Genetically modified rodents for preparing quaternary immobilized light chains and methods of making same

By introducing a specific human immunoglobulin Kappa light chain gene segment into the immunoglobulin Kappa light chain locus in rodents, the problem of light chain recognition and separation in bispecific antibodies was solved, enabling the rapid preparation of diverse antibodies in the same mouse.

CN121065267APending Publication Date: 2025-12-05CYAGEN BIOSCIENCES (SUZHOU) INC
View PDF 8 Cites 0 Cited by

Patent Information

Application Number
CN202510055943.2
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Priority Date
2024-06-04
Filing Date
2025-01-14
Publication Date
2025-12-05

AI Technical Summary

Technical Problem

Existing technologies struggle to effectively address the recognition and separation of light chains during the synthesis and expression of bispecific binding proteins, making it difficult to prepare bispecific antibodies.

Method used

By knocking out a continuous segment from the endogenous V region to the J region of the rodent immunoglobulin Kappa light chain locus and introducing human immunoglobulin Kappa light chain gene segments, including specific V and J genes, a genetically modified rodent genome was constructed, which was then operatively linked to the endogenous invariant region.

Benefits of technology

It enables the generation of multiple antibodies in the same mouse, maintains light chain diversity, shortens the preparation time to within one year to cover most antibody screenings, and simplifies the preparation process.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121065267A_ABST
    Figure CN121065267A_ABST
Patent Text Reader

Abstract

Genetically modified rodents whose immunoglobulin light chain loci are engineered to be inserted into human immunoglobulin light chain gene segments are disclosed, which rodents are capable of normal reproduction and producing human light chain containing antibodies. The invention also provides a method of making the genetically modified rodent and a use of the rodent.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The present invention relates to genetically modified rodents (e.g., mice), cells, embryos and tissues, and in particular, the present invention relates to the humanization of the immunoglobulin Kappa light chain variable region locus of a rodent (e.g., mouse) and methods thereof. The present invention also relates to the genome of the modified rodent, cells, tissues comprising the genome, and methods and uses of the rodent for the production of monoclonal antibodies. The present invention also relates to a rodent having a modified genome. BACKGROUND

[0002] There have been problems in the synthesis and expression of bispecific binding proteins, in part due to difficulties in identifying appropriate light chains that can associate with two different heavy chains and be expressed together, and in part due to problems in isolation. Mice can be expressed that express a common light chain, the antibodies expressed by which have heavy chains that can associate with and be expressed with the same or substantially the same light chain. This is particularly useful in the production of bispecific antibodies. For example, a mouse can be immunized with a first immunogen to produce B cells that express antibodies that specifically bind to a first epitope. The mouse (or a genetically identical mouse) can be immunized with a second immunogen to produce B cells that express antibodies that specifically bind to a second epitope. SUMMARY

[0003] One aspect of the present invention provides a method of making a genetically modified rodent, the method comprising (i) knocking out a continuous segment of endogenous V- to J-regions of an immunoglobulin Kappa light chain locus of the rodent; and (ii) introducing into the immunoglobulin Kappa light chain locus of the rodent a human immunoglobulin Kappa light chain gene segment operably linked to an endogenous constant region of the immunoglobulin Kappa light chain locus of the rodent; wherein the human immunoglobulin Kappa light chain gene segment comprises only four human immunoglobulin Kappa light chain V-genes and only one human immunoglobulin Kappa light chain J-gene; wherein the four human immunoglobulin Kappa light chain V-genes are selected from the group consisting of: hlgKVl-39, hlgKVl-33, hlgKV2-28, hlgKV2-30, hlgKV3-20, hlgKV3-15, hlgKV3-11, and hlgKV4-1; and the one human immunoglobulin Kappa light chain J-gene is selected from the group consisting of: hlgKJl, hlgKJ2, hlgKJ3, hlgKJ4, and hlgKJ5.

[0004] In another aspect, the present application provides a genetically modified rodent genome, wherein the immunoglobulin Kappa light chain locus of the genetically modified rodent genome does not contain a continuous segment of the V region to the J region of the endogenous immunoglobulin Kappa light chain locus of the rodent; and the immunoglobulin Kappa light chain locus of the rodent genome comprises a human immunoglobulin Kappa light chain gene segment operably linked to an endogenous constant region of the immunoglobulin Kappa light chain locus of the rodent; wherein the human immunoglobulin Kappa light chain gene segment comprises only four human immunoglobulin Kappa light chain V genes and only one human immunoglobulin Kappa light chain J gene; wherein the four human immunoglobulin Kappa light chain V genes are selected from the group consisting of hlgKVl-39, hlgKVl-33, hlgKV2-28, hlgKV2-30, hlgKV3-20, hlgKV3-15, hlgKV3-11, and hlgKV4-1; and wherein the one human immunoglobulin Kappa light chain J gene is selected from the group consisting of hlgKJl, hlgKJ2, hlgKJ3, hlgKJ4, and hlgKJ5.

[0005] In another aspect, the present application relates to a cell, tissue, organ, or rodent comprising the rodent genome of any one described herein. In another aspect, the present application provides a method of making a monoclonal antibody.

[0006] The present application will construct into 2 models using the most frequently used hlgKVl-39, hlgKVl-33, hlgKV2-28, hlgKV2-30, hlgKV3-20, hlgKV3-15, hlgKV3-11, and hlgKV4-1 genes in VH and VL pairing, which is faster to construct, and can be obtained within 1 year, but can cover most of the antibody screening. The present application can be used in common light chain model applications, without immunizing multiple models when immunizing antigens, antibodies can be produced in the same mouse, and light chain diversity is maintained in the same mouse. BRIEF DESCRIPTION OF DRAWINGS

[0007] Figure 1 Gene orientation and arrangement of human IgK locus is shown, wherein green indicates functional V genes; yellow indicates V region ORFs; red indicates V region pseudogenes; and blue indicates functional C genes.

[0008] Figure 2 Gene orientation and arrangement of mouse IgK locus is shown, wherein green indicates functional V genes; yellow indicates V region ORFs; red indicates V region pseudogenes; and blue indicates functional C genes.

[0009] Figure 3This shows the mouse Kappa light chain genome constructed according to Example 1 of the present invention.

[0010] Figure 4 This shows the mouse Kappa light chain genome constructed according to Example 2 of the present invention.

[0011] Figure 5 Represented as Figure 3 The image shows the pattern of the plasmid vector constructed in Example 1.

[0012] Figure 6 Represented as Figure 4 The image shows the pattern of the plasmid vector constructed in Example 2.

[0013] Figure 7 show Figure 3 The PCR identification region of Example 1 is shown.

[0014] Figures 8 to 11 The PCR identification results of Example 1 are shown.

[0015] Figure 12 The PCR identification region of the F1 mouse obtained in Example 1 is shown.

[0016] Figures 13 to 19 The PCR identification results of F1 mice in Example 1 are shown.

[0017] Figure 20 show Figure 4 The PCR identification region shown in Example 2.

[0018] Figures 21 to 24 The PCR identification results of Example 1 are shown.

[0019] Figure 25 The PCR identification region of the F1 mouse obtained in Example 2 is shown.

[0020] Figures 26 to 31 The PCR identification results of F1 mice in Example 2 are shown.

[0021] Figure 32 This shows the proportion of B cells (CD45+CD19+) in the spleen tissue of homozygous mice.

[0022] Figure 33 The study showed that Lambda-type B cells were missing in the spleen tissue of homozygous mice.

[0023] Figure 34 This shows the frequencies of the four human light chain V genes in bigenic homozygous mice.

[0024] Figure 35 and Figure 36This indicates whether the antibody sequence of homozygous bigenic mice has mutated and the location of the mutation.

[0025] Figure 37 and Figure 38 This invention demonstrates the detection of serum titers after immunizing homozygous mice with two genes according to embodiments of the present invention. Detailed Implementation

[0026] Definitions

[0027] In this invention, "hIgKV" refers to region V of the human (h) immunoglobulin Kappa light chain variable region locus. When used alone, it refers to the entire region V of the human immunoglobulin Kappa light chain variable region locus. When it is suffixed with a specific gene number, such as "hIgKV1-39", it indicates genes 1-39 located in region V of the human immunoglobulin Kappa light chain variable region locus. Similarly, this invention also uses "hIgKJ" to refer to region J of the human immunoglobulin Kappa light chain variable region locus. The human immunoglobulin Kappa light chain locus is located on human chromosome 2 (position 2p11.2), and its orientation and arrangement can be determined by the IMGT Repertoire (IGand TR). Replication is as follows: Figure 1 As shown, the gene sequences and the connection sequences between genes can be obtained from NCBI reference sequence number NC_000002.12. The term "Vk+ encoding" is used equivalently to "IgKV+ encoding" in this invention. The term "Jk+ encoding" is used equivalently to "IgKJ+ encoding" in this invention.

[0028] In this invention, "mIgKV" refers to region V of the mouse (m) immunoglobulin Kappa light chain variable region locus. When used alone, it refers to the entire region V of the mouse immunoglobulin Kappa light chain variable region locus. When it is suffixed with a specific gene number, such as "mIgKV2-137", it indicates the 2-137 gene located in region V of the mouse immunoglobulin Kappa light chain variable region locus. Similarly, this invention also uses "mIgKJ" to refer to region J of the mouse immunoglobulin Kappa light chain variable region locus; and "mIgKC" to refer to the mouse immunoglobulin Kappa light chain constant region locus. The mouse immunoglobulin Kappa light chain locus is located on mouse chromosome 6 (position 6C1), and its orientation and arrangement can be determined by the IMGT Repertoire (IG and TR). Replication is as follows: Figure 2 As shown, the gene sequences and the connection sequences between genes can be obtained from NCBI reference sequence number NC_000072.7.

[0029] A “continuous segment” refers to a non-discontinuous nucleotide sequence between two specified endpoint genes, which includes functional genes, pseudogenes, ORFs, and other nucleotide sequences (e.g., spacer sequences) located between the two endpoint genes. The term “continuous segment from A to B” refers to a continuous gene segment including A, B, and the segment in between.

[0030] "Operationally linked" includes juxtaposing two or more components (e.g., V and C genes) so that each component functions normally. For example, the operative linking of one or more genes of hIgKV to one gene of hIgKJ to the mIgKC region means that when these components are linked, they can each perform their natural functions, including rearrangements to form diverse antibody light chain variable regions.

[0031] “hIgKV1-39” is the human immunoglobulin Kappa light chain gene at locus V, region 1-39, Gene ID: 28930, NCBI reference sequence number NC_000002.12:c89320099-89319625, 522 bp, and its gene sequence is shown in SEQ ID NO. 60. The nucleotide sequence of the gene fragment containing hIgKV1-39 and its upstream 3 kb and downstream 500 bp is shown in SEQ ID NO. 1.

[0032] “hIgKV1-33” is the human immunoglobulin Kappa light chain gene at locus V, region 1-33, Gene ID: 28933, NCBI reference sequence number NC_000002.12:c89268475-89268001, 475 bp, and its gene sequence is shown in SEQ ID NO. 61. The nucleotide sequence of the gene fragment containing hIgKV1-33 and its upstream 3 kb and downstream 500 bp is shown in SEQ ID NO. 5.

[0033] “hIgKV2-28” is the human immunoglobulin Kappa light chain gene at locus V, region 2-28, Gene ID: 28921, NCBI reference sequence number NC_000002.12:c89222431-89221698, 734 bp, and its gene sequence is shown in SEQ ID NO. 62. The nucleotide sequence of the gene fragment containing hIgKV2-28 and its upstream 3 kb and downstream 500 bp is shown in SEQ ID NO. 2.

[0034] “hIgKV2-30” is the human immunoglobulin Kappa light chain gene at locus V, region 2-30, Gene ID: 28919, NCBI reference sequence number NC_000002.12:c89245566-89244781, 786 bp, and its gene sequence is shown in SEQ ID NO. 63. The nucleotide sequence containing hIgKV2-30 and its upstream 3 kb and downstream 500 bp gene fragments is shown in SEQ ID NO. 6.

[0035] “hIgKV3-20” is the human immunoglobulin Kappa light chain gene at locus V, region 3-20, Gene ID: 28912, NCBI reference sequence number NC_000002.12:c89143108-89142574, 535 bp, and its gene sequence is shown in SEQ ID NO. 64. The nucleotide sequence containing hIgKV3-20 and its upstream 3 kb and downstream 500 bp gene fragments is shown in SEQ ID NO. 3.

[0036] “hIgKV3-15” is the human immunoglobulin Kappa light chain gene at locus V, region 3-15, Gene ID: 28913, NCBI reference sequence number NC_000002.12:c89085690-89085177, 514 bp, and its gene sequence is shown in SEQ ID NO. 65. The nucleotide sequence containing hIgKV3-15 and its upstream 3 kb and downstream 500 bp gene fragments is shown in SEQ ID NO. 7.

[0037] “hIgKV3-11” is the human immunoglobulin Kappa light chain gene at locus V, region 3-11, Gene ID: 28914, NCBI reference sequence number NC_000002.12:c89027684-89027171, 514 bp, and its gene sequence is shown in SEQ ID NO. 66. The nucleotide sequence containing hIgKV3-11 and its upstream 3 kb and downstream 500 bp gene fragments is shown in SEQ ID NO. 8.

[0038] “hIgKV4-1” is the human immunoglobulin Kappa light chain gene at locus V region 4-1, GeneID: 28908, with NCBI reference sequence number NC_000002.12:88885572-88886153, 582 bp, and its gene sequence is shown in SEQ ID NO. 67. The nucleotide sequence containing hIgKV4-1 and its upstream 3 kb and downstream 500 bp gene fragments is shown in SEQ ID NO. 4.

[0039] “hIgKJ1” is the J1 gene at the J locus of the human immunoglobulin Kappa light chain, Gene ID: 28950, with NCBI reference sequence number NC_000002.12:c88861923-88861886, 38 bp in length, and its gene sequence is shown in SEQ ID NO. 68. The nucleotide sequence containing hIgKJ1 and its upstream 500 bp and downstream 272 bp gene fragments is shown in SEQ ID NO. 9.

[0040] “hIgKJ2” is the J2 gene at the J locus of the human immunoglobulin Kappa light chain, Gene ID: 28949, NCBI reference sequence number NC_000002.12:c88861563-88861525, 39bp, and the gene sequence is shown in SEQ ID NO. 69.

[0041] “hIgKJ3” is the J3 gene in the J region of the human immunoglobulin Kappa light chain locus, Gene ID: 28948, its NCBI reference sequence number NC_000002.12:c88861258-88861221, 38bp, and the gene sequence is shown in SEQ ID NO. 70.

[0042] “hIgKJ4” is the J4 gene in the J region of the human immunoglobulin Kappa light chain locus, Gene ID: 28947, NCBI reference sequence number NC_000002.12:c88860923-88860886, 38bp, and the gene sequence is shown in SEQ ID NO. 71.

[0043] “hIgKJ5” is the J5 gene in the J region of the human immunoglobulin Kappa light chain locus, Gene ID: 28946, NCBI reference sequence number NC_000002.12:c88860605-88860568, 38bp, and the gene sequence is shown in SEQ ID NO. 72.

[0044] Methods for preparing genetically modified rodents and their genomes

[0045] A first aspect of the present invention provides a method for preparing a genetically modified rodent, the method comprising (i) knocking out a continuous segment from the endogenous V region to the J region of an immunoglobulin Kappa light chain gene locus of the rodent; and (ii) introducing a human immunoglobulin Kappa light chain gene segment into the immunoglobulin Kappa light chain gene locus of the rodent, which is operatively linked to an endogenous constant region of the immunoglobulin Kappa light chain gene locus of the rodent; wherein the human immunoglobulin Kappa light chain gene segment comprises only four human immunoglobulins. The four human immunoglobulin Kappa light chain V genes and only one human immunoglobulin Kappa light chain J gene are selected from: hIgKV1-39, hIgKV1-33, hIgKV2-28, hIgKV2-30, hIgKV3-20, hIgKV3-15, hIgKV3-11 and hIgKV4-1; and the human immunoglobulin Kappa light chain J gene is selected from: hIgKJ1, hIgKJ2, hIgKJ3, hIgKJ4 and hIgKJ5.

[0046] A second aspect of the present invention provides a genetically modified rodent genome, wherein the immunoglobulin Kappa light chain locus of the genetically modified rodent genome does not contain a continuous segment from region V to region J of the rodent's endogenous immunoglobulin Kappa light chain locus; and the immunoglobulin Kappa light chain locus of the rodent genome includes a human immunoglobulin Kappa light chain gene segment operatively linked to the endogenous constant region of the rodent's immunoglobulin Kappa light chain locus; wherein the human immunoglobulin Kappa light chain gene segment includes only Four human immunoglobulin Kappa light chain V genes and only one human immunoglobulin Kappa light chain J gene; wherein the four human immunoglobulin Kappa light chain V genes are selected from: hIgKV1-39, hIgKV1-33, hIgKV2-28, hIgKV2-30, hIgKV3-20, hIgKV3-15, hIgKV3-11 and hIgKV4-1; and wherein the human immunoglobulin Kappa light chain J gene is selected from: hIgKJ1, hIgKJ2, hIgKJ3, hIgKJ4 and hIgKJ5.

[0047] In some embodiments of any aspect, the four human immunoglobulin Kappa light chain V genes are: one of hIgKV1-39 and hIgKV1-33; one of hIgKV2-28 and hIgKV2-30; one of hIgKV3-20, hIgKV3-15 and hIgKV3-11; and hIgKV4-1.

[0048] In some embodiments of any aspect, the four human immunoglobulin Kappa light chain V genes are: one of hIgKV1-39 and hIgKV1-33; one of hIgKV2-28 and hIgKV2-30; one of hIgKV3-20 and hIgKV3-15; and one of hIgKV4-1 and hIgKV3-11.

[0049] For example, the four human immunoglobulin Kappa light chain V genes are: hIgKV1-39, hIgKV2-28, hIgKV3-20, and hIgKV4-1.

[0050] For example, the four human immunoglobulin Kappa light chain V genes are: hIgKV1-33, hIgKV2-30, hIgKV3-15, and hIgKV3-11.

[0051] For example, the four human immunoglobulin Kappa light chain V genes are: hIgKV1-39, hIgKV2-30, hIgKV3-20, and hIgKV4-1.

[0052] For example, the four human immunoglobulin Kappa light chain V genes are: hIgKV1-39, hIgKV2-28, hIgKV3-15, and hIgKV4-1.

[0053] For example, the four human immunoglobulin Kappa light chain V genes are: hIgKV1-39, hIgKV2-28, hIgKV3-11, and hIgKV4-1.

[0054] For example, the four human immunoglobulin Kappa light chain V genes are: hIgKV1-39, hIgKV2-30, hIgKV3-15, and hIgKV4-1.

[0055] For example, the four human immunoglobulin Kappa light chain V genes are: hIgKV1-39, hIgKV2-30, hIgKV3-11, and hIgKV4-1.

[0056] For example, the four human immunoglobulin Kappa light chain V genes are: hIgKV1-33, hIgKV2-28, hIgKV3-15, and hIgKV3-11.

[0057] For example, the four human immunoglobulin Kappa light chain V genes are: hIgKV1-33, hIgKV2-28, hIgKV3-20, and hIgKV3-11.

[0058] For example, the four human immunoglobulin Kappa light chain V genes are: hIgKV1-33, hIgKV2-30, hIgKV3-15, and hIgKV3-11.

[0059] For example, the four human immunoglobulin Kappa light chain V genes are: hIgKV1-33, hIgKV2-28, hIgKV3-15, and hIgKV4-1.

[0060] For example, the four human immunoglobulin Kappa light chain V genes are: hIgKV1-33, hIgKV2-28, hIgKV3-11, and hIgKV4-1.

[0061] For example, the four human immunoglobulin Kappa light chain V genes are: hIgKV1-33, hIgKV2-30, hIgKV3-15, and hIgKV4-1.

[0062] For example, the four human immunoglobulin Kappa light chain V genes are: hIgKV1-33, hIgKV2-30, hIgKV3-11, and hIgKV4-1.

[0063] In some embodiments of any aspect, for the embodiments of the four human immunoglobulin Kappa light chain V genes described and exemplified above, the human immunoglobulin Kappa light chain J gene is hIgKJ1. In some embodiments of any aspect, for the embodiments of the four human immunoglobulin Kappa light chain V genes described and exemplified above, the human immunoglobulin Kappa light chain J gene is hIgKJ2. In some embodiments of any aspect, for the embodiments of the four human immunoglobulin Kappa light chain V genes described and exemplified above, the human immunoglobulin Kappa light chain J gene is hIgKJ3. In some embodiments of any aspect, for the embodiments of the four human immunoglobulin Kappa light chain V genes described and exemplified above, the human immunoglobulin Kappa light chain J gene is hIgKJ4. In some embodiments of any aspect, for the implementation of the four human immunoglobulin Kappa light chain V genes described and exemplified above, the human immunoglobulin Kappa light chain J gene is hIgKJ5.

[0064] For example, in some embodiments of any aspect, the four human immunoglobulin Kappa light chain V genes are: one of hIgKV1-39 and hIgKV1-33; one of hIgKV2-28 and hIgKV2-30; one of hIgKV3-20, hIgKV3-15 and hIgKV3-11; and hIgKV4-1; and the human immunoglobulin Kappa light chain J gene is hIgKJ1.

[0065] For example, in some embodiments of any aspect, the four human immunoglobulin Kappa light chain V genes are: one of hIgKV1-39 and hIgKV1-33; one of hIgKV2-28 and hIgKV2-30; one of hIgKV3-20 and hIgKV3-15; and one of hIgKV4-1 and hIgKV3-11; and the human immunoglobulin Kappa light chain J gene is hIgKJ1.

[0066] For example, in some embodiments of any aspect, the four human immunoglobulin Kappa light chain V genes are: hIgKV1-39, hIgKV2-28, hIgKV3-20, and hIgKV4-1; and the human immunoglobulin Kappa light chain J gene is hIgKJ1.

[0067] For example, in some embodiments of any aspect, the four human immunoglobulin Kappa light chain V genes are: hIgKV1-33, hIgKV2-30, hIgKV3-15, and hIgKV3-11; and the human immunoglobulin Kappa light chain J gene is hIgKJ1.

[0068] The permutations and combinations of the other four human immunoglobulin Kappa light chain V genes and the human immunoglobulin Kappa light chain J gene can be derived similarly from the above description, and will not be repeated for the sake of brevity.

[0069] In this invention, the four human immunoglobulin Kappa light chain V genes can be linked together in any order. In some embodiments, the four human immunoglobulin Kappa light chain V genes are linked sequentially in the cited order.

[0070] In some embodiments of any aspect, the human immunoglobulin Kappa light chain J gene is downstream of and directly linked to the most downstream of the four human immunoglobulin Kappa light chain V genes.

[0071] In some embodiments of any aspect, the linking order of the human immunoglobulin Kappa light chain gene segments is: hIgKV1-39, hIgKV2-28, hIgKV3-20, hIgKV4-1, hIgKJ1.

[0072] In some embodiments, the linking sequence of the human immunoglobulin Kappa light chain gene segments is: hIgKV1-33, hIgKV2-30, hIgKV3-15, hIgKV3-11, hIgKJ1.

[0073] In some embodiments of any aspect, the four human immunoglobulin Kappa light chain V genes are linked by upstream and downstream naturally adjacent sequences of adjacent genes. In some embodiments, the four human immunoglobulin Kappa light chain V genes do not contain rodent endogenous gene fragments.

[0074] In some embodiments of any aspect, the upstream natural adjacent sequence of the immunoglobulin Kappa light chain V gene for each person is 500 bp to 3 kb upstream of the corresponding gene, preferably 1 kb to 3 kb, more preferably 2 kb to 3 kb.

[0075] In some embodiments of any aspect, the downstream natural adjacent sequence of the immunoglobulin Kappa light chain V gene for each person is 50 bp to 500 bp downstream of the corresponding gene; preferably 100 bp to 500 bp, more preferably 200 bp to 500 bp.

[0076] In some embodiments of any aspect, the human immunoglobulin Kappa light chain J gene is linked to the most downstream of the four human immunoglobulin Kappa light chain V genes via its upstream natural neighbor sequence; preferably, the upstream natural neighbor sequence of the human immunoglobulin Kappa light chain J gene is 50 bp to 500 bp upstream, more preferably 100 bp to 500 bp, and more preferably 200 bp to 500 bp.

[0077] In some embodiments of any aspect, the human immunoglobulin Kappa light chain J gene is linked with its downstream natural neighbor sequence; preferably, the downstream natural neighbor sequence of the human immunoglobulin Kappa light chain J gene is 50 bp to 280 bp downstream, more preferably 100 bp to 280 bp, and more preferably 200 bp to 280 bp.

[0078] In some embodiments of any aspect, there is no animal endogenous gene fragment between the human immunoglobulin Kappa light chain J gene and the four human immunoglobulin Kappa light chain V genes.

[0079] For example, in some embodiments of any aspect, the human immunoglobulin Kappa light chain gene segment is: [upstream natural neighbor sequence]-hIgKV1-39-[downstream natural neighbor sequence], [upstream natural neighbor sequence]-hIgKV2-28-[downstream natural neighbor sequence], [upstream natural neighbor sequence]-hIgKV3-20-[downstream natural neighbor sequence], [upstream natural neighbor sequence]-hIgKV4-1-[downstream natural neighbor sequence], [upstream natural neighbor sequence]-hIgKJ1-[downstream natural neighbor sequence]; wherein the upstream natural neighbor sequence and the downstream natural neighbor sequence have the lengths described above or preferred lengths, respectively.

[0080] For example, in some embodiments of any aspect, the human immunoglobulin Kappa light chain gene segment is: [upstream natural neighbor sequence]-hIgKV1-33-[downstream natural neighbor sequence], [upstream natural neighbor sequence]-hIgKV2-30-[downstream natural neighbor sequence], [upstream natural neighbor sequence]-hIgKV3-15-[downstream natural neighbor sequence], [upstream natural neighbor sequence]-hIgKV3-11-[downstream natural neighbor sequence], [upstream natural neighbor sequence]-hIgKJ1-[downstream natural neighbor sequence]; wherein the upstream natural neighbor sequence and the downstream natural neighbor sequence have the lengths described above or preferred lengths, respectively.

[0081] Those skilled in the art will recognize that the V and J region genes in other embodiments of the human immunoglobulin Kappa light chain gene segment described and exemplified herein can also be linked in a similar manner by upstream and downstream natural adjacent sequences of adjacent genes to form various embodiments. For the sake of simplicity, they will not be listed one by one.

[0082] In some embodiments of any aspect, the rodent may be a mouse, and thus the continuous segment of the endogenous V to J region of its immunoglobulin Kappa light chain locus refers to the continuous segment from mIgKV2-137 to mIgKJ5.

[0083] In some embodiments of any aspect, the present invention preserves or does not destroy the endogenous 5'-enhancer and 3'-enhancer of the mouse Kappa light chain genome constant region gene (mIgKC).

[0084] In some embodiments of any aspect, the rodent immunoglobulin heavy chain variable region locus is humanized. Methods for humanizing the rodent immunoglobulin heavy chain variable region locus are known in the art, including but not limited to those described in WO2013187953A1, WO2013116609A1, WO2013059230A1, WO2011072204A1, WO2013041844A2, WO2011004192A1, WO2011158009A1, or WO2013079953A1. The present invention is intended to include all such methods for modifying the heavy chain variable region genome.

[0085] Cell, tissue, animal and antibody preparation methods

[0086] A third aspect of the invention relates to a cell, tissue, organ, or rodent that comprises any of the rodent genomes described herein.

[0087] In some embodiments, the present invention provides a cell comprising any of the rodent genomes described herein, said cell being an embryonic cell, a B cell, or a hybridoma cell.

[0088] In some embodiments, the present invention provides a tissue comprising any of the rodent genomes described herein, said tissue being the white pulp of the spleen or its lymphoid nodules.

[0089] In some embodiments, the present invention provides an organ comprising any of the rodent genomes described herein, wherein the organ is the spleen.

[0090] In some embodiments, the present invention provides a rodent genome comprising any of the rodent genomes described herein, wherein the rodent is a mouse.

[0091] A fourth aspect of the present invention provides a method for preparing monoclonal antibodies, comprising:

[0092] (a) Immunizing rodents with any of the genomes described in this invention using an antigen;

[0093] (b) Isolating cells from the rodent containing monoclonal antibodies against the antigen; and

[0094] (c) Culture the cells to obtain the monoclonal antibody.

[0095] In some embodiments, the cells described in step (c) are spleen cells, B cells, or hybridoma cells.

[0096] In some embodiments, the method further includes

[0097] (d) Identify the monoclonal antibody having the same light chain.

[0098] In some embodiments, the monoclonal antibody is a multispecific antibody; preferably a bispecific antibody.

[0099] In some embodiments, the monoclonal antibody has a human heavy chain variable region, a human Kappa light chain variable region, a mouse heavy chain constant region, and a mouse Kappa light chain constant region. In some embodiments, the monoclonal antibody does not have a mouse heavy chain variable region and a mouse Kappa light chain variable region.

[0100] A fifth aspect of the invention provides the use of any of the cells, tissues, organs, or rodents of the invention in the preparation of monoclonal antibodies. In some embodiments, the monoclonal antibody is a multispecific antibody; preferably a bispecific antibody. In some embodiments, the monoclonal antibody has a human heavy chain variable region, a human Kappa light chain variable region, a mouse heavy chain constant region, and a mouse Kappa light chain constant region. In some embodiments, the monoclonal antibody does not have a mouse heavy chain variable region and a mouse Kappa light chain variable region.

[0101] This invention constructs eight genes—hIgKV1-39, hIgKV1-33, hIgKV2-28, hIgKV2-30, hIgKV3-20, hIgKV3-15, hIgKV3-11, and hIgKV4-1—that are most frequently used in VH and VL pairings into two models. This allows for faster construction, achieving results within one year, while still covering most antibody screening needs. This invention can be used in common light chain model applications, eliminating the need to immunize multiple models during antigen immunization, and generating antibodies in the same mouse while maintaining light chain diversity within the same mouse.

[0102] sequence list

[0103] Example 1. Construction of a four-gene mouse model 1

[0104] The mouse Vk2-137 to Igkj5 region was replaced with human-derived genes: Vk1-39, Vk2-28, Vk3-20, Vk4-1, and IgKJ1. The strategy diagram is shown below. Figure 3 As shown.

[0105] KI (knock-in) sequence: Four different Vk genes (from upstream 3kb to downstream 500bp gene fragments, synthesized through gene synthesis, sequences shown in SEQ ID NO.1 to 4) and one Jk gene (from upstream 500bp to downstream 272bp, sequence shown in SEQ ID NO.9) were synthesized. The entire KI sequence is approximately 17kb in length.

[0106] Homologous arm sequences: The 5' arm and 3' arm homologous arms were amplified from the C57BL / 6 mouse genome using two pairs of primers. The amplification primers and amplification conditions are shown below.

[0107] 5F (SEQ ID NO.10):

[0108] atctagctgtcgcgaagagtggcgcgccatggagtccagagcttcatcc

[0109] 5R (SEQ ID NO.11):

[0110] AACCTCGAGATTCATATGGTTAACTTTAAATAATTGGCATTATTTAAAGTTAAGCCCGGAAAAGAGCAATGAAG

[0111] 3F (SEQ ID NO.12):

[0112] ttagtagcgtcgcacgtgaagtttaaacgtgcgatcgctagcgtggtcttctagacgtt

[0113] 3R (SEQ ID NO.13):

[0114] AAGGGAACAAAAGCTGGTACGCGGCCGCGCTTCAGACAGAGATTC AGACC

[0115] The 5' arm homologous arm was amplified using 5F / 5R, and the 3' arm homologous arm sequence was amplified using 3F / 3R. Finally, the four Vk genes, one Jk gene, Neo (SEQ ID NO.14), and the 5' arm and 3' arm homologous arm sequences were ligated into the pUC57 backbone via infusion to obtain the vector plasmid. The plasmid map is shown below. Figure 5 As shown.

[0116] The vector was electroporated into wild-type ES cells, and different clones were obtained through cell culture and Neo resistance selection. The clones were then selected for culture and sent for PCR genotyping to obtain the final correct positive clones.

[0117] Cell clones selected using four primer pairs were subjected to PCR amplification to identify regions such as... Figure 7 As shown, a total of 17 clones, 2F9-1C1, 2F9-1D1, 2F9-1A2, 2F9-1E2, 2F9-1C3, 2F9-1H3, 2F9-1A5, 2F9-1G5, 2F9-1A6, 2F9-1H7, 2F9-1A10, 2F9-1C10, 2F9-1D10, 2F9-1H10, 2F9-1E11, 2F9-1F11, and 2F9-1B12, were confirmed as positive clones.

[0118] PCR identification primers:

[0119] F1(SEQ ID NO.15):5'-GCAAGCAAGATTCAGTCATTGGGTGAG-3'

[0120] R1(SEQ ID NO.16):5'-CCTACAGATAAGGAACAATGGGGCCA-3'

[0121] Expected PCR Product:

[0122] Wildtype:NA

[0123] Targeted: 2227bp

[0124] See results Figure 8 .

[0125] PCR identification primers:

[0126] 1F2(SEQ ID NO.17):5'-TGTCTGCCTGTTGACTGTATCTAA-3'

[0127] 1R2(SEQ ID NO.18):5'-CGGAACCCTTCGAAGTTCCTATTCT-3'

[0128] Expected PCR Product:

[0129] Wildtype:NA

[0130] Targeted: 231bp

[0131] See results Figure 9 .

[0132] PCR identification primers:

[0133] 1F3(SEQ ID NO.19):5'-GCTAGCTTGGCTGGACGTA-3'

[0134] 1R3(SEQ ID NO.20):5'-GATGTGCTCTTGCCCTCGAA-3'

[0135] Expected PCR Product:

[0136] Wildtype:NA

[0137] Targeted: 356bp

[0138] See results Figure 10 .

[0139] PCR identification primers:

[0140] 1F4(SEQ ID NO.21):5'-TACAAGTCCACCTGAGGAGTCT-3'

[0141] 1R4(SEQ ID NO.22):5'-TGGTTTAGCATTCGCTCTGCT-3'

[0142] Expected PCR Product:

[0143] Wildtype:NA

[0144] Targeted: 291bp

[0145] See results Figure 11 .

[0146] 2F9-1A5 positive cell clones were transplanted into albino B6 surrogate mice. F0 mice were born 19-21 days later. The F0 mice had black fur and 100% chimerism, confirming them as positive F0 mice. The F0 mice were raised to sexual maturity and then bred with wild-type mice to produce F1 generation offspring. When the F1 generation mice were 5-7 days old, their claws were clipped and PCR identification was performed to obtain positive F1 mice.

[0147] like Figure 12 As shown, PCR amplification was performed on seven F1 mice using eight pairs of primers, confirming that four mice (89#, 92#, 93#, and 95#) were heterozygous. NGS sequencing of the F1 mice confirmed that the human sequence had rearranged within the mice. Simultaneously, male and female F1 mice were mated to obtain the Fn generation, which was then identified by PCR, confirming the birth of homozygous mice. The homozygous mice were immunized, confirming the production of antibody sequences after antigen immunization.

[0148] Primers for KI1 PCR:

[0149] M1F2(SEQ ID NO.29):5'-TACAAGTCCACCTGAGGAGTCT-3'

[0150] M1R2(SEQ ID NO.30):5'-TGGTTTAGCATTCGCTCTGCT-3'

[0151] Internal control PCR primer A1(SEQ ID NO.31):

[0152] 5'-CTATCAGGGATACTCCTCTTTGCC-3'

[0153] Internal control PCR primer A2 (SEQ ID NO.32):

[0154] 5'-GATACAGGAATGACAAGCTCATGGT-3'

[0155] Expected PCR Product:

[0156] Wildtype:NA

[0157] Targeted: 291bp

[0158] Internal control product size:507bp

[0159] See results Figure 13 .

[0160] Primers for KI2 PCR:

[0161] M1F3(SEQ ID NO.33): 5’-AGTCCCACATGTTAAGGCCC-3’

[0162] M1R3(SEQ ID NO.34): 5’-ACTGAGTTGCTCCATGGTGA-3’

[0163] Internal control PCR primer A3(SEQ ID NO.35):

[0164] 5’-CATGCCAATGGTTCACTCTAAGGT-3’

[0165] Internal control PCR primer A4(SEQ ID NO.36):

[0166] 5’-TCTCTATGTCCCAAAGTGCAGACAC-3’

[0167] Expected PCR Product:

[0168] Wildtype: N.A.

[0169] Targeted: 504bp

[0170] Internal control product size: 335bp

[0171] The results are shown in Figure 14 。

[0172] Primers for KI3 PCR:

[0173] M1F4(SEQ ID NO.37): 5’-GCACAGTTTCACAGTAATGGC-3’

[0174] M1R4(SEQ ID NO.38): 5’-GCATCGCTTTGGTCTGGAAA-3’

[0175] Internal control PCR primer A3(SEQ ID NO.35):

[0176] ​​

[0177] Internal control PCR primer A4(SEQ ID NO.36):

[0178] 5’-TCTCTATGTCCCAAAGTGCAGACAC-3’

[0179] Expected PCR Product:

[0180] Wildtype:N.A.

[0181] Targeted:510bp

[0182] Internal control product size:335bp

[0183] The results are shown in Figure 15 .

[0184] Primers for KI4 PCR:

[0185] M1F5(SEQ ID NO.39):5’-ACACATCACATGACCGAGCC-3’

[0186] M1R5(SEQ ID NO.40):5’-ACGTCTATGGCCTGATGGTTC-3’

[0187] Internal control PCR primer A3(SEQ ID NO.35):

[0188] 5’-CATGCCAATGGTTCACTCTAAGGT-3’

[0189] Internal control PCR primer A4(SEQ ID NO.36):

[0190] 5’-TCTCTATGTCCCAAAGTGCAGACAC-3’

[0191] Expected PCR Product:

[0192] Wildtype:N.A.

[0193] Targeted:514bp

[0194] Internal control product size:335bp

[0195] The results are shown in Figure 16 .

[0196] Primers for KI5 PCR:

[0197] M1F6(SEQ ID NO.41): 5’-CAAGCAAGATTCAGTCATTGGGTG-3’

[0198] M1R6(SEQ ID NO.42): 5’-GCTGTTTCATCCTCTGGGTCATTC-3’

[0199] Internal control PCR primer A1(SEQ ID NO.31):

[0200] 5’-CTATCAGGGATACTCCTCTTTGCC-3’

[0201] Internal control PCR primer A2(SEQ ID NO.32):

[0202] 5’-GATACAGGAATGACAAGCTCATGGT-3’

[0203] Expected PCR Product:

[0204] Wildtype: N.A.

[0205] Targeted: 257bp

[0206] Internal control product size: 507bp

[0207] The results are shown in Figure 17 .

[0208] Primers for Neo-del PCR:

[0209] M1F1(SEQ ID NO.43): 5’-TGTCTGCCTGTTGACTGTATCTAA-3’

[0210] ​​​​​​5’-GCAGAAGAGGACAGATACATTCAT-3’

[0213] Internal control PCR primer A6(SEQ ID NO.46):

[0214] 5’-CCTACTGAAGAATCTATCCCACAG-3’

[0215] Expected PCR Product:

[0216] Wildtype:N.A.

[0217] Targeted:378bp

[0218] Internal control product size:689bp

[0219] Results are shown in Figure 18 .

[0220] Primers for wildtype PCR:

[0221] M1F1(SEQ ID NO.43):5’-TGTCTGCCTGTTGACTGTATCTAA-3’

[0222] M1R7(SEQ ID NO.47):5’-GACCCCAATGAAGGAAACTAAATGG-3’

[0223] Internal control PCR primer A1(SEQ ID NO.31):

[0224] 5’-CTATCAGGGATACTCCTCTTTGCC-3’

[0225] Internal control PCR primer A2(SEQ ID NO.32):

[0226] 5’-GATACAGGAATGACAAGCTCATGGT-3’

[0227] Expected PCR Product:

[0228] Wildtype:217bp

[0229] Targeted:N.A.​​Internal control product size:507bp

[0231] See results Figure 19 .

[0232] Example 2. Construction of a four-gene mouse model 2

[0233] The mouse Vk2-137 to Igkj5 region was replaced with human-derived genes: Vk1-33, Vk2-30, Vk3-15, Vk3-11, and IgKJ1. The strategy diagram is shown below. Figure 4 As shown.

[0234] KI (knock-in) sequence: Four different Vk genes (from upstream 3kb to downstream 500bp gene fragments, synthesized through gene synthesis, sequences shown in SEQ ID NO.5 to 8) and one Jk gene (from upstream 500bp to downstream 272bp, sequence shown in SEQ ID NO.9) were synthesized. The total length of the KI sequence is approximately 17kb.

[0235] Homologous arm sequences: The 5' arm and 3' arm homologous arms were amplified from the C57BL / 6 mouse genome using two pairs of primers. The amplification primers and amplification conditions are shown below.

[0236] 5F (SEQ ID NO.10):

[0237] atctagctgtcgcgaagagtggcgcgccatggagtccagagcttcatcc

[0238] 5R (SEQ ID NO.11):

[0239] AACCTCGAGATTCATATGGTTAACTTTAAATAATTGGCATTATTTAAAGTTAAGCCCGGAAAAGAGCAATGAAG

[0240] 3F (SEQ ID NO.12):

[0241] ttagtagcgtcgcacgtgaagtttaaacgtgcgatcgctagcgtggtcttctagacgtt

[0242] 3R (SEQ ID NO.13):

[0243] AAGGGAACAAAAGCTGGTACGCGGCCGCGCTTCAGACAGAGATTC AGACC

[0244] The 5' arm homologous arm was amplified using 5F / 5R, and the 3' arm homologous arm sequence was amplified using 3F / 3R. Finally, the four Vk genes, one Jk gene, and the Neo, 5' arm, and 3' arm homologous arm sequences were ligated into the pUC57 backbone via infusion to obtain the vector plasmid. The plasmid map is shown below. Figure 6 As shown.

[0245] Cell clones selected using four primer pairs were subjected to PCR amplification to identify their locations, as shown in the figure. Figure 20 As shown, a total of 16 clones, namely 1H9-1C1, 1H9-1G1, 1H9-1H1, 1H9-1F2, 1H9-1G2, 1H9-1B3, 1H9-1C3, 1H9-1C4, 1H9-1C5, 1H9-1B6, 1H9-1E7, 1H9-1A8, 1H9-1E8, 1H9-1B9, 1H9-1C9, and 1H9-1E9, were confirmed as positive clones.

[0246] PCR identification primers:

[0247] F1(SEQ ID NO.15):5'-GCAAGCAAGATTCAGTCATTGGGTGAG-3'

[0248] R1(SEQ ID NO.16):5'-CCTACAGATAAGGAACAATGGGGCCA-3'

[0249] Expected PCR Product:

[0250] Wildtype:NA

[0251] Targeted: 2517bp

[0252] See results Figure 21 .

[0253] PCR identification primers:

[0254] 2F2(SEQ ID NO.23):5'-TTTGGCATATTGTTCAGAGGACA-3'

[0255] 2R2(SEQ ID NO.24):5'-GTCCAACAAGAGGGAAAGAGACTG-3'

[0256] Expected PCR Product:

[0257] Wildtype:NA

[0258] Targeted: 631bp

[0259] See results Figure 22 .

[0260] PCR identification primers:

[0261] 2F3(SEQ ID NO.25):5'-AGGGCTTGAGTTGCAGAATTG-3'

[0262] 2R3(SEQ ID NO.26):5'-CGGAACCCTTCGAAGTTCCTATT-3'

[0263] Expected PCR Product:

[0264] Wildtype:NA

[0265] Targeted: 331bp

[0266] See results Figure 23 .

[0267] PCR identification primers:

[0268] 2F4(SEQ ID NO.27):5'-TGGCTGGACGTAAACTCCTCTTC-3'

[0269] 2R4(SEQ ID NO.28):5'-TGGAGCCATATGGGATCTCCT-3'

[0270] Expected PCR Product:

[0271] Wildtype:NA

[0272] Targeted: 253bp

[0273] See results Figure 24 .

[0274] The 1H9-1A8 clone was transplanted into albino B6 surrogate mice. F0 mice were born 19-21 days later. These F0 mice had black fur and 100% chimerism, confirming them as positive F0 mice. The F0 mice were raised to sexual maturity and then bred with wild-type mice to produce F1 generation offspring. At 5-7 days of age, the paws of the F1 mice were clipped for PCR identification, yielding positive F1 mice.

[0275] like Figure 25As shown, PCR amplification was performed on 15 F1 mice using 6 pairs of primers, confirming that 7 mice (38#, 40#, 44#, 49#, 50#, 51#, and 52#) were heterozygous. NGS sequencing of the F1 mice confirmed that the human sequence had rearranged in the mice. Simultaneously, male and female F1 mice were mated to obtain the Fn generation, which was then identified by PCR, confirming the birth of homozygous mice. The homozygous mice were immunized, confirming the production of antibody sequences after antigen immunization.

[0276] Primers for KI1 PCR:

[0277] M2F3(SEQ ID NO.48):5'-AAGGCCCACTTCATCGTAGC-3'

[0278] M2R3(SEQ ID NO.49):5'-TCCACAGTCTTGTGCTGGAC-3'

[0279] Internal control PCR primer A3(SEQ ID NO.35):

[0280] 5'-CATGCCAATGGTTCACTCTAAGGT-3'

[0281] Internal control PCR primer A4(SEQ ID NO.36):

[0282] 5'-TCTCTATGTCCCAAAGTGCAGACAC-3'

[0283] Expected PCR Product:

[0284] Wildtype:NA

[0285] Targeted: 585bp

[0286] Internal control product size:335bp

[0287] See results Figure 26 .

[0288] Primers for KI2 PCR:

[0289] M2F4(SEQ ID NO.50):5'-TTTGGCATATTGTTCAGAGGACA-3'

[0290] M2R4 (SEQ ID NO.51): 5’-GTCCAACAAGAGGGAAAGAGACTG-3’

[0291] Internal control PCR primer A3 (SEQ ID NO.35):

[0292] 5’-CATGCCAATGGTTCACTCTAAGGT-3’

[0293] Internal control PCR primer A4 (SEQ ID NO.36):

[0294] 5’-TCTCTATGTCCCAAAGTGCAGACAC-3’

[0295] Expected PCR Product:

[0296] Wildtype: N.A.

[0297] Targeted: 631bp

[0298] Internal control product size: 335bp

[0299] The results are shown in Figure 27 .

[0300] Primers for KI3 PCR:

[0301] M2F5 (SEQ ID NO.52): 5’-ACGCATTTCAGAAGGCATCTC-3’

[0302] M2R5 (SEQ ID NO.53): 5’-CATGAGCCATACTACCACCAAGA-3’

[0303] Internal control PCR primer A5 (SEQ ID NO.45):

[0304] 5’-GCAGAAGAGGACAGATACATTCAT-3’

[0305] Internal control PCR primer A6 (SEQ ID NO.46): <00>00703>5’-CCTACTGAAGAATCTATCCCACAG-3’

[0307] Expected PCR Product:

[0308] Wildtype:N.A.

[0309] Targeted:445bp

[0310] Internal control product size:689bp

[0311] The result is shown in Figure 28 .

[0312] Primers for KI4 PCR:

[0313] M2F6(SEQ ID NO.54):5’-TTGCTTCCTCAGTTGTCTGTGTC-3’

[0314] M2R6(SEQ ID NO.55):5’-TTCAAAGTTTGCTCCCACATCC-3’​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​M2F2 (SEQ ID NO.56): 5’-GGCTTGAGTTGCAGAATTGTCAT-3’

[0326] M2R2 (SEQ ID NO.57): 5’-TAACTGGAGCCATATGGGATCTCT-3’

[0327] Internal control PCR primer A5 (SEQ ID NO.45):

[0328] 5’-GCAGAAGAGGACAGATACATTCAT-3’

[0329] Internal control PCR primer A6 (SEQ ID NO.46):

[0330] 5’-CCTACTGAAGAATCTATCCCACAG-3’

[0331] Expected PCR Product:

[0332] Wildtype: N.A.

[0333] Targeted: 384bp

[0334] Internal control product size: 689bp

[0335] The results are shown in Figure 30 .

[0336] Primers for wildtype PCR:

[0337] M2F1 (SEQ ID NO.58): 5’-GGGCTTGAGTTGCAGAATTGTCATC-3’

[0338] M2R1 (SEQ ID NO.59): 5’-CAGCATCAGTGGAGACACAATCTAC-3’

[0339] Internal control PCR primer A5 (SEQ ID NO.45):

[0340] 5’-GCAGAAGAGGACAGATACATTCAT-3’

[0341] Internal control PCR primer A6 (SEQ ID NO.46):

[0342] 5'-CCTACTGAAGAATCTATCCCACAG-3'

[0343] Expected PCR Product:

[0344] Wildtype: 451bp

[0345] Targeted:NA

[0346] Internal control product size:689bp

[0347] See results Figure 31 .

[0348] Example 3. Construction of homozygous mice with two genes

[0349] Kappa chain-modified mice were crossed with Lambda chain knockout mice to obtain bigenic heterozygous mice and bigenic homozygous mice. The bigenic homozygous mice were designed to express only the introduced Kappa light chain sequence in their B cells, without expressing either the mouse Kappa light chain sequence or the mouse Lambda light chain sequence.

[0350] Spleens were collected from naive mice. Cells were incubated in a solution containing blocking antibodies (such as Fc Block) to prevent non-specific binding. Fluorescently labeled antibodies were added at the concentration recommended in the antibody manufacturer's instructions. The cells were incubated on ice for 20-30 minutes, avoiding light exposure. Cells were then washed with PBS buffer to remove unbound antibodies. Laser and filter parameters were set to ensure they matched the antibody fluorescence. The stained cell samples were then loaded onto the flow cytometer, and fluorescence signals were detected according to the set parameters. Data were acquired using flow cytometry software and saved for analysis.

[0351] Representative flow cytometry immunophenotypic analysis and statistical comparison were performed on the classification of B cells. The results are as follows: Figure 32 and Figure 33 As shown. Figure 32 The results show that, compared with wild-type WT mice (right figure), the spleen tissue of the homozygous mice (mouse 1, mouse 2) showed normal development of B cells (CD45+CD19+), and the proportion of B cells was comparable to that of wild-type mice.

[0352] Figure 33 The spleen tissue of the bigenic homozygous mice (mouse 1, mouse 2) showed a lack of Lambda-type B cells (CD19+Igλ+) compared to WT mice (right figure).

[0353] Example 4. Analysis of light chain sequence diversity

[0354] Spleens were collected from naive mice, and splenic RNA was extracted. After the total RNA extracted from the samples passed the tests, a library was constructed. High-throughput sequencing technology was then used to comprehensively assess the diversity of the immune system. The sequenced sequences were quality controlled using quality control software to filter sequencing background. The sequences were then compared with the VJ gene from the IMGT immune cell receptor library to search for corresponding gene fragments, identify precise VJ gene fragments and sequence sites, and statistically analyze information such as VJ gene frequency.

[0355] The results are as follows Figure 34 As shown, the four human light chain V genes inserted in mice 1 and 2 can all be detected with corresponding antibody sequences; among them, IGKV4-1 and IGKV3-20 are the majority in mouse 1, and IGKV2-30, IGKV3-15 and IGKV3-11 are the majority in mouse 2.

[0356] Further analysis was conducted to determine whether and where the antibody sequence formed from the maternal gene had mutated. The results were as follows: Figure 35 and Figure 36 As shown, in mice 1 and 2, mutations mostly occur in the CDR3 region. Each column represents a sequence, and the height of the column indicates the proportion of that sequence in the total sequence. The columns from bottom to top represent the gradually decreasing proportion of that part of the sequence in the total sequence, that is, the bottom column represents the sequence with the highest proportion.

[0357] Example 5. Immunization and titer determination in mice.

[0358] To induce a humoral immune response against VEGF165 in four-gene light chain mice, two mice each (mouse ① x2 and mouse ② x2) were immunized, with C57B6 / N wild-type (WT) mice serving as controls. The mice were initially immunized subcutaneously with a mixture of Freund's complete adjuvant (CFA) and 0.1 mg of Human VEGF165 His protein (Baiying Biotechnology). Subsequent immunizations were performed every two weeks, for a total of four immunizations, resulting in antigen-specific antibodies in both light chain mice ① and ②.

[0359] Serum from mice after the fourth immunization was used for serum titer detection. The antigen (1 μg / ml) was coated overnight with CBS (carbonate buffer), washed with PBST (phosphate buffer), and then 1% BSA was added. The mixture was blocked at 37°C for 2 h. After washing with PBST, serum dilution buffer (1:100, 3-fold dilution, 11 gradients) was added, and the mixture was incubated at 37°C for 1 h. After washing with PBST, horseradish peroxidase-labeled goat anti-mouse secondary antibody (diluted 1:1W with PBS) was added, and the mixture was incubated at 37°C for 0.5 h. After washing with PBST, TMB chromogenic reagent (Beyotime, PO2O9-500ml) was added for color development. The reaction was incubated at 25°C for 5-10 min, and the reaction was stopped by adding stop solution. Serum titer was measured at 450 nm using optical density.

[0360] The results are as follows Figure 37 and Figure 38 As shown in the figure. The ELISA results showed that the four-gene fixed light chain bigenic homozygous mice ① and ② produced high antibody titers after the fourth immunization, with antibody titers reaching 656,100 (serum dilution factor) or higher. Among them, HUGO-L (902, 903, 906 and 908) were the four-gene fixed light chain bigenic homozygous mice, WT-C57 was the wild-type control, and negative serum was also provided as a negative control.

Claims

1. A method of making a genetically modified rodent, comprising: (i) knocking out an endogenous V-to-J segmental stretch of an immunoglobulin Kappa light chain locus of the rodent; and (ii) introducing into the immunoglobulin Kappa light chain locus of the rodent a human immunoglobulin Kappa light chain gene segment operably linked to an endogenous constant region of the immunoglobulin Kappa light chain locus of the rodent; wherein the human immunoglobulin Kappa light chain gene segment comprises only four human immunoglobulin Kappa light chain V genes and only one human immunoglobulin Kappa light chain J gene; wherein the four human immunoglobulin Kappa light chain V genes are selected from the group consisting of hlgKVl-39, hlgKVl-33, hlgKV2-28, hlgKV2-30, hlgKV3-20, hlgKV3-15, hlgKV3-11 and hlgKV4-1; and wherein the one human immunoglobulin Kappa light chain J gene is selected from the group consisting of hlgKJl, hlgKJ2, hlgKJ3, hlgKJ4 and hlgKJ5.

2. The method of claim 1, wherein the four human immunoglobulin Kappa light chain V genes are, respectively: (a) one of hlgKVl-39 and hlgKVl-33; one of hlgKV2-28 and hlgKV2-30; one of hlgKV3-20, hlgKV3-15 and hlgKV3-11; and hlgKV4-1; or (b) one of hlgKVl-39 and hlgKVl-33; one of hlgKV2-28 and hlgKV2-30; one of hlgKV3-20 and hlgKV3-15; and one of hlgKV4-1 and hlgKV3-11.

3. The method of claim 1, wherein the four human immunoglobulin Kappa light chain V genes are, respectively: (a) hlgKVl-39, hlgKV2-28, hlgKV3-20, hlgKV4-1; or (b) hlgKVl-33, hlgKV2-30, hlgKV3-15, hlgKV3-11.

4. The method of any one of claims 1 to 3, wherein the one human immunoglobulin Kappa light chain J gene is hlgKJl.

5. The method of any one of claims 1 to 4, wherein each human immunoglobulin Kappa light chain V gene is connected to an adjacent gene by an upstream and a downstream natural junction sequence of the respective genes.

6. The method of claim 5, wherein the upstream natural junction sequence of each human immunoglobulin Kappa light chain V gene is between 500 bp and 3 kb, preferably between 1 kb and 3 kb, more preferably between 2 kb and 3 kb, upstream of the respective gene.

7. The method of claim 5 or 6, wherein the downstream natural flanking sequence of each human immunoglobulin Kappa light chain V gene is 50bp to 500bp downstream of the respective gene; preferably 100bp to 500bp, more preferably 200bp to 500bp.

8. The method of any one of claims 1 to 7, wherein the one human immunoglobulin Kappa light chain J gene is linked to the most downstream one of the four human immunoglobulin Kappa light chain V genes by its upstream natural flanking sequence; preferably, the upstream natural flanking sequence of the one human immunoglobulin Kappa light chain J gene is 50bp to 500bp upstream of it, preferably 100bp to 500bp, more preferably 200bp to 500bp.

9. The method of any one of claims 1 to 8, wherein the one human immunoglobulin Kappa light chain J gene is linked to its downstream natural flanking sequence; preferably, the downstream natural flanking sequence of the one human immunoglobulin Kappa light chain J gene is 50bp to 280bp downstream of it, preferably 100bp to 280bp, more preferably 200bp to 280bp.

10. The method of any one of claims 1 to 9, wherein the rodent is a mouse, and the continuous segment of V- to J-regions of the endogenous immunoglobulin Kappa light chain of the mouse is a continuous segment of mlgKV2-137 to mlgKJ5.

11. A genetically modified rodent genome, wherein the immunoglobulin Kappa light chain locus of the genetically modified rodent genome does not contain a continuous segment of V- to J-regions of the endogenous immunoglobulin Kappa light chain locus of the rodent; and the immunoglobulin Kappa light chain locus of the rodent genome comprises human immunoglobulin Kappa light chain gene segments operably linked to the endogenous constant region of the immunoglobulin Kappa light chain locus of the rodent; wherein, the human immunoglobulin Kappa light chain gene segments comprise only four human immunoglobulin Kappa light chain V genes and only one human immunoglobulin Kappa light chain J gene; wherein the four human immunoglobulin Kappa light chain V genes are selected from the group consisting of hlgKVl-39, hlgKVl-33, hlgKV2-28, hlgKV2-30, hlgKV3-20, hlgKV3-15, hlgKV3-11, and hlgKV4-1; and wherein the one human immunoglobulin Kappa light chain J gene is selected from the group consisting of hlgKJl, hlgKJ2, hlgKJ3, hlgKJ4, and hlgKJ5.

12. The rodent genome of claim 11, wherein the four human immunoglobulin Kappa light chain V genes are, respectively: hlgKVl-39, hlgKVl-33, hlgKV2-28, hlgKV2-30, hlgKV3-20, hlgKV3-15, hlgKV3-11, and hlgKV4-1. (a) one of hlgKVl-39 and hlgKVl-33; one of hlgKV2-28 and hlgKV2-30; one of hlgKV3-20, hlgKV3-15 and hlgKV3-11; and hlgKV4-1; or (b) one of hlgKVl-39 and hlgKVl-33; one of hlgKV2-28 and hlgKV2-30; one of hlgKV3-20 and hlgKV3-15; and one of hlgKV4-1 and hlgKV3-11.

13. The rodent genome of claim 11, wherein the four human immunoglobulin kappa light chain V genes are, respectively: (a) hlgKVl-39, hlgKV2-28, hlgKV3-20, hlgKV4-1; or (b) hlgKVl-33, hlgKV2-30, hlgKV3-15, hlgKV3-11.

14. The rodent genome of any one of claims 11 to 13, wherein the one human immunoglobulin kappa light chain J gene is hlgKJl.

15. The rodent genome of any one of claims 11 to 14, wherein each human immunoglobulin kappa light chain V gene is connected to the adjacent gene by the upstream and downstream natural joining sequences of the adjacent gene.

16. The rodent genome of claim 15, wherein the upstream natural joining sequence of each human immunoglobulin kappa light chain V gene is from 500 bp to 3 kb, preferably from 1 kb to 3 kb, more preferably from 2 kb to 3 kb, upstream of the respective gene.

17. The rodent genome of claim 15 or 16, wherein the downstream natural joining sequence of each human immunoglobulin kappa light chain V gene is from 50 bp to 500 bp, preferably from 100 bp to 500 bp, more preferably from 200 bp to 500 bp, downstream of the respective gene.

18. The rodent genome of any one of claims 11 to 17, wherein the one human immunoglobulin kappa light chain J gene is connected to the most downstream of the four human immunoglobulin kappa light chain V genes by its upstream natural joining sequence; preferably, the upstream natural joining sequence of the one human immunoglobulin kappa light chain J gene is from 50 bp to 500 bp, preferably from 100 bp to 500 bp, more preferably from 200 bp to 500 bp, upstream of the one human immunoglobulin kappa light chain J gene.

19. The rodent genome of any one of claims 11 to 18, wherein the one human immunoglobulin kappa light chain J gene is connected to its downstream natural joining sequence; preferably, the downstream natural joining sequence of the one human immunoglobulin kappa light chain J gene is from 50 bp to 280 bp, preferably from 100 bp to 280 bp, more preferably from 200 bp to 280 bp, downstream of the one human immunoglobulin kappa light chain J gene.

20. The rodent genome of any one of claims 11 to 19, wherein the rodent is a mouse, and the endogenous V to J contiguous segment of the mouse is a contiguous segment of mlgKV2-137 to mlgKJ5.

21. A cell, tissue, organ or rodent comprising the rodent genome of any one of claims 11 to 20; preferably, the cell is an embryonic cell, a B cell or a hybridoma cell; preferably, the tissue is white pulp or its lymph nodule of a spleen; preferably, the organ is a spleen.

22. A method of making a monoclonal antibody, comprising: (a) immunizing a rodent having the rodent genome of any one of claims 11 to 20 with an antigen; (b) isolating from the rodent a cell producing a monoclonal antibody comprising an antibody against the antigen; and (c) culturing the cell to obtain the monoclonal antibody; preferably, the cell is a splenocyte, a B cell or a hybridoma cell.

23. The method of claim 22, wherein the method further comprises: (d) identifying the monoclonal antibodies having the same light chain.

24. The method of claim 23, wherein the monoclonal antibody is a multispecific antibody; preferably a bispecific antibody.

25. Use of the cell, tissue, organ or rodent of claim 21 in the manufacture of a monoclonal antibody; preferably, the monoclonal antibody has the same light chain; preferably, the monoclonal antibody is a multispecific antibody, preferably a bispecific antibody.

Citation Information

Patent Citations

  • Animal models and therapeutic molecules

    WO2011004192A1

  • Mice that make heavy chain antibodies

    WO2011072204A1

  • Animal models and therapeutic molecules

    WO2011158009A1

  • Antibodies, variable domains & chains tailored for human use

    WO2013041844A2

  • Restricted immunoglobulin heavy chain mice

    WO2013059230A1