Use of pathogenic transposable element pL1HS as a biomarker and therapeutic target for lung squamous carcinoma
By using the pathogenic transposable element pL1HS as a biomarker and therapeutic target, the problem of lacking effective targets for lung squamous cell carcinoma has been solved, enabling early screening, molecular subtyping, and prognostic assessment. Furthermore, by reshaping the tumor immune microenvironment through inhibitors, tumor growth can be synergistically inhibited, providing a new treatment option.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- TIANJIN TUMOR HOSPITAL
- Filing Date
- 2025-11-21
- Publication Date
- 2026-06-26
Smart Images

Figure CN121160749B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of biomedicine, and in particular to the application of a pathogenic transposable element pL1HS as a biomarker and therapeutic target for lung squamous cell carcinoma. Background Technology
[0002] Non-small cell lung cancer (NSCLC) ranks among the leading causes of death from malignant tumors worldwide. Squamous cell lung carcinoma, as one of the major subtypes of NSCLC, is characterized by rapid progression, poor prognosis, and low response rates to chemotherapy. Compared to adenocarcinoma, squamous cell lung carcinoma lacks effective targets and is prone to immune escape, limiting the efficacy of existing targeted therapies and immunotherapy monotherapy, thus necessitating the development of novel treatment strategies.
[0003] Long interspersed element-1 (LINE-1, L1) is the only human retrotransposon capable of autonomous transposition, with the L1HS subtype being the only LINE-1 subtype in the human genome currently exhibiting retrotransposition activity. Recent studies have revealed that LINE-1-mediated retrotransposition events promote tumorigenesis through multiple mechanisms: genome-wide analysis shows that insertion can lead to centromere and telomere loss, inactivating tumor suppressor genes; or it can drive oncogene amplification through a "break-fusion-bridging" cycle, inducing large-scale genomic rearrangements, disrupting genomic stability, and driving carcinogenesis. LINE-1 is known to insert into neighboring genes via antisense promoters, forming L1 chimeric transcripts. L1-APC, L1-PTEN, and other retrotransposon elements have been reported to be associated with malignant tumors such as colorectal cancer, ovarian cancer, and breast cancer. However, in lung squamous cell carcinoma, although LINE-1 insertion has been shown to be associated with poor prognosis, the key LINE-1 retrotransposon elements regulating the development and progression of lung squamous cell carcinoma remain to be elucidated. Summary of the Invention
[0004] In order to solve the above-mentioned technical problems, the present invention provides an application of the pathogenic transposable element pL1HS as a biomarker and therapeutic target for lung squamous cell carcinoma.
[0005] In a first aspect, the present invention provides a pathogenic transposable element pL1HS, which is achieved through the following technical solution.
[0006] A pathogenic transposon element pL1HS, wherein the 5'-UTR region of the pathogenic transposon element pL1HS has the characteristic nucleic acid sequence shown in SEQ ID NO.1.
[0007] Secondly, the first use of the pathogenic transposable element pL1HS provided by the present invention is achieved through the following technical solution.
[0008] The application of a detection reagent for the expression level of the above-mentioned pathogenic transposable element pL1HS in the preparation of any of the following products:
[0009] a. Early screening or diagnostic products for squamous cell carcinoma of the lung;
[0010] b. Lung squamous cell carcinoma molecular subtyping products;
[0011] c. Prognostic assessment products for squamous cell carcinoma of the lung.
[0012] Furthermore, the detection reagent for the expression level of the pathogenic transposon element pL1HS is a specific amplification primer set for the pathogenic transposon element pL1HS, wherein the upstream primer sequence is shown in SEQ ID NO.2 and the downstream primer sequence is shown in SEQ ID NO.3.
[0013] Thirdly, the present invention provides a specific detection primer set for the pathogenic transposable element pL1HS, which is achieved through the following technical solution.
[0014] A specific detection primer set for detecting the expression level of the pathogenic transposon element pL1HS, the specific detection primer set includes an upstream primer and a downstream primer, the upstream primer sequence is shown in SEQ ID NO.2, and the downstream primer sequence is shown in SEQ ID NO.3.
[0015] Fourthly, the present invention provides a second use of the pathogenic transposable element pL1HS, which is achieved through the following technical solution.
[0016] Application of an inhibitor of the expression level of the above-mentioned pathogenic transposable element pL1HS in the preparation of a drug for the treatment of lung squamous cell carcinoma.
[0017] Furthermore, the inhibitor is selected from one or more of the following: retrotransposon inhibitors, cGAS inhibitors, and phase separation inhibitors.
[0018] Specifically, the reverse transcription transposon inhibitor is nevirapine; the cGAS inhibitor is RU.521; and the phase separation inhibitor is 1,6-hexanediol.
[0019] Fifthly, the present invention provides a retrotransposon gene L1-SVEP1, which is achieved through the following technical solution.
[0020] A retrotransposon L1-SVEP1, wherein the 5'-UTR region of the retrotransposon L1-SVEP1 has the characteristic nucleic acid sequence shown in SEQ ID NO.1.
[0021] In a sixth aspect, the present invention provides a first use of the retrotransposon gene L1-SVEP1, which is achieved through the following technical solution.
[0022] The application of a reagent for detecting the expression level of the retrotransposon L1-SVEP1 in the preparation of any of the following products:
[0023] a. Early screening or diagnostic products for squamous cell carcinoma of the lung;
[0024] b. Lung squamous cell carcinoma molecular subtyping products;
[0025] c. Prognostic assessment products for squamous cell carcinoma of the lung.
[0026] Furthermore, the detection reagent for the expression level of the retrotransposon L1-SVEP1 is a set of specific amplification primers for the retrotransposon L1-SVEP1, wherein the upstream primer sequence is shown in SEQ ID NO.2 and the downstream primer sequence is shown in SEQ ID NO.3.
[0027] In a seventh aspect, the present invention provides a specific detection primer set for the retrotransposon gene L1-SVEP1, which is achieved through the following technical solution.
[0028] A specific detection primer set is provided for detecting the expression level of the retrotransposon L1-SVEP1. The specific detection primer set includes an upstream primer and a downstream primer. The sequence of the upstream primer is shown in SEQ ID NO.2, and the sequence of the downstream primer is shown in SEQ ID NO.3.
[0029] Eighthly, the present invention provides a second use of the retrotransposon L1-SVEP1, which is achieved through the following technical solution.
[0030] Application of an inhibitor of the expression level of the aforementioned retrotransposon L1-SVEP1 in the preparation of a drug for the treatment of lung squamous cell carcinoma.
[0031] Furthermore, the inhibitor is selected from one or more of the following: retrotransposon inhibitors, cGAS inhibitors, and phase separation inhibitors.
[0032] Specifically, the reverse transcription transposon inhibitor is nevirapine; the cGAS inhibitor is RU.521; and the phase separation inhibitor is 1,6-hexanediol.
[0033] Ninthly, the present invention provides a drug for treating squamous cell carcinoma of the lung, which is achieved through the following technical solution.
[0034] A drug for treating squamous cell carcinoma of the lung targets the aforementioned pathogenic transposon element pL1HS or the retrotransposon gene L1-SVEP1.
[0035] Furthermore, the drug is selected from one or more of the following: retrotransposon inhibitors, cGAS inhibitors, and phase separation inhibitors.
[0036] Specifically, the reverse transcription transposon inhibitor is nevirapine; the cGAS inhibitor is RU.521; and the phase separation inhibitor is 1,6-hexanediol.
[0037] This application has the following beneficial effects.
[0038] The pathogenic transposon element pL1HS of this invention activates the cGAS-STING pathway by promoting L1-ORF1p phase separation, thereby reshaping the suppressive immune microenvironment of lung squamous cell carcinoma and driving its development. Simultaneously, the combined application of retrotransposon inhibitors and cGAS inhibitors in this application synergistically inhibits tumor growth, demonstrating the effectiveness of a dual-target therapeutic strategy targeting both the pathogenic transposon element pL1HS and the cGAS-STING pathway. The pathogenic transposon element pL1HS of this invention possesses both diagnostic and therapeutic value: as a novel molecular marker, its detection enables early screening, molecular subtyping, and prognostic assessment of lung squamous cell carcinoma; as a therapeutic target, combined intervention programs developed based on it provide new avenues for clinical treatment. Attached Figure Description
[0039] Figure 1 This is a distribution map of the expression level of the pathogenic transposable element pL1HS in two independent lung squamous cell carcinoma cohorts (TJMUCH-LUSC and TCGA-LUSC) (where A. the proportion of each L1 subtype in TJMUCH-LUSC and TCGA-LUSC; B. the distribution of pL1HS and each clinical feature in TJMUCH-LUSC and TCGA-LUSC).
[0040] Figure 2 This is a graph showing the results of the verification of the correlation between the pathogenic transposon element pL1HS and poor prognosis of lung squamous cell carcinoma in two independent cohorts of lung squamous cell carcinoma (wherein, A. KM curve of overall survival in the pL1HS-positive and pL1HS-negative groups in the 150-case TJMUCH-LUSC cohort; B. KM curve of overall survival in the pL1HS-positive and pL1HS-negative groups in the 392-case TCGA-LUSC cohort; C. Proportion of pL1HS-positive and pL1HS-negative groups in the TJMUCH-LUSC cohort at TNM stages).
[0041] Figure 3This diagram illustrates the relationship between the pathogenic transposon element pL1HS of this invention and the tumor immune microenvironment, major immune cell infiltration, and immune-related pathways in two independent lung squamous cell carcinoma cohorts. It also shows the effects of the pathogenic transposon element pL1HS and nevirapine on immune cell activation and immunosuppression in in vitro cell experiments (where A. the effect of pL1HS on immune pathways in the TJMUCH-LUSC cohort; B. the effect of pL1HS on immune-related signaling pathways and immune cell infiltration in the TJMUCH-LUSC cohort; C. the effect of pL1HS on immune pathways in the TCGA-LUSC cohort; D. the effect of pL1HS on immune-related signaling pathways and immune cell infiltration in the TCGA-LUSC cohort; E. changes in CD11b, immunosuppression-related genes, and metabolic enzyme expression in THP-1 cells co-cultured with lung squamous cell carcinoma cells before and after nevirapine treatment).
[0042] Figure 4 This invention discloses the mechanism by which the pathogenic transposon element pL1HS regulates the immune response through activation of the cGAS-STING pathway in lung squamous cell carcinoma cells, and the effects of nevirapine and cGAS inhibitors on the cGAS-STING pathway and immune cells in lung squamous cell carcinoma cells (wherein, A. Schematic diagram of the pathogenic transposon element pL1HS affecting the lung squamous cell carcinoma cell pathway; B. Comparison diagram of cGAS / STING pathway activation in lung squamous cell carcinoma cells before and after treatment with nevirapine or cGAS inhibitors; C. Comparison diagram of downstream gene expression in the cGAS / STING pathway in lung squamous cell carcinoma cells before and after treatment with nevirapine or cGAS inhibitors; D. Changes in CD11b expression in THP-1 cells co-cultured with lung squamous cell carcinoma cells before and after treatment with cGAS inhibitors; E. Changes in the expression of immunosuppression-related genes and metabolic enzymes in THP-1 cells co-cultured with lung squamous cell carcinoma cells before and after treatment with cGAS inhibitors).
[0043] Figure 5 This invention presents the effects of the pathogenic transposon element pL1HS on the cGAS-STING pathway and immune cells in lung squamous cell carcinoma cells by promoting L1-ORF1p phase separation, driving cGAS-STING pathway activation, and directly interfering with phase separation (wherein, A. imaging of L1-ORF1p phase separation structure in lung squamous cell carcinoma cells positive for pathogenic transposon element pL1HS; B. comparison of cGAS / STING pathway activation after treatment with phase separation inhibitors; C. comparison of downstream gene expression of cGAS / STING pathway in lung squamous cell carcinoma cells before and after treatment with phase separation inhibitors; D. changes in CD11b expression in THP-1 cells after co-culturing with lung squamous cell carcinoma cells before and after treatment with phase separation inhibitors; E. changes in the expression of immunosuppression-related genes and metabolic enzymes in THP-1 cells after co-culturing with lung squamous cell carcinoma cells before and after treatment with phase separation inhibitors).
[0044] Figure 6 This is a graph showing the effect of murine transposon element L1Md expression on the development and progression of squamous cell carcinoma of the lung in the mouse model of this invention, as well as the effects of nevirapine alone and in combination with cGAS inhibitors [wherein, A. physical image comparing tumor volume in the control group and different treatment groups (PBS, nevirapine monotherapy, RU.521 monotherapy, nevirapine + RU.521 combination); B. comparison of tumor weight in the control group and different treatment groups; C. comparison of tumor volume in the control group and different treatment groups; D. comparison of mouse weight in the control group and treatment group]. Detailed Implementation
[0045] The invention will be further described below with reference to the accompanying drawings and embodiments. Unless otherwise specified, the experimental methods used in this invention are conventional methods, and the experimental equipment, materials, reagents, etc. used can all be purchased from relevant material sales companies.
[0046] I. Nucleic Acid Sequence
[0047] The 5'-UTR nucleic acid sequence of the pathogenic transposable element pL1HS (SEQ ID NO.1):
[0048] TGCCGCCTTGCAGTTTGATCTCAGACTGCTGTGCTAGCAATCAGCGAGATTCCGTGGGCGTAGGACCCTCGGAGCCAGGTGTGGGATATAGTCTCGTGGTGCGCCGTTTCTTAAGCCGGTCTGAAAAGCGCAATATTCGGGTGGGAGTGACCCGATTTTCCAG
[0049] II. Experimental Methods
[0050] 1. Clinical Sample Collection
[0051] This invention collected samples from 150 patients with squamous cell carcinoma of the lung who visited the pulmonary oncology department and underwent partial pulmonary resection, including 127 men and 23 women. All these patients were diagnosed with squamous cell carcinoma of the lung and had a history of smoking. Clinical stages were: stage I (57 cases), stage II (26 cases), stage III (42 cases), and stage IV (25 cases). No treatment, including chemotherapy or radiotherapy, was received prior to pulmonary resection. Postoperative follow-up ranged from 67 to 96 months. Additionally, this invention collected samples from 392 patients with squamous cell carcinoma of the lung from TCGA, including 290 men and 102 women. These patients were all diagnosed with squamous cell carcinoma of the lung and had a history of smoking. Clinical stages were: stage I (190 cases), stage II (123 cases), stage III (70 cases), stage IV (5 cases), and stage unknown (4 cases).
[0052] 2. PCR detection
[0053] (1) Total RNA extraction using the Trizol method
[0054] ① Collect tissue and cell samples, add an appropriate amount of Trizol, pipette and transfer to enzyme-free tubes;
[0055] ② Let the enzyme-free tube stand at room temperature for 5 minutes, add chloroform (200µl / 1ml Trizol), mix by inverting until pink, let stand at room temperature for 10 minutes, centrifuge at 12000g for 15 minutes at 4℃;
[0056] ③ Carefully aspirate the upper aqueous phase into a new enzyme-free tube, add an equal volume of isopropanol, invert to mix, let stand at room temperature for 10 minutes, then centrifuge at 12000g for 10 minutes at 4℃. Discard the supernatant;
[0057] ④ Wash the precipitate with 75% ethanol (500µl / 1ml Trizol), centrifuge at 7500g for 5 min at 4℃, discard the supernatant, repeat twice, and allow the precipitate to dry to transparency at room temperature. Add an appropriate amount of DEPC to dissolve it, and store at -80℃ for later use;
[0058] ⑤The NanoDrop2000 was used to determine the concentration and purity of RNA.
[0059] (2) Reverse transcription experiment (20µl system)
[0060] Prepare the following reaction system:
[0061] 5×PrimeScript RT Master Mix 2µl
[0062] Total RNA sample 1µg
[0063] 20µl of enzyme-free water replenishment system
[0064] Reverse transcription procedure:
[0065] 37℃ for 15 minutes
[0066] 85℃ 5s
[0067] 4℃ -
[0068] (3) Conventional PCR reaction
[0069] PCR amplification reaction system:
[0070] 2×SYBR Premix Ex Taq II 10µl
[0071] Template 1µl
[0072] Primer 1 (10µM) 0.8µl
[0073] Primer 2 (10µM) 0.8µl
[0074] 7.4 µl of sterile distilled water
[0075] Amplification procedure:
[0076] 95℃ 30s
[0077] 95℃ 10s
[0078] 95℃ 5s×40
[0079] 60℃ 34s
[0080] Primers were designed using Primer Premier 5.0 based on the predicted sequences, ISGs, and immunosuppression-related metabolic enzyme genes (see Table 1) and synthesized by Shanghai Sangon Biotech Co., Ltd. β-actin was used as an internal control. Melting and amplification curves were confirmed after the reaction using a 2... -ΔΔCT The relative expression level of the target gene is calculated using this method.
[0081] Table 1
[0082]
[0083] 3. Constructing cell lines that highly express pL1HS
[0084] After purifying the PCR amplification product, cloning primers were designed with BamHI and EcoRI restriction sites at both ends of the target sequence. The upstream primer was 5'-CGCGGATCCTGCCGCCTTGCAGTTTGAT-3' (SEQ ID NO.36); the downstream primer was 5'-CCGGAATTCCTGGAAAATCGGGTCACTCCC-3' (SEQ ID NO.37). The purified PCR product was simultaneously double-digested with the pHBLV-CMV-MCS-EF1-ZsGreen-T2A-Puromycin cloning vector (purchased from Hanheng Biotechnology (Shanghai) Co., Ltd., catalog number LV012) and ligated. The constructed plasmid was sent to Shanghai Hanheng Biotechnology Co., Ltd. for lentiviral packaging.
[0085] SK-MES-1 cells were seeded into 6-well plates, approximately 4 × 10⁴ cells per well. 5 Cells were cultured for 24 hours until 70% confluence. 20 µl of lentivirus and polybrene were added to each well, and the cells were co-cultured at 37°C for 24 hours, then the medium was replaced with fresh medium. Forty-eight hours after infection, puromycin (2 μg / ml) was used for selection, with the medium changed every 48 hours until stable transfectants were formed. After RT-PCR verification of expression, the cells were aliquoted and stored at -80°C for later use.
[0086] 4. Cell Culture and Processing
[0087] Cells were cultured in MEM medium containing 10% FBS and 1% NEAA at 37°C and 5% CO2. For retrotransposon inhibitor treatment experiments, nevirapine (NVR) was dissolved in dimethyl sulfoxide (DMSO) to prepare a stock solution with a working concentration of 450 μM. For cGAS inhibitor treatment experiments, RU.521 was dissolved in DMSO to prepare a stock solution with a working concentration of 5 μM.
[0088] Tumor cells and THP-1 cells in the logarithmic growth phase were seeded in the upper and lower chambers of a Transwell cell line at a ratio of 5:1 and co-cultured for 72 hours. Cells from the lower chamber were then collected, centrifuged at 300×g for 5 min, and subjected to subsequent PCR or flow cytometry.
[0089] 5. Immunofluorescence
[0090] Cells were seeded in laser confocal microscopy culture dishes at a density of 5 × 10⁶ cells / mL. 4 Cells / cm² were cultured to 60%-70% confluence. The culture medium was discarded, and the cells were washed three times (5 min each) with pre-cooled PBS. 4% paraformaldehyde (PFA) was added for fixation at room temperature for 15 min, followed by three washes with PBS. 0.3% Triton X-100 (dissolved in PBS) was used for permeabilization for 10 min. Non-specific sites were blocked with 3% BSA (prepared in PBS containing 0.1% Tween-20), and the mixture was incubated at 37°C for 1 h. Diluted anti-human L1-ORF1p primary antibody (Merck Millipore, catalog number MABC1152) working solution was added, and the mixture was incubated overnight at 4°C in a humidified chamber. The cells were washed three times (10 min each) with PBS-T (0.05% Tween-20). CoraLite594-conjugated Goat Anti-Mouse IgG (H+L) fluorescently labeled secondary antibody (Proteintech, catalog number RGAM004) was added under light-protected conditions, and the mixture was incubated at 37°C for 1 h. Stain nuclei with DAPI (1 μg / ml) for 5 min, then rinse 3 times with PBS. Add anti-fluorescence quenching mounting medium, cover with a coverslip, and cure in the dark for 24 h.
[0091] 6. Flow cytometry
[0092] The collected cell counts were adjusted to a density of 1×10⁻⁶. 6Cells / ml, aliquoted into flow cytometry tubes (100 μl per tube). Add Fc blocking agent (anti-CD16 / 32 antibody, 1:100 dilution), incubate at 4°C for 10 min. Add fluorescently labeled antibody (FITC-CD11b) according to the experimental design, incubate in the dark for 30 min. Add 2 ml PBS (containing 2% FBS), centrifuge at 300×g for 5 min, discard the supernatant, repeat twice. Fix with 1% PFA for 10 min, wash with pre-cooled PBS, resuspend in PBS, and wait for flow cytometry.
[0093] 7. Establishment of mouse xenograft model
[0094] Using the mouse lung squamous cell carcinoma line KLN205, the target fragment was amplified by PCR based on the mouse L1 gene 5'-UTR and ORF1p sequences [upstream primer: AATCCAATCGCGCGGAACTTGA (SEQ ID NO.38), downstream primer: TCAATTCCGCGCGATTG GATTA (SEQ ID NO.39)]. The purified PCR product was then double-digested with the pHBLV-CMV-MCS-EF1-ZsGreen-T2A-Puromycin cloning vector (purchased from Hanheng Biotechnology (Shanghai) Co., Ltd., catalog number LV012), and ligated. The constructed plasmid was sent to Shanghai Hanheng Biotechnology Co., Ltd. for lentiviral packaging. KLN205 cells were seeded in 6-well plates, approximately 4 × 10⁶ cells per well. 5 Cells were cultured for 24 hours until 70% confluence. 20 µl of lentivirus and polybrene were added to each well, and the cells were co-cultured at 37°C for 24 hours, followed by fresh medium. Forty-eight hours after infection, puromycin (2 μg / ml) was used for selection, with medium changed every 48 hours until stable transgenic cells were formed. KLN205 cells (KLN205) with high expression of the mouse L1 gene were then verified. OV-L1Md Construction successful. Mouse lung squamous cell carcinoma cell line KLN205, in logarithmic growth phase, was obtained. OV-L1Md Digested cells into a single-cell suspension, with a final concentration of 1 x 102 7 / mL. After anesthetizing BDF1 mice (6-8 weeks old, 18-22g, 5 mice per group), the mice were disinfected with 75% ethanol, and 100 μL of cell suspension was injected into the back of the forelimb of the mice to construct a subcutaneous xenograft model.
[0095] 8. Animal experiments
[0096] After successful establishment of the animal model, tumor growth was observed every 2 days for 4 consecutive weeks. The tumor formation rate and time were compared between the control and experimental groups. After tumor formation, the long and short diameters of the tumor were measured daily, and the tumor volume was calculated using the formula: Tumor volume = ab 2The tumor size was calculated using the formula / 2 (a is the major axis, b is the minor axis), and a tumor growth curve was plotted for mice. For drug treatment experiments, animals received nevirapine (50 mg / kg / day) alone or in combination with a cGAS inhibitor (5 mg / kg / 2 days) daily.
[0097] 9. Transcriptome bioinformatics analysis
[0098] This application performed GO gene ontology and KEGG Kyoto Encyclopedia of Genes and Genomes enrichment analyses on differentially expressed genes. RNA was extracted from lung squamous cell carcinoma patients and sent to Beijing Novogene Technology Co., Ltd. for transcriptome sequencing. Based on RNA-Seq data (GEO dataset number GSE181043), gene expression quantification and differential analysis were performed using limma-voom software (limma package version 3.54.0). The screening criteria for differentially expressed genes were: |log2(FoldChange)|>0.5 and adjust. P <0.05. A total of differentially expressed genes were identified for subsequent enrichment analysis. GO enrichment analysis aims to reveal the functional distribution characteristics of differentially expressed genes at three levels: biological processes, molecular functions, and cellular components. This application uses the clusterProfiler R package (version 4.6.2) to correct the p-values obtained from the test using the Benjamini-Hochberg method to control the false discovery rate. GO entries with corrected p<0.05 are defined as significantly enriched entries. KEGG enrichment analysis is used to explore metabolic and signal transduction pathways with significantly enriched differentially expressed genes. This analysis is also performed using the clusterProfiler R package. Similar to GO analysis, this application uses differentially expressed genes as a background and employs the hypergeometric distribution test to calculate the significance of pathway enrichment. By mapping gene identifiers (such as Gene Symbols or Entrez IDs) to the KEGG database, the pathway information to which each gene belongs is obtained. Similarly, the corrected p-values are used to determine the significant enrichment of KEGG pathways. P A value <0.05 was used as the criterion for determining significant enrichment of a pathway. To visually demonstrate the enrichment analysis results, this application used ggolot2 to create bar charts showing the most significantly enriched GO entries and KEGG pathways.
[0099] To assess the relative infiltration activity of immune cells and related pathways in the samples, this study employed Gene Set Variation Analysis (GSVA), an unsupervised and unbiased enrichment score algorithm. Gene expression levels were obtained from previous RNA-Seq analysis. Fourteen predefined gene signatures representing different immune cell subsets and immune activation or inhibition pathways were retrieved from a published immunology database (Charoentong P. et al. Genome Biol 2017). These 14 gene sets included seven signaling pathways: antigen-presenting cell co-inhibition, antigen-presenting cell co-stimulation, T cell co-inhibition, T cell co-stimulation, checkpoint inhibitors, cytotoxicity, and MHC-I; and seven immune cell subsets: dendritic cells, macrophages, neutrophils, natural killer cells, tumor-infiltrating lymphocytes, regulatory T cells, and CD8+. + T cells. Enrichment scores were calculated using the GSVA package in R. Each score represents the relative enrichment of that immune pathway in the corresponding sample; a higher score indicates higher pathway activity or higher infiltration level of the corresponding immune cells. The pL1HS positive group was compared with the pL1HS negative group, and the Wilcoxon rank-sum test was used to compare the differences in specific immune pathway activity between the groups. Violin plots were created using the ggplot2 R package (version 3.4.4) to show the distribution and differences in enrichment scores among the different groups for specific immune pathways.
[0100] III. Experimental Results
[0101] 1. In previous studies (CN108796079A, CN113913436A), this application used deFuse and ReFuse tools to find that more than 80% of lung squamous cell carcinoma samples in the TCGA database had LINE-1 insertions, mainly the L1HS subtype. By integrating public big data and local clinical sample data, high-frequency LINE-1 retrotransposable elements related to lung squamous cell carcinoma were screened out in the public database TCGA and the local database TJMUCH. Among them, L1-FGGY, L1-ATP8B1 and L1-SVEP1 are not only highly expressed in lung squamous cell carcinoma, but also significantly associated with patient prognosis, indicating high pathogenicity. Therefore, this application defines L1-FGGY, L1-ATP8B1 and L1-SVEP1 as pathogenic transposable elements pL1HS. Sequence alignment revealed that the upstream 5'-UTR regions of L1-FGGY, L1-ATP8B1, and L1-SVEP1 are identical, sharing the common sequence TGCCGCCTTGCAGTTTGATCTCAGACTGCTGTGCTAGCAATCAGCGAGATTCCGTGGGCGTAGGACCCTCGGAGCCAGGTGTGGGATATAGTCTCGTGGTGCGCCGTTTCTTAAGCCGGTCTGAAAAGCGCAATATTCGGGTGGGAGTGACCCGATTTTCCAG (SEQ ID NO.1).
[0102] L1-FGGY sequence (SEQ ID NO.40)
[0103] CGCCCCTCCCCCAGCCTCGCTGCCGCCTTGCAGTTTGATCTCAGACTGCTGTGCTAGCAATCAGCGAGATTCCGTGGGCGTAGGACCCTCGGAGCCAGGTGTGGGATATAGTCTCGTGGTGCGCCGTTTCTTAAGCCGGTCTGAAAAGCGCAATATTCGGGTGGGAGTGACCCGATTTTCCAGGTCACCGGATTGAAACTGTCTCAGGACCTTGATGATCTTGCCATTCTCTACCTGGCCACAGTTCAAGCCATTGCTTTGGGGACTCGCTTCATTATAGAAGCCATGGAGGCAGCAGGGCACTCAATCAGTACTCTTTTCCTATGTGGAGGCCTCAGCAAGAATCCCCTTTTTGTGCAAATGCATGCGGACATTACTGGCATGCCTGTGGTCCTGTCGCAAGAGGTGGAGTCCGTTCTTGTGGGT
[0104] L1 - ATP8B1 sequence (SEQ ID NO.41)
[0105] GTTGCCGCCTTGCAGTTTGATCTCAGACTGCTGTGCTAGCAATCAGCGAGATTCCGTGGGCGTAGGACCCTCGGAGCCAGGTGTGGGATATAGTCTCGTGGTGCGCCGTTTCTTAAGCCGGTCTGAAAAGCGCAATATTCGGGTGGGAGTGACCCGATTTTCCAGAATGTACATGGCAAGTCAAAGCAAACGATCGCAAGTACCACGAACAACCTCACTTTATGAACACAAAATTCTTGTGTATTAAGGAGAGTAAATATGCGAATAATGCAATTAAAACATACAAGTACAACGCATTTACCTTTATACCAATGAATCTGTTTGAGCAGTTTAAGAGAGCAGCCAATTTATATTTCCTGGCTCTTCTTATCTTACAGGCAGTTCCTCAAATCTCTACCCTGGCTTGGTACACCACACTAGTGCCCCTG
[0106] L1 - SVEP1 sequence (SEQ ID NO.42)
[0107] CCTAAGCAAGCCTGGGCAATGGTGGGCGCCCCTCCCCCAGCCTCGCTGCCGCCTTGCAGTTTGATCTCAGACTGCTGTGCTAGCAATCAGCGAGATTCCGTGGGCGTAGGACCCTCGGAGCCAGGTGTGGGATATAGTCTCGTGGTGCGCCGTTTCTT AAGCCGGTCTGAAAAGCGCAATATTCGGGTGGGAGTGACCCGATTTTCCAGCTATACTCTTGCTGGTCTTGACACCATTGAATGCCTGGCCGACGGCAAGTGGAGTAGAAGTGACCAGCAGTGCCTGGCTGTCTCCTGTGATGAGCCACCCATTGTGG
[0108] See analysis results Figure 1 The results showed that the expression of pathogenic transposable element pL1HS in lung squamous cell carcinoma was related to clinicopathological indicators such as age, sex and clinical stage, suggesting that pathogenic transposable element pL1HS is commonly present in lung squamous cell carcinoma.
[0109] 2. This invention further analyzed the correlation between the pathogenic transposon element pL1HS and prognostic and clinicopathological indicators in the above two independent lung squamous cell carcinoma cohorts. The results showed that patients with positive pathogenic transposon element pL1HS had a poorer prognosis ( Figure 2 A, Figure 2 B), and the pathogenic transposable element pL1HS leads to later clinical stage, larger tumor volume, lymph node metastasis, and distant metastasis (B). Figure 2 C). The above results confirm that the pathogenic transposable element pL1HS promotes the progression of squamous cell carcinoma of the lung.
[0110] 3. This invention demonstrates the effects of the pathogenic transposon element pL1HS on the tumor immune microenvironment, major immune cells, and immune-related pathways in two independent lung squamous cell carcinoma cohorts. Cellular experiments further confirm the effects of nevirapine reversing the pathogenic transposon element pL1HS on immune cell activation and immunosuppressive function. Specifically, GO enrichment analysis was performed on differentially expressed genes between the pL1HS-positive and pL1HS-negative groups in TJMUCH and TCGA to explore the biological process by which the pathogenic transposon element pL1HS promotes the progression of lung squamous cell carcinoma. Furthermore, the GSVA method was used to score 14 immune cells and pathways in TJMUCH and TCGA, including T cells, NK cells / macrophages, dendritic cells, antigen presentation pathway, T cell co-stimulation / co-inhibition, and cell checkpoint pathway, to analyze the specific ways in which the pathogenic transposon element pL1HS remodels the immune microenvironment of lung squamous cell carcinoma. Next, this invention constructed SK-MES-1 cells (SK-MES-1) that highly express the pathogenic transposon element pL1HS. OV -pL1HS After co-culturing the cells with the THP-1 cell line for 72 hours, the phenotype and gene expression of THP-1 were analyzed. The results showed that the pathogenic transposon element pL1HS downregulated immune response-related pathways in both independent lung squamous cell carcinoma cohorts, suggesting that the pathogenic transposon element pL1HS induces the formation of a suppressive immune microenvironment in lung squamous cell carcinoma. Figure 3 A, Figure 3 C). Further analysis revealed that the pathogenic transposon element pL1HS primarily downregulates antigen recognition and presentation pathways, as well as T cell infiltration and related functions, thereby remodeling the suppressive tumor immune microenvironment. Figure 3 B. Figure 3 D). This invention compares the effects of nevirapine treatment before and after with SK-MES-1. OV-pL1HS and SK-MES-1 OV-NC The expression of CD11b, immunosuppression-related genes, and metabolic enzymes in human THP-1 cells co-cultured with lung squamous cell carcinoma cells was detected. It was found that nevirapine treatment reversed the activation of immune cells by the pathogenic transposon element pL1HS. Figure 3 E). The above data indicate that the pathogenic transposable element pL1HS is a potential tumor marker for squamous cell carcinoma of the lung and is associated with the suppressive tumor immune microenvironment of squamous cell carcinoma of the lung.
[0111] 4. The pathogenic transposon element pL1HS of this invention promotes the activation of the cGAS-STING pathway in lung squamous cell carcinoma cells, while nevirapine and cGAS inhibitors inhibit the cGAS-STING pathway and immune cell activation in lung squamous cell carcinoma cells, thus exerting immunosuppressive functions. This is achieved through GSVA targeting SK-MES-1. OV-pL1HS and SK-MES-1 OV-NCKEGG pathway enrichment analysis of gene changes in lung squamous cell carcinoma transcriptome data revealed that the pathogenic transposon element pL1HS primarily activates the intracytoplasmic nucleic acid sensing pathway. Figure 4 A), further cluster analysis of the core genes enriched in the cytoplasmic DNA sensing pathway revealed that the pathogenic transposon element pL1HS regulates the activation of the cGAS-STING pathway ( Figure 4 B). This invention uses nevirapine or a cGAS inhibitor to treat SK-MES-1. OV-pL1HS and SK-MES-1 OV-NC Analysis of lung squamous cell carcinoma cells and detection of downstream ISGs in the cGAS-STING pathway indicated that the pathogenic transposon element pL1HS activates the cGAS-STING pathway in lung squamous cell carcinoma cell lines, while nevirapine or cGAS inhibitors can inhibit cGAS-STING activation. Figure 4 C). Next, lung squamous cell carcinoma cells (SK-MES-1) will be... OV-pL1HS / SK-MES-1 OV-NC Co-cultured with human THP-1 cells and in SK-MES-1 OV-pL1HS The co-culture group was treated with a cGAS inhibitor, and the expression of CD11b, immunosuppression-related genes, and metabolic enzymes was detected. The results showed that the cGAS inhibitor could inhibit the activation of immune cells by the pathogenic transposon element pL1HS-positive squamous cell carcinoma of the lung. Figure 4 D、 Figure 4 E).
[0112] 5. To further investigate the mechanism by which the pathogenic transposon element pL1HS affects the immune microenvironment of lung squamous cell carcinoma, this invention used immunofluorescence to discover L1-ORF1p phase separation in lung squamous cell carcinoma samples and cell lines positive for the pathogenic transposon element pL1HS. Figure 5 A, Figure 5 B) After interfering with phase separation using 1,6-hexanediol [1,6-HD, 1.5% (w / v), treatment time 5 min], the activation of the cGAS-STING pathway in lung squamous cell carcinoma and its effect on immune cell activation were examined. The results showed that 1,6-HD treatment inhibited SK-MES-1. OV-pL1HS Activation of the cGAS-STING pathway in cells ( Figure 5 C). The present invention compares SK-MES-1 before and after 1,6-HD treatment. OV-pL1HS and SK-MES-1 OV-NC The expression of CD11b, immunosuppression-related genes, and metabolic enzymes in human THP-1 cells co-cultured with lung squamous cell carcinoma cells was detected. It was found that treatment with 1,6-HD reversed the activation of immune cells by the pathogenic transposon element pL1HS. Figure 5 D、 Figure 5 E).
[0113] 6. To verify in vivo the effect of the pathogenic transposon element pL1HS on the occurrence and development of lung squamous cell carcinoma, this invention uses the mouse lung squamous cell carcinoma cell line KLN205 in logarithmic growth phase to construct KLN205 cells that highly express the mouse L1 gene (KLN205). OV-NC and KLN205 OV-L1Md A subcutaneous xenograft tumor model was constructed on the dorsal side of the upper limb of BDF1 mice (6-8 weeks old, 18-22g). After successful establishment of the animal model, tumor growth was observed every other day for 4 consecutive weeks. Mice were weighed every other day after tumor formation, and the major and minor axes of the tumors were measured. Tumor size was calculated using a formula, and tumor growth curves and mouse weight curves were plotted. By comparing the body weight and tumor size of mice in the control and experimental groups, it was found that KLN205 inoculation... OV-L1Md Cell-rich mice and control mice (KLN205) OV-NC There was no significant difference in weight among those who received KLN205, but the difference was not significant. OV-L1Md The tumor volume of the cells in mice was significantly larger than that in the control group ( Figure 6 A, Figure 6 B. Figure 6 C). This invention further examined the therapeutic effects of nevirapine and the cGAS inhibitor, finding that the tumor volume was reduced in mice treated with either nevirapine alone or the cGAS inhibitor alone, while the combined treatment of nevirapine and the cGAS inhibitor showed a more significant therapeutic effect (nevirapine group: 220.168 mm). 3 cGAS inhibitor group: 145.504 mm 3 The combined drug group: 94.987 mm 3 () Figure 6 A, Figure 6 B. Figure 6 C). None of the treatment regimens in this invention caused a decrease in mouse body weight. Figure 6 D).
[0114] The embodiments described herein are preferred embodiments of the present invention and are not intended to limit the scope of protection of the present invention. Therefore, all equivalent changes made in accordance with the structure, shape, and principle of the present invention should be covered within the scope of protection of the present invention.
Claims
1. The application of a combination of the retrotransposon inhibitor nevirapine and the cGAS inhibitor RU.521 in the preparation of a therapeutic drug for squamous cell carcinoma of the lung.
Citation Information
Patent Citations
CN108796079A
CN113913436A
CN108796079B