KIM-1 detection kit
By designing using Taqman's RT-LAMP technology, quantitative detection of KIM-1 mRNA was achieved, overcoming the limitations and low sensitivity of existing detection methods and enabling efficient and sensitive early diagnosis of kidney diseases.
Patent Information
- Application Number
- CN202511360390.8
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-09-23
- Publication Date
- 2025-12-09
AI Technical Summary
Existing KIM-1 detection technologies have limitations in detection methods and low sensitivity. In particular, the ELISA method for detecting KIM-1 dissolved in urine lacks clinical application products, making it difficult to meet the needs of early diagnosis of kidney diseases.
Designed using TaqMan-based RT-LAMP technology, this method achieves quantitative detection of KIM-1 mRNA through an integrated reaction of reverse transcription, amplification, and real-time fluorescence detection. The reaction includes a specific primer set, TaqMan probes, a mixture of reactive enzymes and reaction buffers, along with quality control materials, to realize the integration of RNA reverse transcription, cDNA amplification, and fluorescence detection.
It achieves highly sensitive KIM-1 mRNA detection, reduces operational complexity, meets the timeliness requirements for early AKI diagnosis, and has a higher detection sensitivity than PCR, capable of detecting copy numbers 10 times lower than PCR, and amplifying templates up to 10 copies or less.
Smart Images

Figure BDA0005608874240000051 
Figure BDA0005608874240000061 
Figure BDA0005608874240000062
Abstract
Description
Technical Field
[0001] This invention relates to the field of immunoassay, specifically to a KIM-1 detection kit. Background Technology
[0002] Kidney diseases (especially acute kidney injury and kidney cancer) are a significant category of diseases threatening human health, and early diagnosis and risk prediction are crucial for treatment prognosis. Specifically:
[0003] Renal cell carcinoma accounts for approximately 2% to 3% of adult malignant tumors and 80% to 90% of adult kidney malignant tumors. The cause of renal cell carcinoma is unknown, but it is associated with genetics, smoking, obesity, hypertension, and antihypertensive treatment. Most patients are diagnosed with asymptomatic renal cell carcinoma during routine health checkups. Current diagnostic procedures require complex processes such as laboratory tests and imaging examinations, which are inefficient.
[0004] Current status of acute kidney injury (AKI): AKI is a common critical illness in clinical practice, which can be caused by drugs, toxins, shock, infection, etc., leading to a rapid decline in glomerular filtration rate in a short period of time. Moreover, the mortality rate of critically ill patients with AKI remains high. The core problem is that the current technology lacks early diagnostic biomarkers with high sensitivity and specificity, which leads to delays in treatment.
[0005] KIM-1 is a key biomarker for the aforementioned kidney diseases, and it has unique tissue expression characteristics: the human KIM-1 gene is 41kb in size, consists of 8 exons, and has an mRNA length of 1095bp, encoding a transmembrane protein of 364 amino acids; this protein is not expressed in normal kidney tissue, but only appears when kidney tissue is damaged, and it dissolves during the repair of damaged renal tubular epithelial cells, so it can serve as a specific indicator of kidney damage;
[0006] Recent research confirms that KIM-1 concentration is positively correlated with the risk of developing kidney cancer and negatively correlated with survival rate. It is the only blood marker that can distinguish between high- and low-risk groups for kidney cancer and is also a core target for the early diagnosis of AKI.
[0007] However, existing KIM-1 detection technologies have significant drawbacks: limited detection methods and a lack of kit applications. The mainstream KIM-1 detection method on the market is enzyme-linked immunosorbent assay (ELISA). Although this method is simple to operate and has a long reagent stability period, it has low detection sensitivity and is mostly based on ELISA to detect KIM-1 dissolved in urine. Moreover, it is only used for scientific research and there are no clinical application products. Summary of the Invention
[0008] The technical problem to be solved by the present invention is to overcome the above-mentioned technical defects and provide a KIM-1 detection kit based on Taqman's RT-LAMP technology design, which realizes the quantitative detection of KIM-1 mRNA through an integrated reaction of "reverse transcription-amplification-real-time fluorescence detection".
[0009] To solve the above-mentioned technical problems, the technical solution provided by the present invention is: a KIM-1 detection kit, designed based on Taqman's RT-LAMP method, comprising:
[0010] A specific primer set, including outer primers and inner primers;
[0011] TaqMan probe;
[0012] The reaction enzyme mixture includes BstDNA polymerase and AMV reverse transcriptase, both of which have strand displacement activity.
[0013] The reaction buffer includes Tris·HCl, KCl, (NH4)2SO4 and Tween 20;
[0014] Quality control materials include positive control group, negative control group and blank plasmid control group.
[0015] Preferably, the sample is a biological sample from a human or animal model, and the biological sample is selected from fresh kidney tissue, frozen kidney tissue, paraffin-embedded kidney tissue, urine, or serum.
[0016] Preferably, the outer primer includes:
[0017] F3 primer: CTTTGCCCAGGCAGAACC;
[0018] B3 primer: CCAAAGGCCATCTGAAGACT.
[0019] Preferably, the inner primer comprises:
[0020] FIP primer: CCTGCAGTGTCGTAGGGTGGCCAGTAGCCACTTCACCATC;
[0021] BIP primer: AGGAGAGAACCCACCAGCTCAGTCACGGTGTCATTCCCATC;
[0022] The Tm values of the FIP and BIP primers are higher than those of the F3 and B3 primers.
[0023] Preferably, the TaqMan probe sequence is as follows:
[0024] 5'-FAM-CATCTTCACCTCAGCCAGCAGAAA-BHQ1-3', wherein the 5' end is labeled with the FAM fluorescent reporter group and the 3' end is labeled with the BHQ1 fluorescent quencher group.
[0025] Preferably, the reaction buffer further includes betaine, MgSO4, and dNTPs;
[0026] The allocation ratio for each group is: Tris · HCl 15-25mM, KCl 8-12mM, (NH4)2SO4 8-12mM, Tween 20 volume fraction 0.08%-0.12%, betaine 0.6-1.0M, MgSO4 6-10mM, 1.4mM dNTP each.
[0027] Preferably, the positive control group is a cDNA fragment corresponding to KIM-1 mRNA between the amplification regions of primers F3 and B3, and the fragment is 156 bp in length.
[0028] The negative control group consisted of sterile water free of nucleic acids;
[0029] The blank plasmid control group is a blank vector plasmid that has not been ligated with the cDNA fragment.
[0030] The advantages of this invention compared to the prior art are:
[0031] This invention achieves an integrated reaction of "RNA reverse transcription-cDNA amplification-fluorescence detection", eliminating the need for step-by-step operations. Samples can be directly tested after processing, reducing operational complexity.
[0032] Based on RT-LAMP isothermal amplification technology, detection can be completed in 30-60 minutes, meeting the timeliness requirements for early diagnosis of AKI;
[0033] With high detection sensitivity, LAMP can detect copy numbers up to 10 times lower than the detection limit of PCR, and can amplify templates up to 10 copies or less. Detailed Implementation
[0034] The present invention will now be described in further detail.
[0035] The specific components and core design of the reagent kit are as follows:
[0036] 1. Specific primer set
[0037] To target the cDNA sequence after reverse transcription of KIM-1 mRNA and initiate the RT-LAMP reaction, the following primers, including outer and inner primers, are used, with specific sequences and design rationale as follows:
[0038] Outer primers: including F3 primers and B3 primers, used to initiate the initial stage of the amplification reaction and identify the outer regions of the target sequence;
[0039] F3 primer: nucleotide sequence is 5'-CTTTGCCCAGGCAGAACC-3';
[0040] Primer B3: Nucleotide sequence is 5'-CCAAAGGCCATCTGAAGACT-3';
[0041] Inner primers: including FIP primers and BIP primers, are the core primers for the RT-LAMP reaction. They recognize the inner region of the target sequence and can mediate the formation of a circular single-stranded structure of the target sequence, thus accelerating amplification.
[0042] FIP primers: nucleotide sequence is 5'-CCTGCAGTGTCGTAGGGTGGCCAGTAGCCACTTCACCATC-3';
[0043] BIP primer: The nucleotide sequence is 5'-AGGAGAGAACCCACCAGCTCAGTCACGGTGTCATTCCCATC-3';
[0044] Design features: The Tm value of the inner primers (FIP / BIP) is higher than that of the outer primers (F3 / B3), ensuring that the inner primers preferentially bind to the target sequence and guaranteeing amplification efficiency; all primers have been verified by BLAST sequence alignment, with no cross-reactivity, and avoid forming hairpin structures or primer dimers.
[0045] Optionally, the specific primer set may also include a circular primer (LF / LB) to target the circular single-stranded region mediated by the inner primer, further shortening the detection time (this design references the high-efficiency amplification characteristics of RT-LAMP technology and can be added depending on the detection efficiency requirements).
[0046] 2. TaqMan probe
[0047] The system is designed for real-time monitoring of RT-LAMP amplification products to achieve quantitative detection of KIM-1 mRNA.
[0048] Nucleotide sequence: 5'-FAM-CATCTTCACCTCAGCCAGCAGAAA-BHQ1-3';
[0049] Labeling characteristics: The 5' end is labeled with the FAM fluorescent reporter group, and the 3' end is labeled with the BHQ1 fluorescent quencher group; when the target sequence is not bound, the quencher group inhibits the fluorescence of the reporter group; during amplification, the probe binds to the target sequence and is hydrolyzed by BstDNA polymerase, and the reporter group releases fluorescence, with the fluorescence intensity being positively correlated with the concentration of the target sequence.
[0050] Design features: The Tm value is 5-10℃ higher than that of the specific primer set, ensuring that the probe specifically binds to the target sequence after primer binding and avoiding interference from non-specific fluorescence signals.
[0051] 3. Reactive enzyme mixture
[0052] It provides enzymatic catalytic activity for the RT-LAMP reaction, realizing an integrated "RNA reverse transcription-cDNA amplification" reaction. Its specific composition and function are as follows:
[0053] BstDNA polymerase: Possesses strand displacement activity, extending primers under isothermal conditions (60-65℃) without heat denaturation, replacing the synthesized complementary strand, and driving efficient cDNA amplification; amplification efficiency can reach 10. 9 -10 10 This ensures the high sensitivity of the reagent kit;
[0054] AMV reverse transcriptase: It can reverse transcribe KIM-1 mRNA in the sample into cDNA, providing a template for subsequent LAMP amplification; the enzyme's thermostability is adapted to the isothermal environment of RT-LAMP, and it can work synergistically with BstDNA polymerase in the same reaction system without the need for step-by-step operation.
[0055] 4. Reaction buffer
[0056] To provide a suitable chemical environment for the RT-LAMP reaction and ensure enzyme activity and specific binding of primers / probes, the specific composition and formulation are as follows:
[0057] Basic components: Tris·HCl (15-25mM, pH 8.5-9.0), KCl (8-12mM), (NH4)2SO4 (8-12mM), Tween20 (volume fraction 0.08%-0.12%); Tris·HCl maintains the pH stability of the reaction system, KCl and (NH4)2SO4 adjust the ionic strength, and Tween20 reduces non-specific adsorption;
[0058] Synergistic components: betaine (0.6-1.0M), MgSO4 (6-10mM), dNTPs (concentration of each dNTP is 1.2-1.6mM); among which betaine can inhibit the formation of nucleic acid secondary structure, MgSO4 is a key cofactor of BstDNA polymerase, and dNTPs provide raw materials for amplification reaction;
[0059] Preferably, the reaction buffer composition is as follows: 20 mM Tris-HCl (pH 8.8), 10 mM KCl, 10 mM (NH4)2SO4, 0.1% Tween 20, 0.8 M betaine, 8 mM MgSO4, and 1.4 mM dNTPs (1.4 mM of each dNTP). This composition has been experimentally verified to achieve optimal amplification efficiency (see the RT-LAMP reaction system optimization results in the reference document).
[0060] 5. Quality control products
[0061] Used to verify the effectiveness of the detection process and eliminate experimental errors, its specific components are as follows:
[0062] Positive control: The cDNA fragment (156 bp in length) corresponding to the KIM-1 mRNA between the amplification regions of primers F3 and B3. This fragment has been sequenced and verified to be completely consistent with the target region sequence of KIM-1 mRNA, and can be used to confirm the amplification capacity of the reaction system.
[0063] Negative control: Sterile water free of nucleic acids, used to eliminate reagent contamination or environmental nucleic acid interference;
[0064] Blank plasmid control group: This is a blank vector plasmid (such as pMD18-T vector) that has not been linked to the above cDNA fragment, used to exclude the influence of the vector backbone on the detection results.
[0065] When using it, the total RNA is extracted from biological samples (fresh kidney tissue, frozen kidney tissue, paraffin-embedded kidney tissue, urine or serum) from humans or model animals. The extracted RNA template is mixed with a specific primer set, TaqMan probe, reaction enzyme mixture and reaction buffer to form a 25 μL reaction system.
[0066] The reaction system was placed in a real-time fluorescence PCR instrument and reacted at a constant temperature of 60-65℃ for 30-60 min. The fluorescence signal of the FAM channel was collected in real time. The expression level of KIM-1 mRNA was determined based on the CT value (or Tt value, i.e., the time when the fluorescence signal reaches the threshold) of the positive control, negative control and sample: the positive control showed a typical S-shaped fluorescence curve, and the negative control and blank plasmid control group showed no fluorescence signal; when the CT value (or Tt value) of the sample was lower than the threshold, it was determined to be positive for KIM-1 mRNA expression, and the CT value (or Tt value) was negatively correlated with the expression level.
[0067] In the specific implementation of this invention, Shanghai Sangon Biotech Co., Ltd. was commissioned to synthesize F3, B3, FIP, BIP primers and TaqMan probes, the sequences of which are shown above;
[0068] The KIM-1 mRNA sequence
[0069] ATGCATCCTCAAGTGGTCATCTTAAGCCTCATCCTACATCTGGCAGATTCTGTAGCTGGTTCTGTAAAGGTTGGTGG
[0070] AGAGGCAGGTCCATCTGTCACACTACCCTGCCACTACAGTGGAGCTGTCACATCCATGTGCTGGAATAGAGGCTCAT
[0071] GTTCTCTATTCACATGCCAAAATGGCATTGTCTGGACCAATGGAACCCACGTCACCTATCGGAAGGACACACGCTAT
[0072] AAGCTATTGGGGGACCTTTCAAGAAGGGATGTCTCTTTGACCATAGAAAATACAGCTGTGTCTGACAGTGGCGTATA
[0073] TTGTTGCCGTGTTGAGCACCGTGGGTGGTTCAATGACATGAAAATCACCGTATCATTGGAGATTGTGCCACCCAAGG
[0074] TCACGACTACTCCAATTGTCACAACTGTTCCAACCGTCACGACTGTTCGAACGAGCACCACTGTTCCAACGACAACG
[0075] ACTGTTCCAATGACGACTGTTCCAACGACAACTGTTCCAACAACAATGAGCATTCCAACGACAACGACTGTTCTGAC
[0076] GACAATGACTGTTTCAACGACAACGAGCGTTCCAACGACAACGAGCATTCCAACAACAACAAGTGTTCCAGTGACAA
[0077] CAACTGTCTCTACCTTTGTTCCTCCAATGC
[0078] (CTTTGCCCAGGCAGAACCATGAACCAGTAGCCACTTCACCATCTTCACCTCAGCCAGCAGAAACCCACCCTACGA
[0079] CACTGCAGGGAGCAATAAGGAGAGAACCCACCAGCTCACCATTGTACTCTTACACAACAGATGGGAATGACACCGTGACAGAGTCTTCAGATGGCCTTTGG) amplified fragment
[0080] AATAACAATCAAACTCAACTGTTCCTAGAACATAGTCTACTGACGGCCAATACCACTAAAGGAATCTATGCTGGAGT
[0081] CTGTATTTCTGTCTTGGTGCTTCTTGCTCTTTTGGGTGTCATCATTGCCAAAAAGTATTTCTTCAAAAAGGAGGTTC
[0082] AACAACTAAGTGTTTCATTTAGCAGCCTTCAAATTAAAGCTTTGCAAAATGCAGTTGAAAAGGAAGTCCAAGCAGAAGACAATATCTACATTGAGAATAGTCTTTATGCCACGGACTAA.
[0083] Primer names and sequences are as follows:
[0084]
[0085] Preliminary Establishment of TaqMan-Based RT-LAMP Reaction System
[0086] Configure the RT-LAMP reaction system. The RT-LAMP reaction solution includes: 20 mM Tris · HCl (pH 8.8), 10 mM KCl, 10 mM (NH4)2SO4, 0.1% Tween 20, 0.8 M betaine, 8 mM MgSO4, 1.4 mM dNTPs each, 8 U Bst DNA polymerase, 10 U AMV reverse transcriptase. The amounts of primers and probes added were: 40 pmol each of FIP and BIP, 5 pmol each of F3 and B3, and 4 pmol of FAM-TF.
[0087] Table 2 RT-LAMP reaction system
[0088]
[0089] Reaction conditions: Place the prepared reaction system into a real-time PCR machine and react at 60℃ (adjust appropriately within the range of 60-65℃ depending on the primers) for 60 min (adjust appropriately according to experimental conditions). After the reaction, determine whether the KIM-1 gene is expressed or whether the expression level is increased based on the CT value.
[0090] 3. Preparation of standard templates
[0091] Standard positive template: The cDNA sequence of the mRNA fragment (156 bp in length) between F3 and B3 was synthesized by Shanghai Sangon Biotech Co., Ltd. as a standard positive template.
[0092] Standard negative template: The negative control standard is sterile water free of nucleic acid;
[0093] Blank plasmid template: A blank vector without ligated cDNA fragments.
[0094] 4. Specificity experiments using the Taqman-based RT-LAMP method
[0095] Kidney tissue was taken from a patient with kidney tissue damage or kidney cancer, and total RNA was extracted and reverse transcribed into cDNA. Using cDNA as a template, FIP and BIP primer pairs or F3 and B3 primer pairs were added for conventional PCR. Electrophoresis was performed after PCR, and each primer pair was repeated three times to analyze the specificity of the detection.
[0096] 5. Sensitivity Experiment of RT-LAMP Method
[0097] The template was serially diluted and thoroughly mixed according to a series of concentration ratios of positive plasmid standard to blank plasmid standard (50%, 10%, 5%, 1%, 0.5%, 0.1%, 0.05%, 0.01%, 0.005%, 0.001%, negative control, and blank control). Based on the principle that 1 copy of human genomic DNA is approximately equal to 3 pg, the amounts of positive and blank plasmids added were calculated. Following the PCR reaction system and procedure established in this project, 5 μL of the template was used for each experiment, with three replicates per sample, to analyze the detection sensitivity.
[0098] The contents not described in detail in this specification are existing technologies known to those skilled in the art.
[0099] Result: In 10 1 -10 6 It exhibits good linearity within the copy / μL range.
[0100]
[0101]
[0102] Analysis: Slope = -3.2, Efficiency E = 104%, R 2 =0.999, LOD≈10
[0103] Specificity verification: Only the KIM-1 template generated amplification, while other irrelevant genes and NTCs did not amplify;
[0104] Amplification curves: show that only the KIM-1 curve shows a peak, while the other curves are flat;
[0105] Scatter plot: The Y-axis is the log10 (concentration) measured by RT-LAMP, and the X-axis is the log10 (concentration) measured by RT-qPCR. Results:
[0106] The data points are closely distributed around the fitted line (Y=X). Statistical analysis: Pearson r=0.98, p<0.0001;
[0107] An ROC curve analysis showing an area under the curve (AUC) greater than 0.9 indicates excellent diagnostic discrimination ability.
[0108] In this invention, unless otherwise explicitly specified and limited, "above" or "below" the second feature can include direct contact between the first and second features, or contact between the first and second features through another feature between them. Furthermore, "above," "over," and "on top" of the second feature includes the first feature being directly above or diagonally above the second feature, or simply indicates that the first feature is at a higher horizontal level than the second feature. "Below," "below," and "under" the second feature includes the first feature being directly below or diagonally below the second feature, or simply indicates that the first feature is at a lower horizontal level than the second feature.
[0109] The present invention and its embodiments have been described above. This description is not restrictive, and the actual structure is not limited thereto. In conclusion, if those skilled in the art are inspired by this description and, without departing from the spirit of the invention, design similar structures and embodiments without creative effort, all such designs should fall within the protection scope of the present invention.
Claims
1. A KIM-1 detection kit, characterized in that: Taqman-based RT-LAMP design includes: A specific primer set, including outer primers and inner primers; TaqMan probe; The reaction enzyme mixture includes BstDNA polymerase and AMV reverse transcriptase, both of which have strand displacement activity. The reaction buffer includes Tris·HCl, KCl, (NH4)2SO4 and Tween 20; Quality control materials include positive control group, negative control group and blank plasmid control group.
2. The KIM-1 detection kit according to claim 1, characterized in that: The samples are derived from biological samples of humans or model animals, and the biological samples are selected from fresh kidney tissue, frozen kidney tissue, paraffin-embedded kidney tissue, urine, or serum.
3. The KIM-1 detection kit according to claim 1, characterized in that: The outer primers include: F3 primer: CTTTGCCCAGGCAGAACC; B3 primer: CCAAAGGCCATCTGAAGACT.
4. The KIM-1 detection kit according to claim 4, characterized in that: The inner primers include: FIP primer: CCTGCAGTGTCGTAGGGTGGCCAGTAGCCACTTCACCATC; BIP primer: AGGAGAGAACCCACCAGCTCAGTCACGGTGTCATTCCCATC; The Tm values of the FIP and BIP primers are higher than those of the F3 and B3 primers.
5. The KIM-1 detection kit according to claim 1, characterized in that: The TaqMan probe sequence is as follows: 5'-FAM-CATCTTCACCTCAGCCAGCAGAAA-BHQ1-3', wherein the 5' end is labeled with the FAM fluorescent reporter group and the 3' end is labeled with the BHQ1 fluorescent quencher group.
6. The KIM-1 detection kit according to claim 1, characterized in that: The reaction buffer also includes betaine, MgSO4 and dNTPs; The proportions of each group are as follows: Tris·HCl 15-25mM, KCl 8-12mM, (NH4)2SO4 8-12mM, Tween 20 volume fraction 0.08%-0.12%, betaine 0.6-1.0M, MgSO4 6-10mM, and 1.4mM dNTP each.
7. The KIM-1 detection kit according to claim 4, characterized in that: The positive control group was the cDNA fragment corresponding to KIM-1 mRNA between the amplification regions of primers F3 and B3, which was 156 bp in length. The negative control group consisted of sterile water free of nucleic acids; The blank plasmid control group is a blank vector plasmid that has not been ligated with the cDNA fragment.