballs were removed from euthanized mice, and corneal stroma was isolated under a microscope. The corneal stroma was treated once with PBS, 5 mg / ml type II collagenase (CLS II group), or a mixture of 5 mg / ml collagenase and 50 ng / ml IL-6 (CLS II+IL-6 group). After one treatment, mice in the third group underwent continuous intraocular instillation of inflammatory mediators. Corneal thickness changes were continuously monitored by optical coherence tomography (OCT) over 14 days post-treatment. Each treatment group was performed in triplicate. Results are shown in Table 2. Figures 4 to 6 As shown.

[0043] Table 2. Changes in corneal thickness in mice under different treatments.

[0044] The experimental results showed that the gross appearance of the mouse cornea remained almost unchanged, but its thickness decreased significantly three days post-surgery and gradually recovered by day fourteen. Treatment with collagenase combined with inflammatory mediators resulted in the most pronounced corneal thinning trend, more closely resembling the pathological morphology of keratoconus. In other words, the combination of inflammatory mediators and collagenase can accelerate corneal thinning in mice, consistent with the pathogenesis of keratoconus in terms of corneal thickness changes.

[0045] Example 6

[0046] Male C57BL / 6 mice (5-6 months old, weighing 18-23g, purchased from Shandong Taike Biotechnology Co., Ltd.) were divided into 3 groups: control group, simple surgery group, and inflammation surgery group, with 6 mice in each group.

[0047] Eyeballs were removed from euthanized mice, and corneal stroma was isolated under a microscope. The corneal stroma was treated once with PBS, 5 mg / ml type II collagenase (CLS II) solution, or a mixture of 5 mg / ml collagenase solution and 50 ng / ml IL-6. After one treatment, a third group of mice underwent continuous intraocular treatment with inflammatory mediators. The expression levels of MMPs were measured by immunofluorescence staining of mouse corneal tissue. For the assay, mouse corneal tissue was permeabilized with 0.1% Triton X-100 for 1 min at room temperature, washed once with PBS, and blocked in blocking buffer (2.5% BSA) at 37°C for 1 h. The tissue was washed three times with PBS for 5 min each time, and incubated at 37°C for 1 h with primary antibody against total collagen or fibronectin (purchased from Wuhan Sanying Biotechnology Co., Ltd.). After incubation, the tissue was washed three times with PBS, primary antibody was added, and the tissue was incubated overnight at 4°C. After 24 hours, the slides were washed three times with PBS, incubated at 37°C with species-specific secondary antibody (from Abcom) for 1 hour, washed three times with PBS, and then counterstained with DAPI (0.5 μg / mL) at room temperature for 5 minutes. After counterstaining, the slides were washed once with sterile PBS, and then mounted with Mowiol mounting medium containing polyvinyl alcohol and glycerol (prepared with Tris-Cl buffer) as an anti-fading agent. DABCO (1,4-diazabicyclo[2,2,2]octane) was spread on the slides as a mounting medium, and coverslips were randomly placed on the slides. The results were observed using a confocal microscope. Figure 7 As shown.

[0048] The results showed that the combination of inflammatory mediators and collagenase accelerated the release of MMPs from the mouse cornea, and the core mechanism of this in vivo experiment was consistent with the pathogenesis of keratoconus.

[0049] Example 7

[0050] Male C57BL / 6 mice (5-6 months old, weighing 18-23g, purchased from Shandong Taike Biotechnology Co., Ltd.) were divided into 3 groups: control group, simple surgery group, and inflammation surgery group, with 6 mice in each group.

[0051] The eyeballs of euthanized mice were removed and the corneal stroma was isolated under a microscope. The corneal stroma of the mice was treated once with PBS, 5 mg / ml type II collagenase (CLS II) solution, or 5 mg / ml collagenase solution mixed with 50 ng / ml IL-6.

[0052] On day 3 of the eye drop treatment, total RNA was extracted from the corneal tissue of Experimental 6 mice using a kit (purchased from Takal (Japan)). RNA purity (A260 / 280 and A260 / 230 ratios: 1.9–2.1) was measured using a Thermo Fisher Scientific Nanodrop One spectrophotometer. cDNA was synthesized using the Vazyme HiScript III qPCR kit, and SYBR Green quantitative PCR was performed using SYBR Green fluorescent dye (purchased from Nanjing Novizan Biotechnology Co., Ltd.). The reaction volume was 10 µl (containing extracted RNA, primers MMP1, and MMP3). The reaction conditions were: 95°C pre-denaturation for 10 s, 40 cycles, each cycle consisting of 95°C denaturation for 15 s and 60°C annealing and extension for 60 s each. Quantitative data were analyzed using the sequence detection system software provided by Biosystems. Results are as follows: Figure 8 As shown.

[0053] The results showed that after treatment with collagenase and inflammatory factors, the expression level of MMPs in the corneal stroma of mice increased significantly. Furthermore, treatment with inflammatory factors and collagenase could promote the release of MMPs, a key pathogenic protein family of keratoconus, from mouse corneal stromal cells and corneal tissue, and could also significantly induce corneal thinning in mice.

[0054] As can be seen from the above embodiments, the present invention provides the application of inflammatory mediators combined with collagenase in constructing an animal corneal thinning model. After constructing a mouse model by combining inflammatory mediators with collagenase, the corneal thickness of the mouse can be significantly reduced, promoting the occurrence and development of keratoconus, which is in line with the core concept of keratoconus modeling.

[0055] The above description is only a preferred embodiment of the present invention. It should be noted that for those skilled in the art, several improvements and modifications can be made without departing from the principle of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.

Claims

1. Application of inflammatory mediators combined with collagenase in constructing an animal model of corneal thinning.

2. The application according to claim 1, characterized in that, The inflammatory mediators include IL-6 and TNF-α.

3. The application according to claim 1, characterized in that, The collagenases include type II collagenases.

4. The application according to claim 1, characterized in that, The animals mentioned include mice.

5. A method for constructing an animal corneal thinning model, characterized in that, The corneal stroma of the animals was treated with inflammatory mediators and collagenase eye drops to obtain the corneal thinning model of the animals.

6. The method according to claim 5, characterized in that, The inflammatory mediators include IL-6 and TNF-α.

7. The method according to claim 5, characterized in that, The collagenases include type II collagenases.

8. The method according to claim 5, characterized in that, The animals mentioned include mice.

9. The method according to claim 5, characterized in that, The frequency of the eye drop treatment is 1-2 times / day.

Images