Biomarker for early diagnosis and treatment of LUAD and application thereof

Abstract

The invention relates to the technical field of lung adenocarcinoma, and particularly discloses a biomarker for early diagnosis and treatment of LUAD and application of the biomarker. The biomarker combination comprises an I GF2BP3 gene and an HJURP gene, the invention discloses an application of a biomarker combination in preparation of an LUAD early diagnosis kit, an application of the biomarker combination in preparation of a lung adenocarcinoma early diagnosis product and an application of the biomarker combination in preparation of a lung adenocarcinoma treatment drug. The invention discloses that I GF2BP3 enhances the stability of HJURP mRNA through an m6A dependency mode, promotes the expression of HJURP protein and improves the immunogenicity of the HJURP. Therefore, the proliferation, migration and cell cycle progress of lung adenocarcinoma are driven, and the mechanism blank of m6A modification regulation of the action of HJURP in lung cancer is filled.

Description

TECHNICAL FIELD

[0001] The application belongs to the technical field of lung adenocarcinoma, and particularly relates to a biomarker for early diagnosis and treatment of LUAD and application thereof. BACKGROUND

[0002] Lung adenocarcinoma (LUAD) is one of the most deadly cancers, which is characterized by early diagnosis difficulty, high recurrence and metastasis rate, and poor prognosis. Although the latest advances in molecular technologies such as genomics, transcriptomics, epigenomics and proteomics have revealed some genetic, genomic and epigenetic changes that contribute to the lethality of LUAD, significant progress has been made in the effectiveness of treating LUAD in recent decades, but the therapeutic effect is still far from ideal. Therefore, it is crucial to elucidate the detailed mechanisms of LUAD progression to provide some promising therapeutic targets.

[0003] Studies have shown that epigenetic modifications (such as m6A RNA methylation) are involved in tumor progression by regulating RNA metabolism, and m6A reading proteins (such as IGF2BP3) are abnormally expressed in various cancers and promote malignant phenotypes. However, the specific mechanism of IGF2BP3 in LUAD and its downstream targets have not been clearly defined. In addition, HJURP, as a key protein for maintaining genome stability, its regulatory mechanism in lung cancer and its association with m6A modification are still blank. Therefore, elucidating the functional mechanism of the IGF2BP3-HJURP axis in LUAD is of great significance for developing new diagnosis and treatment strategies. SUMMARY

[0004] The purpose of the present application is to provide a biomarker for early diagnosis and treatment of LUAD and application thereof to solve the problems raised in the background art.

[0005] To achieve the above-mentioned purpose, the present application provides the following technical solutions:

[0006] The biomarker combination for early diagnosis and treatment of lung adenocarcinoma is a combination of IGF2BP3 gene and HJURP gene.

[0007] The application of the biomarker combination in the preparation of a kit for early diagnosis of LUAD, the reagent for detecting the expression level of IGF2BP3 includes IGF2BP3-specific primers for quantitative RT-PCR, and the sequence of the IGF2BP3-specific primers is: forward GGGAGGTGCTGGATAGTTAC, reverse CTAGCTTGGTCCTTACTGGAATAG.

[0008] The reagent for detecting the expression level of HJURP includes an anti-HJURP antibody for Western blotting.

[0009] Preferably, the detection sample is peripheral blood exosome or bronchoalveolar lavage fluid.

[0010] The application of a biomarker combination in the preparation of a diagnostic product for the early diagnosis of lung adenocarcinoma, the biomarker combination being an IGF2BP3 gene and an HJURP gene, wherein the expression amount of IGF2BP3 is positively correlated with that of HJURP, and synchronous high expression of both indicates high risk of LUAD.

[0011] The application of a biomarker combination in the preparation of a screening method for lung adenocarcinoma treatment drugs, the screening method comprising:

[0012] Incubating a candidate compound with IGF2BP3 protein and HJURP mRNA m6A modification segment;

[0013] Detecting binding affinity (KD value) by surface plasmon resonance (SPR), and when the KD value is reduced by ≥50%, it is an effective inhibitor;

[0014] Verifying that the compound shortens the half-life of HJURP mRNA to ≤1.8 hours.

[0015] The application of a biomarker combination in the preparation of a screening method for lung adenocarcinoma treatment drugs, the screening method comprising:

[0016] Compared with the prior art, the beneficial effects of the present application are:

[0017] It is disclosed that IGF2BP3 enhances the stability of HJURP mRNA through an m6A-dependent manner, promotes the expression of HJURP protein, and further drives the proliferation, migration and cell cycle progression of lung adenocarcinoma, filling the mechanism blank of m6A modification regulating HJURP in lung cancer.

[0018] It is confirmed that double high expression of IGF2BP3 / HJURP is an independent biomarker for poor prognosis of LUAD patients, providing a new index for early risk stratification, providing molecular typing basis based on TCGA and GEO multi-omics data, and assisting clinical precision diagnosis and treatment. It is clear that the IGF2BP3-HJURP axis can be used as a key target for intervention in the progression of LUAD, and HJURP overexpression can reverse the anti-tumor effect of IGF2BP3 deletion, proving that targeting this pathway has therapeutic potential.

[0019] It provides a theoretical basis for developing m6A reader protein inhibitors (such as RNA binding domain targeting IGF2BP3) or HJURP antagonists. BRIEF DESCRIPTION OF DRAWINGS

[0020] Figure 1 A key m6A regulator in LUAD is determined for high-throughput library screening of the present application.

[0021] Figure 2 IGF2BP3 promotes tumor progression of LUAD for the present application;

[0022] Figure 3 IGF2BP3 in LUAD for the present application is a functional annotation diagram;

[0023] Figure 4 HJURP is determined as a downstream target of IGF2BP3 for the present application diagram;

[0024] Figure 5 IGF2BP3 regulates the expression of HJURP in an m6A-dependent manner for the present application diagram;

[0025] Figure 6 IGF2BP3 promotes LUAD progression through HJURP expression for the present application diagram. DETAILED DESCRIPTION

[0026] The technical solutions in the embodiments of the present application will be described clearly and completely below in conjunction with the drawings in the embodiments of the present application. Obviously, the described embodiments are only part of the embodiments of the present application, rather than all the embodiments. Based on the embodiments in the present application, all other embodiments obtained by those of ordinary skill in the art without creative labor fall within the scope of protection of the present application.

[0027] Embodiment one:

[0028] Please refer to Figures 1 to 6 It is shown that the biomarkers for early diagnosis and treatment of LUAD include IGF2BP3 gene and HJURP gene, and the biomarker combination includes application in preparation of a LUAD early diagnosis kit and application in preparation of a lung adenocarcinoma treatment drug and application in a lung adenocarcinoma treatment inhibitor.

[0029] The specific experiments of the present application are as follows:

[0030] Materials and methods

[0031] Data collection

[0032] Transcriptome RNA sequencing and clinical follow-up data are from TCGA-LUAD patients (https: / / cancergenome.nih.gov / ). In addition, the data of MeRIP (GEO: GSE29714) and IGF2BP3-RIP (GEO: GSE90639) datasets are obtained from GEO (https: / / www.ncbi.nlm.nih.gov / geo / ).

[0033] Analysis of differentially expressed genes (DEGs)

[0034] The "limma" R package was used to identify DEGs in TCGA, with threshold criteria including |Log2 fold change (FC)| > 0.5 and P < 0.05. Venn diagram (https: / / hiplot-academic.com / basic / venn) To identify key targets, create interesting overlaps between two sets of data.

[0035] Survival analysis

[0036] By Kaplan-Meier survival analysis, the difference in overall survival (OS) between the two groups was assessed using the log-rank test.

[0037] Immune cell infiltration estimation

[0038] Based on the standardized gene expression profile of R. Wilcoxon test, ssGSEA analysis was performed to quantify 29 different immune cell types in tissues to examine changes in infiltration levels.

[0039] Construction of protein-protein interaction (PPI) network

[0040] mRNAs were incorporated into PPI networks using the STRING database (https: / / string-db.org / ) with a confidence score > 0.8. Cytoscape (version 3.8.1) was used to visualize the PPI network.

[0041] Gene Set Variation Analysis (GSVA)

[0042] GSVA analysis was used to study the changes in biological processes between different copper metabolism regulation patterns in the R package "GSVA".

[0043] Cell culture and cell culture

[0044] LUAD cell lines (A549 and H1975 cells) were purchased from the Cell Bank of Shanghai Biotechnology Institute (Shanghai, China). All LUAD cell lines were identified by short tandem repeat (STR) fingerprinting at the Forensic Laboratory of Sun Yat-sen University (Guangzhou, China) and confirmed to be mycoplasma-free. All LUAD cell lines were cultured in Dulbecco's Modified Eagle Medium (DMEM) (Invitrogen) containing 10% FBS (HyClone) and 1% penicillin-streptomycin (P / s).

[0045] CCK-8 assay.

[0046] To evaluate cell viability, we used a cell counting kit-8 (APEBIO, USA) according to the manufacturer’s instructions. Briefly, 3000 cells were cultured in each well of a 96-well plate for 1-4 days. After incubating the CCK-8 reagent at 37°C for 2 hours, the absorbance intensity at 450 nm was measured.

[0047] Colony formation assay

[0048] For the colony formation assay, a total of 1000 cells were grown in each well and then cultured in a 6-well plate. Subsequently, the cells were fixed and stained with paraformaldehyde and crystal violet, respectively. The colonies were photographed and counted.

[0049] Cell cycle analysis

[0050] LUAD cells were collected and fixed with 75% pre-cooled ethanol at 4°C overnight. After washing with phosphate-buffered saline (PBS) three times, 300 μl of DNA staining solution (Multiscience, China) was used to resuspend the cells at room temperature for 30 minutes. Cell cycle analysis was detected by flow cytometry (FACS LSRII, BD Bioscience, USA).

[0051] Transwell migration assay

[0052] Transfected A549 and H1975 cells were added to the top chamber of serum-free medium. The membrane in the upper chamber was pre-coated with 1:8 diluted Matrigel (Yeasen, China). 500 μl of DMEM containing 10% FBS was poured into the lower chamber. After a 24-48 hour incubation period, the cells in the top chamber were removed using a cotton swab, then preserved in 4% polyformaldehyde for 15 minutes, and finally colored with a 2.5% crystal violet solution for 15 minutes. The area of adherent cells in each well was photographed.

[0053] Western blotting

[0054] The harvested cell lysate was denatured in RIPA lysis buffer (Solarbio, China). 4 μg of protein lysate was loaded onto a 10% SDS-PAGE gel and separated, and then the proteins were transferred to a PVDF membrane. Subsequently, the primary antibody was introduced and incubated at 4°C. Next, the membrane was exposed to the appropriate secondary antibody during a 2-hour incubation at room temperature. Finally, the protein bands on the membrane were observed using a GV6000M imaging system (GelView6000pro).

[0055] Quantitative RT-PCR

[0056] RNA was extracted from cells using Simple P Total RNA Extraction Kit (Biolux, China) and then reverse transcribed into complementary DNA using M5 Sprint qPCR RT Kit with gDNA Eliminator (Mei5bio, China).

[0057] Amplification primers (IGF2BP3 forward: GGGAGGTGCTGGATAGTTAC; IGF2BP3 reverse: CTAGCTTGGTCCTTACTGGAATAG).

[0058] Chemicals, antibodies and transfection

[0059] HUR (RiboBio, Guangzhou, China); Actinomycin D (APExBio, Houston, Texas, USA); Anti-IGF2BP3 (Abcam, Cambridge, UK); Anti-HJURP (Protientech, Cat. 15283-1-AP, China). IGF2BP3 overexpression plasmid and short hairpin RNA (shRNA) were purchased from GeneChem (Shanghai, China). Specific human shRNA sequence (shIGF2BP3: ATACCCGCCTCATTTACAG). All transfections were performed according to the manufacturer’s instructions.

[0060] mRNA stability assay

[0061] To explore the stability of HJURP mRNA and protein under the downregulation or upregulation of IGF2BP3, cells were treated with actinomycin D for 0, 3, 6 hours before extracting RNA. The procedure of total RNA isolation and RT-qPCR was performed as described above. The transcription level of HJURP mRNA was estimated as the half-life of mRNA and normalized to GAPDH as a standard.

[0062] RNA immunoprecipitation (RIP) assay

[0063] RIP assay was performed according to the instructions using Geneseed RIP Kit (Guangzhou, China). Briefly, magnetic beads were mixed with anti-m6A / IGF2BP3 / IgG antibodies, and then cell lysates were added. Next, the bound complexes were thoroughly washed, eluted, and purified, and analyzed by RT-PCR. The enrichment degree of precipitated RNA was normalized to the input control group.

[0064] Statistical analysis

[0065] We analyzed our data using R language (version 4.2.3) and Prism 10 (GraphPad, USA). Survival analysis was performed using the Kaplan-Meier method and log-rank test. Pearson’s correlation coefficient was used to analyze correlation. Student’s t-test and one-way ANOVA were used to test differences. All experiments were independently performed at least 3 times under similar conditions unless otherwise stated in the figures. P < 0.05 was considered statistically significant in all cases.

[0066] Results analysis and discussion;

[0067] High-throughput library screening identified IGF2BP3 as a core m6A regulator in LUAD.

[0068] m6A modification dynamically regulates the mRNA stability and translation efficiency of proto-oncogenes, thus promoting the occurrence and development of tumors. A total of 26 m6A regulators, including 10 writers, 3 erasers, and 13 readers, were investigated according to TCGA-LUAD data. CNV alteration frequency showed that CNV alteration was prevalent in 26 regulators. YTHDs and IGF2BPs were found to have CNV amplification frequency, while ZC3H13 and RBM15 showed copy number deletion Figure 1 A). In addition, m6A regulators with amplified CNV had significantly higher expression in LIHC tissues compared to normal tissues, and vice versa Figure 1 B). Survival analysis of the prognostic values of 21 m6A regulators in LUAD patients showed that patients with high expression genes (IGF2BP3, HNRNPC, HNRNPA2B1, METTL5, and RBM15) had poorer overall survival Figure 1 C). The m6A regulator network depicted a comprehensive picture of m6A regulator interactions, regulator connections, and their prognostic significance in LUAD patients. We found that m6A regulators not only showed significant correlation in expression within the same functional category, but also showed significant correlation between writers, erasers, and readers. Figure 1 D). Importantly, based on differential, risk, survival, CNV alteration frequency analysis, HNRNPC and IGF2BP3 were screened Figure 1 E), of which IGF2BP3 mRNA had the highest expression in LUAD cell lines (A549 and H1975) Figure 1 F).

[0069] In summary, these data further elucidate the oncogenic role of IGF2BP3 in LUAD progression.

[0070] m6A modification drives the malignant phenotype of LUAD by regulating RNA stability, translation efficiency, and epigenetic interaction networks. IGF2BP3 has a significant oncogenic effect in LUAD, and its high expression is closely related to poor prognosis, lymph node metastasis, and tumor progression in patients.

[0071] IGF2BP3 was screened as a core m6A regulator protein by high-throughput library screening in LUAD. We confirmed from a bioinformatics perspective that the expression of IGF2BP3 in LUAD was significantly higher than that in normal samples, and patients with high expression of IGF2BP3 had poor prognosis. IGF2BP3 promotes tumor malignant progression through multiple mechanisms such as integrating m6A modification, signal pathway regulation, EMT induction, and metabolic reprogramming. Its core function as an "oncogenic RNA binding protein" is to maintain the stability of oncogene mRNA, thereby amplifying the oncogenic signal network. Therefore, targeting strategies for IGF2BP3 (such as inhibiting its RNA binding activity or blocking synergistic protein interactions) may provide new directions for tumor treatment.

[0072] As shown in Figure 1 High-throughput library screening determines the key m6A regulators in LUAD.

[0073] A. CNV variation frequency of m6A regulators in TCGA cohort. The height of the column represents the frequency of change. Deletion frequency, blue dot; amplification frequency, red dot.

[0074] B. Differential expression of m6A regulators in normal and LUAD tissues. LUAD, red; normal, blue. Significant results are shown as *p<0.05, **p<0.01, and ***p<0.001.

[0075] C. Kaplan-Meier survival analysis shows that the indicated genes exhibit prognostic performance in LUAD patients based on TCGA data.

[0076] D. Interaction of 26 m6A regulators in LUAD. Different biological functions of m6A regulators are represented by circles of different colors. The lines connecting the regulators show their interactions, with pink indicating positive correlation and blue indicating negative correlation. The size of the circle indicates the effect of each regulator on prognosis. The purple dot in the circle indicates a risk factor for prognosis; the green dot in the circle indicates a good prognostic factor.

[0077] E. Venn diagram showing that IGF2BP3 and HNRNPC are determined based on cross-analysis. Cox, p<0.05; HR>1; differential analysis between normal and LUAD in TCGA database, with a critical standard set as |log2 fold change (FC)|>0 and p<0.05.

[0078] F. mRNA expression levels of IGF2BP3 and HNRNPC in A549 and H1975 were detected by pPCR.

[0079] IGF2BP3 promotes tumor progression of LUAD.

[0080] To explore the biological function of IGF2BP3 in LUAD, IGF2BP3 knockdown or overexpression was transfected in A549 and H1975 cells. Transfection efficiency was evaluated by western blot and qPCR Figure 2 A-B and Fig. S1). CCK-8 and colony formation assays showed that IGF2BP3 played a crucial role in cell proliferation and colony formation ability Figure 3 C-D). Transwell analysis showed that IGF2BP3 also affected the cell migration ability of A549 and H1975 cells Figure 3 E). In addition, cell cycle analysis by flow cytometry showed that silencing HJURP could induce G0 / G1 phase arrest, reducing the proportion of S phase cells. Therefore, these data showed that IGF2BP3 promoted tumor progression of LUAD.

[0081] As shown in Figure 2 IGF2BP3 promotes tumor progression of LUAD

[0082] A-B. Transfection knockdown (A) and overexpression (B) efficiency was verified by western blot and qPCR, respectively, in A549 and H1975 cells.

[0083] C-D. CCK-8 (C) and colony formation (D) assays were used to analyze the proliferation activity of IGF2BP3 in LUAD cells.

[0084] E. Transwell migration assay was used to analyze the migration activity of IGF2BP3 in LUAD cells.

[0085] F. Cell cycle distribution was analyzed by flow cytometry. The proportion of each cell cycle phase is shown in the histogram.

[0086] All data are expressed as mean ± standard deviation (n = 3). *P < 0.05, **P < 0.01, ***P < 0.001 compared with the control group. Two-tailed unpaired Student's t test (A, B, D, E and F).

[0087] Functional annotation of IGF2BP3 in LUAD.

[0088] Immune cell infiltration analysis showed that patients with high IGF2BP3 did not show significant enhancement compared to patients with low IGF2BP3 using the single-sample GSEA (ssGSEA) algorithmFigure 3 A), which indicates that IGF2BP3 does not promote tumor progression by regulating the immune system. To explore the potential molecular mechanism of IGF2BP3 in LUAD patients, we used gene set variation analysis (GSVA) to evaluate the biological function differences between high and low IGF2BP3 subgroups of LUAD patients, and the results showed that high IGF2BP-3 patients were mainly related to cell cycle and DNA damage repair signaling in TCGA dataset Figure 3 B), glycolysis, MYC and mitotic spindle signaling pathway Figure 3 C). In the TCGA dataset, we evaluated the correlation between IGF2BP3 expression and clinical characteristics, and we screened 1421 DEGs (critical standard set as |log2 fold change (FC)|>0.5, p<0.05) of high and low IGF2BP3 LUAD patients for subsequent study Figure 3 D). In summary, these data suggest that IGF2BP3 may regulate cell cycle and DNA damage repair to promote tumor progression of LUAD.

[0089] High IGF2BP3 patients were mainly related to cell cycle and DNA damage repair signals, glycolysis, MYC and mitotic spindle signaling pathways in LUAD. In hepatocellular carcinoma (HCC), IGF2BP3 binds to the m6A site of MCM10 mRNA, prolongs its half-life, and promotes tumor cell proliferation and migration. In gastric cancer (GC), IGF2BP3 cooperates with METTL14 to stabilize EGFR mRNA through an m6A-dependent mechanism, activates the EGFR pathway, and promotes tumor growth and metastasis. In lung cancer (LUAD), IGF2BP3 inhibits TFAP2A-mediated anemia by m6A modification, thereby maintaining tumor cell survival. To further study the modification pattern of IGF2BP3 in LUAD, 31 key genes MeRIP (GEO:GSE29714) and IGF2BP3-RIP (GEO:GSE90639) were used to identify the downstream targets of IGF2BP3. Finally, HJURP was identified as a substrate of IGF2BP3 that functions in an m6A modification manner.

[0090] Figure 3 A. IGF2BP3 expression and immune-related features determined by ESTIMATE, immune, stromal and tumor purity scores based on TCGA data.

[0091] A. IGF2BP3 expression and immune-related features determined by ESTIMATE, immune, stromal and tumor purity scores based on TCGA data.

[0092] B. GSVA analysis (KEGG) of IGF2BP3 in LUAD patients based on TCGA data

[0093] C. GSVA analysis of IGF2BP3 in LUAD patients based on TCGA data (HALLMARK).

[0094] HJURP has been identified as a downstream target of IGF2BP3.

[0095] 1421 DEGs were screened using the limma package to investigate the potential biological behavior of IGF2BP3 modification patterns between high and low IGF2BP3 expression groups. The STRING database (confidence value > 0.8) and a PPI network were used to visualize interactions between DEGs. Figure 4 A). Through cross-analysis of 160 genes with prognostic significance and 50 central genes in the PPI network, 31 genes were identified ( Figure 4 B and Table S3). Then, based on 31 key genes MeRIP (GEO:GSE29714) and IGF2BP3-RIP (GEO:GSE90639), HJURP was identified as a downstream target of IGF2BP3 (B and S3). Figure 4 C). Finally, differential analysis showed that, using the TCGA dataset, HJURP expression was significantly increased in LUAD compared to normal tissues ( Figure 4 DE). KM analysis showed that HJURP overexpression was associated with lower survival rates in cancer patients ( Figure 4 F). Therefore, these data suggest that IGF2BP3 may exert its oncogenic effect by regulating HJURP through m6a modification.

[0096] HJURP (Holliday Junction Recognition Protein) is a multifunctional protein that plays an important biological role in various cancers. Its functions include maintaining genome stability, regulating tumor progression, and modulating the immune microenvironment. HJURP is the molecular chaperone of histone H3 variant CENP-a, responsible for loading it to centromeric regions, thereby maintaining centromeric chromatin structure and ensuring proper chromosome segregation. This function is crucial for genome stability, and abnormal regulation can lead to chromosomal instability (CIN), which in turn promotes tumorigenesis. In addition, HJURP is involved in the epigenetic regulation of DNA damage repair by facilitating the turnover of H3K9me3 and HP1 proteins in DNA double-strand break (DSB) repair. In cancer (GC), HJURP promotes TOP2A transcription by stabilizing MYC protein, enhancing cell proliferation, and chemotherapy resistance. In triple-negative breast cancer (TNBC), HJURP promotes cell proliferation and metastasis by inhibiting the tumor suppressor function of wild-type p53. In hepatocellular carcinoma (HCC), HJURP overexpression promotes cell migration, invasion, and colony formation, and enhances tumorigenesis by reducing G0 / G1 phase arrest and apoptosis. In bladder cancer (BLUC), HJURP regulates cell cycle and apoptosis by activating the JNK / STAT3 pathway and promotes tumor progression. HJURP plays a role in promoting cancer in various cancers by regulating genome stability, cell cycle, apoptosis resistance, and immune microenvironment, and its expression level is closely related to patient prognosis. Targeting HJURP or its regulatory network may provide a new strategy for cancer treatment.

[0097] As shown in Figure 4 HJURP was identified as a downstream target of IGF2BP3

[0098] A. PPI network based on STRING confidence score > 0.8 of 1421 up-regulated genes in LUAD.

[0099] B. Based on 50 key genes and 160 prognostic genes of PPI network, Venn diagram shows 31 key genes.

[0100] C. Venn diagram shows that based on key gene MeRIP (GEO: GSE29714) and IGF2BP3-RIP (GEO: GSE90639), HJURP was identified as a downstream target of IGF2BP3.

[0101] D. Expression of HJURP between normal people and LUAD.

[0102] E. Paired difference analysis of HJURP in normal people and tumor patients.

[0103] The F. Kaplan-Meier overall survival (OS) curve for cancer patients is consistent with HJURP expression in the Cancer Genome Atlas (TCGA) cohort.

[0104] IGF2BP3 regulates HJURP expression in an m6A-dependent manner.

[0105] The m6A site prediction tool SRAMP is used to predict different m6A sites in HJURP at single-base resolution. Figure 5 A). Then, MeRIP RT-PCR was performed to investigate whether gene expression affected m6A modification. The results showed that HJURP mRNA was enriched in the m6A-specific antibody ( Figure 5 B). RIP and RT-qPCR were used to assess RNA enrichment, and the results showed that anti-IGF2BP3 antibody enriched HJURP mRNA compared with IgG in A549 and H1975 cell lines, which confirmed the direct interaction between IGF2BP3 and HJURP. Figure 5 C). Furthermore, IGF2BP3 overexpression significantly prolonged the half-life of HJURP mRNA in TNBC cells ( Figure 5 D), while IGF2BP3 knockout significantly shortened the half-life of HJURP messenger RNA in TNBC cells (see D). Figure 5 E). Furthermore, the mRNA silencing stabilizer HuR significantly reduced IGF2BP3-induced HJURP upregulation (E). Figure 5 F), indicating that IGF2BP3 regulates HJURP expression by modulating its mRNA stability. In summary, these data suggest that IGF2BP3 mediates HJURP mRNA degradation through m6A modification.

[0106] like Figure 5 The results show that IGF2BP3 regulates HJURP expression in an m6A-dependent manner.

[0107] A.SRAMP predicted potential m6A sites in HJURP. Different colored lines represent different confidence levels.

[0108] B. Compared with IgG in A549 and H1975 cells, m6A-specific antibodies enriched HJURP mRNA.

[0109] C. Compared with IgG in A549 and H1975 cells, the anti-IGF2BP3 antibody enriched HJURP mRNA.

[0110] DE.qRT-PCR assay showed the stability of MCM10 mRNA in A549 cells.

[0111] F. Effect of silencing HuR on MCM10 expression in A549 and H1975 cells.

[0112] All data are presented as mean ± standard deviation (n = 3). *P < 0.05, **P < 0.01, ***P < 0.001 compared with control. Two-tailed unpaired Student’s t test (B, C, D, E, and F).

[0113] IGF2BP3 promotes LUAD progression through HJURP expression.

[0114] HJURP is significantly associated with poor prognosis in many cancers, such as cholangiocarcinoma, lung cancer, and cancer. In LUAD, we found that overexpression of HJURP also promoted cell proliferation Figure 6 A), colony formation Figure 6 B), and migration Figure 6 C) in A549 and H1975 cells, which confirmed the oncogenic role of HJURP in LUAD (Fig. A-C). Since IGF2BP3 can regulate the expression of HJURP, a rescue experiment was performed to verify the interaction of IGF2BP3 and HJURP in the progression of LUAD. As expected, HJURP overexpression can partially offset the anti-tumor effects of shIGF2BP3 on cell survival Figure 6 A), colony formation Figure 6 B), and migration Figure 6 C). In addition, the G0 / G1 phase arrest induced by silencing IGF2BP3 can be reversed by overexpression of HJURP in A549 and H1975 cells. Overall, IGF2BP3 promotes the progression of LUAD through the expression of HJURP.

[0115] We confirmed by bioinformatics that HJURP was significantly upregulated in LUAD compared with normal tissues, and HJURP overexpression showed low survival rate. MeRIP RT-PCR showed that IGF2BP3 regulates the stability of HJURP mRNA through m6A modification. Importantly, in in vitro experiments, a rescue experiment was performed to verify that the anti-tumor effect induced by shIGF2BP3 can be reversed by HJURP overexpression. The above data suggest that the IGF2BP3-HJURP axis provides a compelling therapeutic strategy for inhibiting tumor progression in LUAD.

[0116] As Figure 6 IGF2BP3 promotes LUAD progression through HJURP expression.

[0117] A. Cell survival was measured in IGF2BP3-silenced cells with or without HJURP overexpression in A549 and H1975 cells.

[0118] B. Colony formation assay shows the rescue effect of HJURP on IGF2BP3 silencing in A549 and H1975 cells.

[0119] C. Transwell migration assay was performed in IGF2BP3 deficient cells with or without HJURP overexpression in A549 and H1975 cells.

[0120] D. Cell cycle distribution of IGF2BP3 deficient cells with HJURP overexpression was analyzed by flow cytometry in A549 and H1975 cells. The proportion of each cell cycle stage is shown in the histogram.

[0121] All data are expressed as mean ± standard deviation (n = 3). NS not significant, **P < 0.01, ***P < 0.001, ***P < 0.001 compared with control group. Two-tailed unpaired Student's t test (A-D).

[0122] It is understood that in the development of any actual implementation, as in any engineering or design project, numerous implementation-specific decisions can be made. Such development efforts might be complex and time-consuming, but would nevertheless be a routine undertaking for those of ordinary skill in the art having the benefit of this disclosure, without undue experimentation.

[0123] It should be noted that the above examples are only used to illustrate the technical solutions of the present application but not to limit the present application. Although the present application has been particularly described with reference to the preferred embodiments, it will be understood by those skilled in the art that the technical solutions of the present application can be modified or replaced equivalently without departing from the spirit and scope of the technical solutions of the present application, and they should be covered in the scope of the claims of the present application.

Claims

1. Biomarkers for early diagnosis and treatment of lung adenocarcinoma, characterized in that, The biomarker is the IGF2BP3 gene or its expression product.

2. The biomarker for early diagnosis and treatment of lung adenocarcinoma as described in claim 1, characterized in that, The biomarker IGF2BP3 gene is used to detect elevated expression levels in biological samples, indicating an increased risk of LUAD or a poor prognosis.

3. A biomarker composition for early diagnosis and treatment of lung adenocarcinoma, characterized in that, The biomarker composition includes the IGF2BP3 and HJURP genes or their expression products.

4. The biomarker composition for early diagnosis and treatment of lung adenocarcinoma as described in claim 3, characterized in that, The biomarker composition IGF2BP3 was positively correlated with the expression level of HJURP, and high expression of both simultaneously indicated a significantly increased risk of LUAD progression.

5. The application of the biomarker combination as described in claim 1 in the preparation of an early diagnostic kit for lung adenocarcinoma, characterized in that, The kit for detecting IGF2BP3 expression levels includes IGF2BP3-specific primers for quantitative RT-PCR. The sequences of the IGF2BP3-specific primers are: forward GGGAGGTGCTGGATAGTTAC, reverse CTAGCTTGGTCCTTACTGGAATAG. The reagents used to detect HJURP expression levels include anti-HJURP antibodies used for Western blotting.

6. The reagent kit as described in claim 5, characterized in that, The test samples are peripheral blood exosomes or bronchoalveolar lavage fluid.

7. The application of a combination of biomarkers in the preparation of diagnostic products for the early diagnosis of lung adenocarcinoma, characterized in that, The biomarker combination consists of the IGF2BP3 gene and the HJURP gene. The expression levels of IGF2BP3 and HJURP are positively correlated, and simultaneous high expression of both indicates a high risk of LUAD.

8. A pharmaceutical composition for treating lung adenocarcinoma, characterized in that, This includes inhibitors targeting IGF2BP3 or HJURP, as well as pharmaceutically acceptable vectors.

9. The pharmaceutical composition for treating lung adenocarcinoma as described in claim 8, characterized in that, The inhibitors are: nucleic acid molecules that specifically silence the IGF2BP3 gene; small molecule compounds that inhibit HJURP function; and monoclonal antibodies that block the binding of IGF2BP3 to HJURP mRNA.

Images