Application of CD47 gene in prevention and treatment of porcine epidemic diarrhea disease

By targeting and knocking out the CD47 gene using CRISPR/Cas9 technology, the IPEC-J2 cell line with CD47 gene knockout was constructed, solving the problem that existing vaccines cannot effectively protect piglets from porcine epidemic diarrhea (PEDV). This significantly inhibits PEDV replication in host cells and improves the pig herd's resistance to PEDV.

CN121102514BActive Publication Date: 2026-06-26CHINA AGRI UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
CHINA AGRI UNIV
Filing Date
2025-10-30
Publication Date
2026-06-26

AI Technical Summary

Technical Problem

Existing porcine epidemic diarrhea virus (PEDV) vaccines are ineffective in protecting piglets from infection with highly pathogenic PEDV variants, and there is a lack of research on effective host factors that antagonize PEDV infection.

Method used

By targeting and knocking out the CD47 gene using CRISPR/Cas9 technology and utilizing the sgRNA sequence such as SEQ ID NO.1, an IPEC-J2 cell line with CD47 gene knockout was constructed to inhibit PEDV replication in host cells.

Benefits of technology

Significantly reducing the mRNA and N protein expression levels of porcine epidemic diarrhea virus (PEDV) M gene, improving the resistance of pig herds to PEDV, providing new drug development strategies and cell models, and offering new ideas for disease control.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121102514B_ABST
    Figure CN121102514B_ABST
Patent Text Reader

Abstract

The application discloses application of a CD47 gene in prevention and treatment of porcine epidemic diarrhea disease, and belongs to the technical field of prevention and treatment of pig viral diseases and the technical field of biotechnology. It is found that, after a porcine epidemic diarrhea virus infects a host cell, the expression level of the CD47 gene is up-regulated. Moreover, specific targeted knockout of the CD47 gene can effectively inhibit the porcine epidemic diarrhea virus from infecting the host cell, so as to prevent the porcine epidemic diarrhea disease caused by PEDV infection. Therefore, the CD47 gene / protein can be used as a potential target for prevention and treatment of the porcine epidemic diarrhea disease, the gene is knocked out or a related drug is developed aiming at the target, a new idea is provided for prevention and treatment of the PEDV, and the disease control has important significance for the pig raising industry.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the fields of swine viral disease prevention and control technology and biotechnology, and in particular to the application of the CD47 gene in the prevention and control of swine epidemic diarrhea. Background Technology

[0002] Porcine epidemic diarrhea virus (PEDV) can infect pigs of all ages, especially newborn piglets, inducing severe intestinal disease with clinical symptoms such as acute watery diarrhea, vomiting, and dehydration, severely restricting the economic efficiency of my country's pig farming industry. The continuous mutation of animal coronaviruses, coupled with their large genomes and complex replication processes, increases the difficulty of studying their pathogenesis. Since the end of 2010, existing PEDV vaccines have been unable to effectively protect piglets from highly pathogenic PEDV variants resulting from cumulative mutations and recombination events. PEDV belongs to the alpha-coronavirus family, and its genome is a single-stranded positive-sense RNA of approximately 28 kb in length, containing seven open reading frames (ORFs). These ORFs encode ORF1a, ORF1b, spike (S), ORF3, envelope (E), membrane (M), and nucleocapsid (N) genes. After translation, the pp1a and pp1ab proteins encoded by ORF1a and ORF1b are further cleaved by viral proteases into 16 non-structural proteins called Nsp1-16. PEDV possesses a variety of important structural and functional proteins, and has developed various mechanisms to hijack and disrupt the host system in infected host cells to achieve optimal viral adaptation and replication. Therefore, it is crucial to study novel potential host factors that antagonize PEDV infection, including receptors.

[0003] IPEC-J2 cells are intestinal epithelial cells isolated from the jejunum of piglets within 12 hours of birth that have not yet been suckled. IPEC-J2 cells are unique in that they are neither transforming nor tumorigenic cells. Therefore, they are an ideal tool for studying epithelial transport, interactions with intestinal pathogens, interactions with beneficial intestinal bacteria, and parameters such as nutrient and feed epithelial resistance, permeability, and metabolic activity. These cells divide and grow under suitable culture conditions to obtain sufficient passages. In current research, IPEC-J2 cells have been used up to passage 98, and most studies do not mention circulation numbers. IPEC-J2 cells were first used in 1989 to study transepithelial ion transport and intestinal cell differentiation. They have been shown to be useful for studying the interactions between epithelial cells and intestinal bacteria and viruses. The IPEC-J2 cell line is highly similar in morphology and function in vivo and in vitro, making it an ideal in vitro model. IPEC-J2 cells have microvilli and tight junction proteins at their apical ends, tightly connecting adjacent cells together. IPEC-J2 cells formed a polarization layer when cultured on filters with 0.4 μm pores. Immunoblotting confirmed the expression of claudin-1, claudin-3, claudin-4, claudin-5, claudin-7, claudin-8, claudin-12, trichollulin, occludin, E-cadherin, and zonulaoccludens-1 proteins in IPEC-J2 cells. On the other hand, compared to porcine ileal cells (IPI-2I), claudin-2 and claudin-15 were not expressed, and the cells exhibited lower cation selectivity and increased metal ion permeability. IPEC-J2 cells can express and secrete cytokines, defensins, Toll-like receptors, and mucus. The presence of glycolytically bound mucins (such as Muc1 and Muc3) in IPEC-J2 cells was confirmed by RT-PCR and ELISA, respectively. IPEC-J2 cells can express immune-related proteins such as MHC1 and secrete cytokines gm-csf and TNF-α, establishing a link between intestinal epithelial cells and the immune system. Microbial assays using IPEC-J2 cells showed a strong correlation between in vitro and in vivo experiments. Compared to the immortalized IPI-2I cell line, IPEC-J2 cells offer two major advantages as a model of normal intestinal epithelial cells: (1) as a permanent cell line, their differentiation characteristics remain unchanged, exhibiting strong similarity to primary intestinal epithelial cells; (2) IPEC-J2 cells can be directly used as experimental animals in human in vivo models for comparison. The IPEC-J2 cell line is an easy-to-use cell line with the structural and functional differentiation patterns characteristic of mature intestinal epithelial cells.Compared to all non-primates, the pig's gastrointestinal tract is similar in size, weight, anatomy, and physiology to the human gastrointestinal tract, making it the most suitable model for human diseases.

[0004] CD47 is a 50 kDa transmembrane protein widely expressed on the cell membrane, belonging to the immunoglobulin superfamily. It was initially discovered through co-precipitation with human placental integrin αVβ3 and can regulate the function of leukocyte-responsive integrins. Integrins, platelet-agglutinin-1, and signal regulatory protein α are known natural ligands of CD47. It is widely expressed in erythrocytes, epithelial cells, T cells, tumor cells, etc., and its expression is upregulated in immune cells and infected tissues under infectious or inflammatory conditions. CD47 upregulation is usually controlled by NF-κB transcription through the NF-κB motif within the CD47 enhancer. CD47 can affect epithelial regeneration and repair by influencing octamer binding to transcription factor 4, SRY box transcription factor 2, Krüppel-like factor 4, and v-myc avian myeloma virus oncogene homologs. Currently, there are no reports of CD47 antagonizing PEDV infection. Summary of the Invention

[0005] The purpose of this invention is to provide the application of the CD47 gene in the prevention and treatment of porcine epidemic diarrhea (PED) to solve the problems existing in the prior art. By knocking out the CD47 gene, resistance to PED can be effectively improved, indicating that CD47 can serve as a potential target for the prevention and treatment of PED. This provides a new approach for the development of drugs that can be effectively applied to the prevention and treatment of PED.

[0006] To achieve the above objectives, the present invention provides the following solution:

[0007] This invention provides the application of the CD47 gene in any of the following:

[0008] (1) Application in the preparation of drugs for the prevention and treatment of porcine epidemic diarrhea virus infection;

[0009] (2) Application in the preparation of drugs for the prevention and treatment of swine epidemic diarrhea;

[0010] (3) Application in drugs that enhance resistance to porcine epidemic diarrhea;

[0011] (4) Application in pig breeding for resistance to swine epidemic diarrhea.

[0012] The CD47 gene involved in this invention has the following accession numbers in the NCBI database: NC_010455.5 (gene accession number), NM_213982.13 (mRNA accession number), and NP_999147.1 (protein sequence accession number).

[0013] This invention also provides the use of the protein encoded by the CD47 gene in any of the following:

[0014] (1) Application in the preparation of drugs for the prevention and treatment of porcine epidemic diarrhea virus infection;

[0015] (2) Application in the preparation of drugs for the prevention and treatment of swine epidemic diarrhea;

[0016] (3) Application in drugs that enhance resistance to porcine epidemic diarrhea;

[0017] (4) Application in pig breeding for resistance to swine epidemic diarrhea.

[0018] The present invention also provides the use of recombinant vectors containing the CD47 gene in any of the following:

[0019] (1) Application in the preparation of drugs for the prevention and treatment of porcine epidemic diarrhea virus infection;

[0020] (2) Application in the preparation of drugs for the prevention and treatment of swine epidemic diarrhea;

[0021] (3) Application in drugs that enhance resistance to porcine epidemic diarrhea;

[0022] (4) Application in pig breeding for resistance to swine epidemic diarrhea;

[0023] The recombinant vector is obtained by ligating the CD47 gene with an expression vector.

[0024] This invention also provides the use of a host bacterium containing a recombinant vector in any of the following:

[0025] (1) Application in the preparation of drugs for the prevention and treatment of porcine epidemic diarrhea virus infection;

[0026] (2) Application in the preparation of drugs for the prevention and treatment of swine epidemic diarrhea;

[0027] (3) Application in drugs that enhance resistance to porcine epidemic diarrhea;

[0028] (4) Application in pig breeding for resistance to swine epidemic diarrhea;

[0029] The recombinant vector is obtained by linking the CD47 gene with an expression vector, and the CD47 gene is integrated into the genome of the host bacterium through the recombinant vector.

[0030] Preferably, the drug comprises an sgRNA that targets and knocks out the CD47 gene or a knockout vector containing the sgRNA.

[0031] Preferably, the nucleotide sequence of the sgRNA is as shown in SEQ ID NO.1.

[0032] More specifically, this invention is based on CRISPR / Cas9 technology, which uses the sgRNA involved to target and knock out the CDd47 gene, thereby altering the DNA sequence to inactivate the specific target gene. However, this invention is not limited to the above method, and may also involve substances that inhibit, reduce, or downregulate CD47 gene expression through other means, thereby achieving the purpose of preventing and controlling porcine epidemic diarrhea virus infection and improving porcine epidemic diarrhea resistance.

[0033] The present invention also provides a drug for preventing and treating porcine epidemic diarrhea virus infection, the drug comprising an sgRNA that targets and knocks out the CD47 gene or a knockout vector containing the sgRNA.

[0034] Preferably, the nucleotide sequence of the sgRNA is as shown in SEQ ID NO.1.

[0035] This invention also provides the application of reagents for detecting CD47 gene expression levels in the preparation of detection kits for swine epidemic diarrhea virus infection.

[0036] The present invention also provides the application of the CD47 gene in the preparation of cell models that enhance resistance to porcine epidemic diarrhea virus infection, by knocking out the CD47 gene in cells to enhance the resistance of pigs to epidemic diarrhea virus infection.

[0037] The present invention discloses the following technical effects:

[0038] This invention provides an sgRNA sequence for targeted CD47 gene knockout and constructs a CD47 gene knockout IPEC-J2 cell line. This construction method is simple, quick, and low-cost. Quantitative real-time PCR and Western blotting experiments revealed that after CD47 gene knockout, the expression levels of porcine epidemic diarrhea virus (PEDV) M gene mRNA and N protein were significantly reduced at different time points and under different multiplicity of infection conditions. This indicates that CD47 knockout inhibits PEDV replication efficiency in host cells. This invention helps to genetically improve the PEDV infection threshold in pig herds and provides new strategies and methods for antiviral drug design.

[0039] This invention marks the first discovery of the application of the CD47 gene in the prevention and control of porcine epidemic diarrhea virus (PEDV) infection. The invention reveals that CD47 gene expression is upregulated after PEDV infection of host cells IPEC-J2. Knocking out CD47 through gene editing effectively inhibits the efficiency of PEDV infection in host cells. Therefore, CD47 can serve as a potential target for the prevention and control of PEDV. Knocking out this gene or developing related drugs targeting this gene provides new insights for PEDV prevention and control, and is of great significance for disease control in the pig industry. Attached Figure Description

[0040] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0041] Figure 1 A schematic diagram of CD47 firing at a target;

[0042] Figure 2 The results of PCR identification of CD47 monoclonal cells are shown; M: standard DNA molecule; WT: wild-type cells; 1H4, 1E1, 1G6, and 1H3 are four CD47 knockout cell lines; WT: 687 bp; heterozygote: 687 bp; homozygote: 687 bp; among them, monoclonal cell 1H4 was identified as homozygous by PCR and sequencing.

[0043] Figure 3 This is the result of comparing the sequencing results with a reference genome after PCR amplification and ligation of the product into a T vector for Sanger sequencing.

[0044] Figure 4 To detect CD47 expression in knockout cell lines at the gene and protein levels; A: Detection of CD47 expression levels in knockout cell lines; B: Western blotting detection of CD47 protein levels in knockout cell lines; ***, P < 0.001;

[0045] Figure 5 The CCK8 assay was used to detect the in vitro proliferation of WT and KO-CD47; N = 6; ns indicates no significant difference.

[0046] Figure 6 To detect changes in CD47 expression at different time points after infecting IPEC-J2 cells with PEDV at MOI = 0.05; ****, P < 0.0001;

[0047] Figure 7 To detect M gene expression in PEDV knockout cell lines and wild-type cells infected with different MOIs using qRT-PCR;

[0048] Figure 8 To detect changes in viral M gene expression in PEDV-infected knockout cells at different time points at the gene and protein levels; A: qRT-PCR was used to detect viral M gene expression in PEDV-infected knockout cells and control cells at different time points; B: Western blotting was used to detect protein levels at different time points of PEDV infection.

[0049] Figure 9 To detect the effect of CD47 knockout on the expression level of PEDV N protein using immunofluorescence. Detailed Implementation

[0050] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as a limitation of the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0051] It should be understood that the terminology used in this invention is merely for describing particular embodiments and is not intended to limit the invention. Furthermore, with respect to numerical ranges in this invention, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Any stated value or intermediate value within a stated range, as well as each smaller range between any other stated value or intermediate value within said range, is also included in this invention. The upper and lower limits of these smaller ranges may be independently included or excluded from the range.

[0052] Unless otherwise stated, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. While only preferred methods and materials have been described herein, any methods and materials similar or equivalent to those described herein may be used in the implementation or testing of this invention. All references to this specification are incorporated by way of citation to disclose and describe methods and / or materials associated with those references. In the event of any conflict with any incorporated reference, the content of this specification shall prevail.

[0053] Various modifications and variations can be made to the specific embodiments described in this specification without departing from the scope or spirit of the invention, as will be apparent to those skilled in the art. Other embodiments derived from this specification will also be apparent to those skilled in the art. This specification and embodiments are merely exemplary.

[0054] The terms “include,” “including,” “have,” “contain,” etc., used in this article are all open-ended terms, meaning that they include but are not limited to.

[0055] The CD47 gene accession numbers in the NCBI database used in the following examples are CD47 sequence (NC_010455.5), mRNA (NM_213982.13), and protein sequence (NP_999147.1).

[0056] Example 1: Construction of CD47 gene knockout cell line using CRISPR / Cas9 technology

[0057] 1. Construction of knockout cell lines

[0058] (1) Construction steps

[0059] Using CRISPR / Cas9 technology, pigCD47 was knocked out in IPEC-J2 (preserved in our laboratory) using the gene knockout vector pSpCas9(BB)-2A-GFP (purchased from AddGene, catalog number 48138). This was performed by Cyagen Biosciences. Information on pigCD47, its transcripts, and protein (Gene ID: 397042) was retrieved from NCBI. The sgRNA targeting site was designed using the online CRISPR tool TargetFinder (http: / / crispr.mit.edu / ) and located in the second exon (e.g., ...). Figure 1 (as shown)

[0060] gRNA-ATGCCATGTAGTAATTCTGA-TGG (SEQ ID NO. 1).

[0061] Construction of gene expression vector: The positive and negative strand sgRNA (ATGCCATGTAGTAATTCTGATGG, SEQ ID NO.1) were annealed. The reaction system consisted of 10 μL each of the positive and negative strands, 5 μL of buffer, and water to a final volume of 50 μL. The dsDNA formed by annealing was ligated into a linearized knockout Cas9 vector. The ligation product was transformed into *E. coli*, and the recombinant plasmid was sequenced. IPEC-J2 cells were electroporated using a Neon nuclear electroporation system and cultured for 12–24 h. Cell viability and fluorescence expression were observed. After 48 h, Hygromycin B was used for selection until all cells in the negative control group died. Single-clone plating and expansion culture were performed in 96-well plates for 10 days using the limiting dilution method. A portion of the expanded cell lines was used to extract genomic DNA for sequencing, while the other portion was further expanded. Gene knockout (frameshift mutation) was considered to have occurred if the number of base pairs deleted or inserted at the target site was not an integer multiple of 3.

[0062] (2) Construction results

[0063] Based on the second exon of the CD47 CDS region in the NCBI database, sgRNA targeting sites were designed (positive and negative strand single-stranded DNA). The Cas9-sgRNA vector was ligated and transformed, and positive clones were screened to obtain four successfully edited monoclonal cell lines (e.g., Figure 2 As shown in the figure, they are 1H4, 1E1, 1G6 and 1H3 respectively.

[0064] 2. Identification of knockout cell lines

[0065] 2.1 Cell Genome Extraction

[0066] The following steps were taken to extract cellular genomic DNA using the TIANamp Genomic DNA Kit:

[0067] (1) Take the knockout cell line and wild-type cells from the fully grown T25 culture flask, remove the original culture medium, gently wash twice with PBS buffer, add 1 mL of 0.25% trypsin solution, and incubate at 37°C for 1.5 min to complete digestion. Add an equal volume of complete culture medium, blow off the cells, centrifuge at 1,000 rpm for 5 min, add 1 mL of PBS to wash once, centrifuge at 2,000 rpm for 3 min, discard the supernatant, add 200 μL of buffer GA and vortex until completely resuspended.

[0068] (2) Add 20 μL of proteinase K and mix well, then place in a molecular hybridization furnace at 56°C for 4-6 h for digestion.

[0069] (3) Add 200 μL of GB buffer to the digestion end product, mix thoroughly and then transfer to a 70℃ constant temperature water bath for treatment until the solution is clear, about 10 min. Finally, centrifuge for 10 s to complete the sample preparation.

[0070] (4) Add 200 μL of anhydrous ethanol, shake for 15 s and centrifuge for 10 s.

[0071] (5) Add the liquid and precipitate obtained in step (4) to the adsorption column a-collection tube A, centrifuge at 12,000 rpm for 30 s and discard the waste liquid.

[0072] (6) Add 500 μL of buffer GD to the adsorption column a-collection tube A (12,000 rpm, 30 s), and discard the waste liquid after centrifugation.

[0073] (7) Add 600 μL PW to the adsorption column collection tube A and centrifuge (12,000 rpm, 30 s), then discard the waste liquid.

[0074] (8) Repeat the previous step and rinse again, then centrifuge (12,000 rpm, 30 s). After centrifugation, open the lid and let stand to dry the rinsing solution containing alcohol.

[0075] (9) Assemble the adsorption column a-collection tube B, wash the DNA on the adsorption column membrane with a certain amount of TE solution, let stand for 5 min and then centrifuge (12,000 rpm, 30 s).

[0076] Specific primers designed for the CD47 mutation site are shown in Table 1. Genomic sequences targeting the gRNA target site and its vicinity were sequenced to confirm the cell genotype. The primers were synthesized by Beijing Sangon Biotech Co., Ltd. The PCR amplification system consisted of: 12.5 μL of reaction premix, 1 μL each of forward and reverse primers, 1 μL of genomic DNA, and double-distilled water to a total volume of 20 μL. The reaction program was performed according to the manufacturer's instructions, with the annealing temperature selected based on the primer Tm value, and a uniform 32 cycles.

[0077] Table 1 Primers for PCR detection of mutation sites

[0078]

[0079] 2.2 Cell resuscitation

[0080] Thaw IPEC-J2 cells in a 37°C water bath, avoiding water splashing or contact with the cell cryovial opening. Quickly transfer the thawed cell suspension and gently pipette to mix. Passage cells when the cell density in the culture flask is approximately 80-90%. Remove the original culture medium and wash twice with PBS buffer. Add 1 mL of 0.25% trypsin containing EDTA and incubate the flask at 37°C. Add complete culture medium to stop the digestion. Centrifuge at 1000 rpm for 5 min, remove the supernatant, add 5 mL of complete culture medium, and gently pipette to fully resuspend the cells. Then transfer to a 25T culture flask and incubate at 37°C to complete cell resuscitation or passage. Continuously supply 5% CO2 gas to maintain the cell growth environment.

[0081] 2.3 Cell RNA Extraction

[0082] After experimental treatment, cells in 12-well plates were washed three times with pre-chilled PBS, and 300 μL of Trizol was added to each well. 200 μL of chloroform was added, and the mixture was vortexed and incubated at room temperature for 2–3 min. The cells were then centrifuged at 12,000 rpm for 15 min. The supernatant obtained after centrifugation contained RNA. The upper aqueous phase was transferred to a 1.5 mL centrifuge tube, and a slightly larger amount of isopropanol was added. The mixture was incubated at -30°C for 40 min, and then centrifuged at 12,000 rpm for 10 min at 4°C. The gelatinous precipitate in the tube was washed 1–2 times with 1,000 μL of pre-chilled, freshly prepared 75% ethanol, and centrifuged at 7,500 rpm for 5 min at 4°C. The supernatant was carefully discarded, and any remaining liquid in the tube was aspirated using an RNase-free pipette tip. The tube was allowed to dry until the gelatinous precipitate was completely clear. Depending on the size of the RNA gelatinous precipitate, DEPC water was added to dissolve it.

[0083] 2.4 Reverse transcription and quantitative PCR

[0084] Reverse transcription step 1: Based on the measured RNA concentration, adjust the RNA concentration to approximately 1,000 ng / μL by adding DEPC water. Determine the required volume of DEPC water in the system according to the reaction system described below. PCR was performed at 42℃ for 2 min; then stored at 12℃.

[0085] Table 2 Reverse transcription step 1 system

[0086]

[0087] Reverse transcription step 2: Take the reaction product from step 1 and prepare it according to the following system. The PCR program is as follows: 37℃, 15min; 85℃, 5s; store at 4℃ for the reaction.

[0088] Table 3. Reverse transcription step 2 system

[0089]

[0090] Quantitative fluorescence assay: Gene expression levels were detected using a fluorescent dye method with GAPDH as an internal control. Specific primers for CD47 and GAPDH were designed using Primer 3 and synthesized by Beijing Biotechnology Co., Ltd. The specific primer sequences are shown in the table below.

[0091] Table 4 Primer Information

[0092]

[0093] Table 5. Fluorescence Quantitative System

[0094]

[0095] 2.5 Western blotting experiment

[0096] Total protein sample preparation: Mix RIPA protein lysis buffer and protease inhibitor PMSF at a ratio of 1 mL:10 μL and set aside. Add 100 μL of lysis buffer to each well of a six-well plate, spread the lysis buffer evenly, and incubate on ice for 10 min. Scrape off cells using a cell scraper, sonicate at 50 W for 2 min, sonicate for 30 s, pause for 30 s, and continue lysis on ice for 5-10 min. Collect the supernatant at 12,000 rpm for 5 min for protein concentration determination. Measure the absorbance of each well at 562 nm using a microplate reader, and quantify the sample protein concentration using a standard curve.

[0097] Detection: Calculate the protein loading volume based on 30 μg of protein per well. Dilute the protein sample to 1× with 5×SDS protein loading buffer, mix thoroughly by pipetting, and then denature at 95℃ for 5 min in a metal bath (37℃ for membrane proteins). Centrifuge at 15,000 rpm for 3 min at 4℃ and collect the supernatant. Prepare 10% PAGE separating and stacking gels according to the manufacturer's instructions. Add 30 μg of protein sample to each well and leave a well for protein marker loading. Electrophore to the separating gel at 80 V, then adjust the voltage to 120 V until bromophenol blue reaches the bottom. Prepare transfer buffer and construct a transfer "sandwich structure." Transfer the membrane at 300 mAn according to the molecular weight. Block the membrane with antigen using 5% skim milk powder prepared with 10×TBST for 2 h. Wash the membrane three times with 1×TBST for 5 min each time. Prepare the primary antibody according to the appropriate ratio for Western blotting and incubate overnight at 4℃. Wash the membrane three times with 1×TBST for 10 min each time on the second day. Add diluted secondary antibody of the corresponding seed source and incubate at room temperature for 1.5 h. Wash the secondary antibody 5 times with 1×TBST, 5 min each time. Mix A and B developing solutions in a 1:1 ratio and drop them onto the membrane for exposure.

[0098] 3. Experimental Results

[0099] Sequencing analysis revealed a non-integer deletion (not equal to 3) in exon 2 of the 1H4 cell line. This was validated at the genomic, transcriptional, and protein levels. Primers were designed flanking the sgRNA editing site, and PCR amplification was performed. The product was then ligated into a T-vector and Sanger sequencing was conducted. The sequencing results were compared with a reference genome. The results are as follows: Figure 3 As shown, CD47 exhibited a one-base G insertion on one strand and a 14 bp deletion on the other. Based on the location of the mutation in the second exon, quantitative PCR primers were designed to detect CD47 expression levels in knockout cell lines and wild-type cells. Simultaneously, whole protein was extracted and subjected to Western blotting to further validate the CD47 gene knockout effect at the protein level. Results are as follows... Figure 4 As shown, compared with wild-type IPEC-J2 cells, the expression level and protein level of CD47 in the knockout cell line were significantly reduced.

[0100] Example 2: CD47 knockout does not affect normal cell proliferation

[0101] (1) Experimental steps

[0102] CCK8 assay for cell proliferation: 3,000 cells were seeded into each well of a 96-well plate and cultured for 24 h. At different time points, 10 μL of enhanced CCK-8 solution was added to each well using the CellCounting Kit-8 assay. The cells were incubated in a cell culture incubator for 0.5–4 h and the absorbance was measured at 450 nm using a microplate reader. Wells containing the appropriate amount of cell culture medium, drug, and enhanced CCK-8 solution but without cells were set up as blank controls.

[0103] (2) Experimental results

[0104] Cell proliferation rate was detected using a CCK8 assay kit. Cells were incubated in 96-well plates at 12, 24, and 36 h for 1 h, followed by OD measurement. 450 Test results Figure 5 This indicates that there was no significant difference in proliferation rate between the CD47 knockout cell line (KO-CD47) and the wild-type (WT) (P < 0.05).

[0105] Example 3: Upregulation of CD47 gene expression level after PEDV infection of IPEC-J2 cells

[0106] (1) Experimental steps

[0107] The cell culture, RNA extraction, and RT-qPCR steps are as described in Example 1.

[0108] (2) Experimental results

[0109] IPEC-J2 cells were infected with MOI = 0.05. qRT-PCR analysis revealed that the CD47 mRNA level in IPEC-J2 cells infected with PEDV-CV777 strain (CV777 strain preserved in our laboratory) showed a similar trend of first increasing and then decreasing at different time points. However, the overall level was significantly increased compared to the control group, with a highly significant increase in relative CD47 mRNA expression at 24 h (P < 0.0001). The results are as follows... Figure 6 As shown.

[0110] Example 4: Knockout of CD47 significantly inhibits PEDV replication in host cells.

[0111] (1) Experimental steps

[0112] The cell culture, RNA extraction, RT-qPCR, and Western blotting procedures are described in Example 1.

[0113] PEDV Inoculation: When cell confluence reached 80-90%, PEDV infection was performed. Complete culture medium was discarded, and cells were washed twice with PBS. Wild-type (WT) and candidate gene knockout (KO) cells were infected with PEDV under different MOIs (0.01, 0.05, 0.1, 1) and time points (1, 3, 6, 12, 24, 36, 48 h). Uninoculated cell wells were treated with DMEM as negative controls. The top of the culture plate was gently tapped every 30 min to promote virus adsorption. After 2 h, PBS sufficient to cover the bottom of the wells was added and the cells were washed three times to remove unbound virus. Cells were then cultured in serum-free DMEM, and harvested at different time points for subsequent analysis. Specific primers for the PEDV M gene were designed using Primer 3 and synthesized by Beijing Biotechnology Co., Ltd. The specific primer sequences are shown in Table 6 below.

[0114] Table 6 Primer Information

[0115]

[0116] Immunofluorescence: Place 24-well sterile cell slides into cell culture plates. When the cell confluence reaches 90%, inoculate with the virus. After 24 hours, remove the culture plates for immunofluorescence treatment. Discard the culture medium and wash three times with PBS. Fix the slides with 4% paraformaldehyde for 15 min, then wash three times with PBS for 3 min each time. Permeabilize with 0.2% permeabilizer at room temperature for 20-30 min, then wash three times with PBS for 3 min each time. Block with 5% BSA blocking solution at room temperature for 30-60 min, aspirate the blocking solution, add the prepared primary antibody, and incubate overnight at 4°C in a humidified chamber. Recover the primary antibody and wash three times with PBS for 3 min each time. Add diluted fluorescent secondary antibody and incubate at 37°C for 1 h in the dark. Recover the secondary antibody and wash three times with PBS for 3 min each time. Add DAPI (10 μg / mL) to stain the nuclei, wash three times with PBS for 5 min each time, mount the slides, and image under a fluorescence microscope.

[0117] Virus titer detection: Vero cells were seeded one day in advance, with 5 × 10⁶ cells per well. 3 Prepare cells for infection. Take out the virus solution to be tested and press 10... -1 -10 -8 The virus was serially diluted in eight 1.5 mL sterile EP tubes. 0.9 mL of serum-free culture medium was added to each tube for serial dilution. When cells reached 90% confluence, the original culture medium was carefully removed, followed by two washes with PBS buffer. The pre-prepared virus dilutions were then serially aliquoted into each well of a 96-well plate, with 100 µL added to each well. Six to eight replicates were performed for each dilution to ensure reproducibility. For inoculation, a 10-1... -8The initial concentration gradient was used to seed cells in the eighth row of the culture plate, and subsequent dilution gradients were added in descending order of concentration. A blank control was added with 100 µL of serum-free medium. After 2 h, the virus solution was discarded, the cells were washed twice with PBS, and cell maintenance medium was added. Cell status was observed daily for 5 consecutive days. The cumulative number of positive and negative wells was calculated, the distance ratio was calculated, and TCID50 was calculated using the Reed-Muench method.

[0118] (2) Experimental results

[0119] PEDV infection was performed using different MOIs (0.01, 0.05, 0.1, 1), and viral M gene expression was detected 24 h after infection, with GAPDH used as an internal control. Results showed that viral replication levels in the CD47 knockout group were significantly lower than in the wild type. Figure 7 As shown.

[0120] Furthermore, KO-CD47 and WT cells were infected with MOI = 0.05, and samples were collected at different time points for qRT-PCR and Western blotting detection. The results are as follows: Figure 8 As shown, knocking out CD47 can significantly suppress the expression levels of key structural proteins of PEDV.

[0121] With an MOI of 0.05, viral particle levels were detected in KO-CD47 and WT cells 24 h after infection using immunofluorescence and TCID50. Immunofluorescence results are shown below. Figure 9 As shown, compared to the IPEC-J2 wild-type cell line, the knockout cell line exhibits less and weaker green fluorescence, indicating that the protein expression of the viral N gene is significantly suppressed.

[0122] The embodiments described above are merely preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Various modifications and improvements made by those skilled in the art to the technical solutions of the present invention without departing from the spirit of the present invention should fall within the protection scope defined by the claims of the present invention.

Claims

1. Application of knocking out the porcine CD47 gene in any of the following: (1) Application in the preparation of drugs for the prevention and treatment of porcine epidemic diarrhea virus infection; (2) Application in the preparation of drugs for the prevention and treatment of swine epidemic diarrhea; (3) Application in drugs that enhance resistance to porcine epidemic diarrhea; (4) Application in pig breeding for resistance to swine epidemic diarrhea.

2. Application of porcine CD47 gene knockout vectors in any of the following: (1) Application in the preparation of drugs for the prevention and treatment of porcine epidemic diarrhea virus infection; (2) Application in the preparation of drugs for the prevention and treatment of swine epidemic diarrhea; (3) Application in drugs that enhance resistance to porcine epidemic diarrhea; (4) Application in pig breeding for resistance to swine epidemic diarrhea.

3. The use of host bacteria containing a pig CD47 gene knockout vector in any of the following: (1) Application in the preparation of drugs for the prevention and treatment of porcine epidemic diarrhea virus infection; (2) Application in the preparation of drugs for the prevention and treatment of swine epidemic diarrhea; (3) Application in drugs that enhance resistance to porcine epidemic diarrhea; (4) Application in pig breeding for resistance to swine epidemic diarrhea.

4. The application as described in any one of claims 1-3, characterized in that, The drug comprises an sgRNA that targets and knocks out the CD47 gene or a knockout vector containing the sgRNA.

5. The application as described in claim 4, characterized in that, The nucleotide sequence of the sgRNA is shown in SEQ ID NO.

1.

6. The application of knocking out the porcine CD47 gene in preparing cell models that enhance resistance to porcine epidemic diarrhea virus infection, characterized in that... By knocking out the CD47 gene in cells, the resistance of pigs to porcine epidemic diarrhea virus infection was improved; the cells were porcine intestinal epithelial cells.