A chip for spatial multi-omics sequencing and a preparation method and application thereof

By using a chip design that simultaneously acquires transcriptomic and epigenomic information on the same tissue slice, the problems of error and cost in multi-omics detection are solved, and efficient and accurate multi-omics simultaneous detection is achieved.

CN121204210BActive Publication Date: 2026-04-14GUANGZHOU MEDICAL UNIV
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202511751431.6
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-11-26
Publication Date
2026-04-14
Estimated Expiration
2045-11-26

AI Technical Summary

Technical Problem

Existing technologies lack the ability to simultaneously detect multiple omics, which increases the time and economic costs of multi-slice experiments and introduces errors due to differences in cell distribution between slices, reducing data reliability and the accuracy of biological interpretation.

Method used

A chip for spatial multi-omics sequencing was designed, integrating transcriptome and epigenomic capture probes. It can simultaneously acquire spatial transcriptome and spatial open chromatin information on the same tissue slice. Through the design and enzymatic digestion of oligonucleotide probe clusters, a dual-omics probe chain is formed to achieve simultaneous detection.

Benefits of technology

It effectively avoids registration errors between multiple slices, shortens detection time, reduces costs, and improves data reliability and the accuracy of biological interpretation.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121204210B_ABST
    Figure CN121204210B_ABST
Patent Text Reader

Abstract

The application discloses a chip for spatial multi-omics sequencing and a preparation method and application thereof. The chip designed in the application is fixed with clusters of oligonucleotide probes, the oligonucleotide probes are double-omics probe chains, and the double-omics probe chains simultaneously include transcriptome and epigenome capture probes, so that spatial transcriptome and spatial open chromatin information can be synchronously acquired on the same tissue section, registration errors among multiple sections are avoided, and a more complete solution is provided for multi-modal spatial omics research.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of biological monitoring technology, specifically relating to a chip for space multi-omics sequencing, its preparation method, and its application. Background Technology

[0002] Spatial multi-omics sequencing is a rapidly developing and highly regarded emerging technology field in recent years. In biomedical research, this technology achieves high-dimensional molecular expression analysis in a morphological context by preserving and detecting the original spatial locations of molecules such as genes and proteins in tissues. It not only precisely locates the expression regions of genes and proteins but also enables researchers to more systematically reveal the molecular mechanisms of the cellular microenvironment, intercellular interactions, and tissue functional regionalization, showing great application potential, especially in fields such as tumor immunology, developmental biology, and neuroscience. Currently, mainstream spatial multi-omics technologies mainly follow two strategies: one is based on fluorescence in situ detection, using multiple fluorescent probes to bind to target molecules and employing high-resolution microscopy for imaging and quantification; the other is based on spatial coding technology, using oligonucleotide barcodes to record the location information of molecules, and then combining high-throughput sequencing and bioinformatics analysis to reconstruct the spatial topology of gene expression within tissues.

[0003] However, current technologies mostly focus on a single omics type (such as transcriptomics or proteomics), lacking the ability for true "simultaneous detection of multiple omics." They typically require separate experiments on adjacent tissue sections, followed by spatial registration using algorithms. This approach not only further increases time and economic costs but also introduces errors due to differences in cell distribution between sections, reducing the reliability of the data and the accuracy of biological interpretation. Summary of the Invention

[0004] To address the shortcomings of existing technologies, this application provides a chip for spatial multi-omics sequencing and its preparation method. The chip designed in this application has clusters of oligonucleotide probes immobilized on it. These oligonucleotide probes are dual-omics probe chains, including both transcriptome and epigenome capture probes. This allows for the simultaneous acquisition of spatial transcriptome and spatial open chromatin information on the same tissue slice, avoiding registration errors between multiple slices and providing a more complete solution for multimodal spatial omics research.

[0005] The technical solution of this invention is to provide a method for preparing a chip for space multi-omics sequencing, comprising at least:

[0006] S1. Hybridize the P7 sequence of the sequence shown in SEQ ID NO.1 with the primers on the solid support, thereby loading it onto the solid support;

[0007] SEQ ID NO.1 is: AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTVHDBVHDBNHVNHVBNHVBDNHVBDNHVDNHBNTCTTGTGACTACATCACCTCCGACTATCGATTTTTTTTTTTTTTTTTTTTTTTT TTTTTAAACAGGAACGAGTCAGCAACGTTAGACGACATCAGTACAGGATCGTBNHVBDNHVDNHVDNHBDHVNHBDHVNHVDHVNAGATCGGAAGAGCACACGTCTGAACTCCAGTCACTGCAAGCTATCTCGTATGCCGTCTTCTGCTTG;

[0008] S2. PE reversal: The p5 end of the sequence shown in SEQ ID NO.1 rebinds to the p5 site on the chip;

[0009] S3. Resynthesis: Add polymerase to form a double-stranded structure;

[0010] S4. A dual-omics probe chain formed on a solid support after enzyme digestion.

[0011] in,

[0012] AATGATACGGCGACCACCGAGATCTACA is the P5 end sequence of the oligonucleotide probe.

[0013] CTCTTTCCCTACACGACGCTCTTCCGATCT is the sequencing primer binding site sequence used to capture the transcriptome;

[0014] VHDBVHDBNHVNHVBNHVBDNHVBDNHVDNHBN is a random sequence used to capture transcriptome fragment localization;

[0015] TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT is a probe sequence used to capture transcriptome fragments;

[0016] TTTAAA is the restriction endonuclease cleavage site sequence;

[0017] AAACAGGAACGAGTCAGCA is a probe sequence used to capture epigenome fragments;

[0018] BNHVBDNHVDNHVDNHBDHVNHBDHVNHVDHVN is a random sequence used to capture epigenome fragment localization;

[0019] AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC is the sequence of sequencing primer binding sites used to capture the epigenome;

[0020] ATCTCGTATGCCGTCTTCTGCTTG is the P7 end sequence.

[0021] Furthermore, S4 is cleaved using the DraI endonuclease.

[0022] Specifically, it includes the following steps:

[0023] (1) Design an oligo library sequence, namely the sequence shown in SEQ ID NO.1, and load the constructed oligo library sequence onto the flow cell of the sequencer;

[0024] (2) Cluster generation on the flow cell;

[0025] (3) P5 linearization: The P5 strand is cut by chemical or enzymatic methods to release the template strand for sequencing;

[0026] (4) Remove the chain anchored to P7 and clean to remove unbonded impurities;

[0027] (5) Add the first group of sequencing primers to make them specifically bind to the primer binding site on the p5 side;

[0028] (6) Perform the first sequencing, repeating 38 times;

[0029] The forward primer for the first sequencing group is AATGATACGGCGACCACCGA; the reverse primer is CGATAGTTCGGAGGTGATGTAGTCA; the probe is CTTTCCCTACACGACGCTCTTC, and the probe is modified with 6-FAM and BHQ1 fluorescent groups at both ends, respectively.

[0030] (7) Remove the blocking agent, remove the primers, and wash;

[0031] (8) Add the second set of sequencing primers;

[0032] (9) Perform a second sequencing, repeating 38 times;

[0033] The second sequencing primer is AGTCAGCAACGTTAGACGACATCA; the reverse primer is CAAGCAGAAGACGGCATACGA; the probe is CAGACGTGTGCTCTTCCGATC, and the probe is modified with HEX and BHQ1 fluorescent groups at both ends, respectively.

[0034] (10) PE turns, releasing the chain anchored on P7 and reversing its direction, and the p5 end of the chain is reattached to the p5 site on the chip;

[0035] (11) Resynthesis, adding polymerase to form a double-stranded structure;

[0036] (12) Washing and finishing. After recombination, proceed directly to the washing and finishing section. This ensures that the double-stranded bridge structure remains stable at the end of sequencing. After this, DraI endonuclease is added for cleavage to separate the two different probes, and then NaOH is used to dissociate the unfixed DNA strands, leaving only the fixed dual-omics probe strands.

[0037] Since the oligo library sequence is formed by linking two oligo library sequences, the library concentration needs to be determined by dPCR. Two sequencing operations were performed, one for capturing transcriptome fragments and the other for capturing epigenome fragments. The final concentration was determined based on the percentage of double-positive droplets in the dPCR results.

[0038] The present invention also provides a chip prepared by the above method, which includes a solid support modified with primers, wherein a cluster of oligonucleotide probes is immobilized on the solid support by the primers, wherein the oligonucleotide probes are a dual-omics probe chain, including a first probe with the sequence shown in SEQ ID NO.2 and a second probe with the sequence shown in SEQ ID NO.3;

[0039] SEQ ID NO.2 is AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTVHDBVHDBNHVNHVBNHVBDNHVBDNHVDNHBNTCTTGTGACTACATCACCTCCGACTATCGATTTTTTTTTTTTTTTTTTTTTTTTTTTT;

[0040] SEQ ID NO.3 is AAACAGGAACGAGTCAGCAACGTTAGACGACATCAGTACAGGATCGTBNHVBDNHVDNHVDNHBDHVNHBDHVNHVDHVNAGATCGGAAGAGCACACGTCTGAACTCCAGTCACTGCAAGCTATCTCGTATGCCGTCTTCTGCTTG.

[0041] The present invention also provides an application of the above-mentioned chip in in situ and synchronous analysis of transcriptome and epigenomic information in tissue slices.

[0042] The present invention also provides a reagent kit comprising the aforementioned chip.

[0043] This invention also provides a method for in situ, simultaneous analysis of transcriptome and epigenomic information in tissue sections, comprising the following steps:

[0044] S1) Obtain the chip;

[0045] S2) The sample to be tested is hybridized with the chip, and after hybridization, the probe captures the corresponding gene.

[0046] Specifically, it includes the following steps:

[0047] (1) The chip for space multi-omics sequencing was prepared.

[0048] (2) The sample to be tested is hybridized with the chip. After hybridization, the probe captures the corresponding gene.

[0049] Specifically: (1) The oligo library sequence is implanted onto the chip surface;

[0050] (2) Tissue slides were mounted on the surface of a chip containing oligo library sequences, fixed, stained, and lysed, followed by Tn5 transposition reaction;

[0051] (3) Add 0.8 mg / ml proteinase K and react at 37 degrees Celsius for two hours, then add T4 polymerase + T4 ligase reaction solution and react at 25 degrees Celsius for two hours, and finally add Maxima H-reverse transcriptase and TSO primers and react at 42 degrees Celsius for more than two hours.

[0052] (4) Remove the remaining tissue on the chip surface using proteinase K;

[0053] (5) Dissociate the gDNA fragment and lyse the mRNA with 0.1N NaOH. Repeat three times. Neutralize the collected alkaline solution with 1M Tris (pH 7), and then purify it with DNA sorting magnetic beads to obtain the ATAC fragment;

[0054] (6) Perform the second-chain synthesis step: add Klenow Fragment (exo-) enzyme and Randomer primer and corresponding buffer, and react at 37 degrees for 2 hours;

[0055] (7) Repeat step (5) to obtain the complementary strand of cDNA;

[0056] (8) The complementary strands of the ATAC fragment and cDNA were pre-amplified and an NGS adapter was added. The mixture was then annealed at 60 degrees Celsius and purified with magnetic beads. The amplification primer sequences are shown below:

[0057] RPE_F:TCTTTCCCTACACGACGCTC;

[0058] RPE_R:TCAGACGTGTGCTCTTCCGA.

[0059] (9) Amplify the product from the previous step using primers carrying p5 / p7 and index; the sequences of p5 / p7 and index are as follows:

[0060] p5_fwd:

[0061] AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGAGCTCTTC.

[0062] p7_rev_index_01:

[0063] CAAGCAGAAGACGGCATACGAGATAGCTTGCAGTGACTGGAGTTCAGACGTGTGCTCTTCCGA.

[0064] p7_rev_index_02:

[0065] CAAGCAGAAGACGGCATACGAGATCTAGACGTGTGACTGGAGTTCAGACGTGTGCTCTTCCGA.

[0066] p7_rev_index_03:

[0067] CAAGCAGAAGACGGCATACGAGATGTCGATACGTGACTGGAGTTCAGACGTGTGCTCTTCCGA.

[0068] p7_rev_index_04:

[0069] CAAGCAGAAGACGGCATACGAGATTACGCGTAGTGACTGGAGTTCAGACGTGTGCTCTTCCGA.

[0070] The two libraries were amplified using p5_fwd and two different p7_rev_indexes, respectively.

[0071] (10) Sequencing was performed on the machine, followed by data processing.

[0072] The advantages of this invention are: the chip design integrates transcriptome and epigenomic capture probes, enabling simultaneous acquisition of spatial transcriptome and spatial chromatin accessibility information on the same tissue slice, effectively avoiding registration errors between multiple slices. Furthermore, it also boasts advantages such as short detection time and low cost. Attached Figure Description

[0073] Figure 1 This is a flowchart of the operation process for this application.

[0074] Figure 2 The image shows an enlarged view of the chip prepared in Example 1, and a statistical analysis of the number of barcodes in different regions of the chip.

[0075] Figure 3 This represents the percentage of lanes that passed the quality filter (PF) after sequencing.

[0076] Figure 4 HE staining of tissue and cell segmentation.

[0077] Figure 5 For every 100μm 2 The number of UMIs and genes detected within the area.

[0078] Figure 6 (a) in the table represents the unsupervised clustering results. Figure 6 (b) shows the distribution of some markers in the organization. Detailed Implementation

[0079] The following examples are provided to further illustrate the present invention and are intended to explain the invention, not to limit its scope. Unless otherwise specified, all figures are expressed in parts by weight and weight percentages.

[0080] Unless otherwise specified, the raw materials used in this invention are all conventional commercially available products; unless otherwise specified, the methods used in this invention are all conventional methods in the field.

[0081] The embodiments of the present invention will be further described below with reference to several examples.

[0082] It should be understood that the described embodiments are merely some, not all, of the embodiments in this application. All other embodiments obtained by those skilled in the art based on the embodiments in this application without inventive effort are within the scope of protection of this application.

[0083] The terminology used in the embodiments of this application is for the purpose of describing particular embodiments only and is not intended to be limiting of this application. The singular forms “a,” “the,” and “the” used in the embodiments of this application and the appended claims are also intended to include the plural forms unless the context clearly indicates otherwise.

[0084] Example 1

[0085] 1. Planting the oligo library onto the chip surface: (1) Load the constructed oligo library onto the flow cell of the sequencer;

[0086] (2) Cluster generation on the flow cell;

[0087] (3) P5 linearization: The P5 strand is cut by chemical or enzymatic methods to release the template strand for sequencing;

[0088] (4) Remove the chain anchored to P7 and clean to remove unbonded impurities;

[0089] (5) Add the first group of sequencing primers to make them specifically bind to the primer binding site on the p5 side;

[0090] (6) Perform the first sequencing, repeating 38 times;

[0091] (7) Remove the blocking agent, remove the primers, and wash;

[0092] (8) Add the second set of sequencing primers;

[0093] (9) Perform a second sequencing, repeating 38 times;

[0094] (10) PE turns, releasing the chain anchored on P7 and reversing its direction, and the p5 end of the chain is reattached to the p5 site on the chip;

[0095] (11) Resynthesis, adding polymerase to form a double-stranded structure;

[0096] (12) Cleaning, end.

[0097] Following this, DraI endonuclease is added for cleavage to separate the two different probes. Then, NaOH is used to dissociate the unfixed DNA strands, leaving only the fixed dual-omics probe strands. After rinsing with pure water and drying, a spatial dual-omics sequencing chip is generated. The pretreated chip can be stored at -20°C for at least one year. The number of barcodes carried by each swath region after probe implantation is as follows: Figure 2 As shown, one barcode corresponds to one spot. The higher the value, the stronger the chip's capture capability.

[0098] 2. Tissue sectioning and mounting. Thickness: 8-12 micrometers. First, place a suitably sized microarray onto a regular glass slide, adding 3 μL of glycerol or OCT between them for fixation. Pre-cool the slide in a microtome. After the tissue is cut and flattened, carefully transfer the tissue section onto the microarray, adjusting its position so that the microarray aligns with the area to be studied. Then, lift the slide and touch the bottom of the microarray with your finger to melt the OCT, allowing the tissue to fully adhere to the microarray surface. Finally, place the slide and microarray on dry ice for temporary storage.

[0099] 3. Tissue fixation (1% formaldehyde, room temperature, 10 min).

[0100] 4. Tissue staining: Water-soluble Eosin and Hematoxylin must be used to avoid damaging the gDNA structure.

[0101] 5. Tissue lysis. The lysis buffer was the previously published omini-ATAC formulation.

[0102]

[0103] 6. Tn5 transposition reaction (100 μl). The transposition reaction was carried out at 37 degrees Celsius for 1 hour. After completion, 25 μl of 0.1 MEDTA was added and the reaction was terminated at 37 degrees Celsius for 10 minutes.

[0104]

[0105] The 2xTD buffer is:

[0106]

[0107] 7. Add 0.8 mg / ml proteinase K, using the omini-ATAC buffer formulation.

[0108]

[0109] React at 37°C for two hours. Then rinse with 0.1x SSC + 1 U / μl RI.

[0110] 8. Add T4 polymerase + T4 ligase reaction solution.

[0111]

[0112] React at 25°C for 2 hours. Then rinse once with 0.1x SSC + 1 U / μl RI. NEB buffer r2.1 (5x, 1 ml) can be prepared as follows:

[0113]

[0114] 9. Add Maxima H-reverse transcriptase and react at 42 degrees Celsius for at least two hours (or overnight).

[0115]

[0116] 10. The next morning, aspirate the reverse transcription reaction solution, wash once with 0.1x SSC + 1 U / μl RI, and then add Exo-I reaction solution:

[0117]

[0118] 11. Remove any remaining tissue from the chip surface using proteinase K.

[0119] Proteinase K reaction solution formulation:

[0120] Proteinase K buffer (1x, 1.96ml):

[0121]

[0122] Add 200 μL of proteinase K reaction solution:

[0123]

[0124] React at 37°C for 1 hour. Afterward, repeatedly blow air through the chip surface to ensure complete removal of the microstructure. Then rinse once with 0.1x SSC.

[0125] 12. Dissociate the gDNA fragment and lyse the mRNA using 0.1N NaOH. Repeat three times. Neutralize the collected alkaline solution with 0.3 volumes of 1M Tris (pH 7), and then purify the ATAC fragment using 0.8 volumes of DNA sorting magnetic beads.

[0126] 13. While performing step 11, proceed with the second-chain synthesis step: add Klenow Fragment (exo-) enzyme, Randomer primer and corresponding buffer, and react at 37 degrees for 2 hours.

[0127]

[0128] The Randomer sequence is: 5'-TCAGACGTGTGCTCTTCCGATCTNNNNNNNNB -3'

[0129] 14. Repeat step 12. This step yields the complementary strand of cDNA.

[0130] 15. First, pre-amplify the fragments obtained in steps 11 and 13 and add NGS adapters.

[0131]

[0132] The reaction was carried out for 15 cycles, with an annealing temperature of 60 degrees Celsius. 0.8 times the volume of magnetic beads were added for purification.

[0133] 16. Amplify the product from the previous step using primers carrying p5 / p7 and the index. Specific reaction parameters can be determined using qPCR. Generally, 8-10 rounds are required. The sequences of p5 / p7 and the index are as follows:

[0134] p5_fwd:

[0135] AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGAGCTCTTC.

[0136] p7_rev_index_01:

[0137] CAAGCAGAAGACGGCATACGAGATAGCTTGCAGTGACTGGAGTTCAGACGTGTGCTCTTCCGA.

[0138] p7_rev_index_02:

[0139] CAAGCAGAAGACGGCATACGAGATCTAGACGTGTGACTGGAGTTCAGACGTGTGCTCTTCCGA.

[0140] p7_rev_index_03:

[0141] CAAGCAGAAGACGGCATACGAGATGTCGATACGTGACTGGAGTTCAGACGTGTGCTCTTCCGA.

[0142] p7_rev_index_04:

[0143] CAAGCAGAAGACGGCATACGAGATTACGCGTAGTGACTGGAGTTCAGACGTGTGCTCTTCCGA.

[0144] The two libraries were amplified using p5_fwd and two different p7_rev_indexes, respectively.

[0145]

[0146] Next, magnetic beads were used for sorting. First, 0.4 times the volume of magnetic beads were added, and the mixture was incubated at room temperature for 5 minutes. The supernatant was retained, and the magnetic beads were discarded. Then, 0.8 times the volume of magnetic beads were added, and the mixture was incubated at room temperature for 10 minutes. The supernatant was then discarded, and the magnetic beads were rinsed twice with 80% ethanol, air-dried, and eluted with 40 μl of pure water. The concentration and band distribution range (200-1000 bp) of the samples were determined using Qubit and capillary electrophoresis, respectively. The resulting library was then used for instrumentation.

[0147] 17. Sequencing. PE150, each square centimeter of sample typically requires more than 300G of data.

[0148] 18. Data processing.

[0149] like Figure 3 As shown, there are a total of 4 lanes, each using a different loading concentration. The proportion of spots that pass through the quality filter (PF) in each lane (i.e., the percentage of spots that ultimately produce effective reads) (PF value) is up to nearly 70%. Considering the original distance between two adjacent spots is 0.6 micrometers, the final effective spot spacing is approximately 0.75 micrometers.

[0150] Example 2: Mouse brain spatial transcriptome sequencing test

[0151] (1) First, the HDMI and UMI sequences of each read were cut and recorded. The cut Read2 sequence is the transcriptome cDNA sequence, and the HDMI sequence is used for spatial localization.

[0152] (2) Comparison of the sample with the HDMI sequence. The comparison sample shows HDMI and chip HDMI, and the spot corresponding to each Read is assigned according to the pairing relationship.

[0153] (3) Use STAR to align the cut Read2 sequence with the species reference genome to obtain the BAM file.

[0154] (4) Perform spot-level quantitative counting by merging the comparison reads of each spot.

[0155] 2.2 Quantitative Transcriptome Analysis

[0156] (1) The HE images of the sample slices were precisely matched with the idling data.

[0157] (2) Cells were segmented from the HE image using the Cellpose model to obtain the cell mask.

[0158] (3) The spot-level data and quantitative data are combined into cell-level data based on the cell mask.

[0159] 2.3 Downstream Analysis of Conventional Idle Running

[0160] (1) The results after comparison and quantification are H5ADs in the format of Scanpy. They can be directly read by mainstream tools such as Scanpy or Giotto for data quality control, filtering, standardization and unsupervised clustering analysis.

[0161] (2) STAGATE spatial clustering. STAGATE is an automatic embedding model that uses graph attention to adaptively learn the edge weights of the spatial neighborhood network and further utilize these weights to aggregate information from its neighbors, ultimately achieving spatial clustering.

[0162] Figure 4 Images of tissue after H&E staining (left) and images after cell identification and filtering (middle and right). After library sequencing, following gene sequence alignment and spatial coordinate projection, the unique molecular identifiers (UMIs) and gene counts identified within each cell are shown below. Figure 5 As shown.

[0163] Figure 6 (a) shows the subpopulations of mouse brain tissue cells divided by unsupervised clustering. Each "dot" in the figure represents a cell, and the color represents different cell subpopulations (or clusters). This analysis is based on the similarity of intracellular gene expression profiles, grouping cells with similar functions or states together to identify cell type diversity in tissues. Clusters of different colors correspond to different cell types such as neurons and glial cells, laying the foundation for subsequent research on cell function and interactions.

[0164] Figure 6 (b) shows the spatial distribution of specific gene expression levels in mouse brain tissue sections. The color gradients (e.g., blue → yellow) represent the levels of gene expression (the specific level needs to be determined in conjunction with the color scale on the right). These figures illustrate the expression locations of "marker genes" (genes capable of marking specific cell types or states) on two-dimensional tissue sections, providing a visual representation:

[0165] Regional enrichment of genes in tissues (e.g., some genes are highly expressed only in specific layered structures in brain regions).

[0166] Spatial differences in gene expression (compare different small images to see the similarities and differences in expression patterns).

[0167] This distribution is similar to existing publicly available data, confirming the accuracy of the chips used in this application.

[0168] The above embodiments describe in detail the structure, features, and effects of the present invention. The above description is only a preferred embodiment of the present invention. Any changes made in accordance with the concept of the present invention, or equivalent embodiments modified to have equivalent changes, shall still fall within the scope of protection of the present invention if they do not exceed the scope covered by the specification.

Claims

1. A method for fabricating a chip for space multi-omics sequencing, characterized in that, At least including: S1. Hybridize the P7 sequence of the sequence shown in SEQ ID NO.1 with the primers on the solid support, thereby loading it onto the solid support; SEQ ID NO.1 is: AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTVHDBVHDBNHVNHVBNHVBDNHVBDNHVDNHBNTCTTGTGACTACATCACCTCCGACTATCGATTTTTTTTTTTTTTTTTTTTTTTTTTAAACAGGAACG AGTCAGCAACGTTAGACGACATCAGTACAGGATCGTBNHVBDNHVDNHVDNHBDHVNHBDHVNHVDHVNAGATCGGAAGAGCACACGTCTGAACTCCAGTCACTGCAAGCTATCTCGTATGCCGTCTTCTGCTTG; where ATCTCGTATGCCGTCTTCTGCTTG is the P7 end sequence; S2. PE Redirection: The p5 end of the sequence shown in SEQ ID NO.1 is re-integrated into the p5 site on the chip; wherein, AATGATACGGCGACCACCGAGATCTACA is the p5 end sequence; S3. Resynthesis: Add polymerase to form a double-stranded structure; S4. The dual-omics probe chain formed on the solid-phase support after enzyme digestion; cleavage was performed using DraI restriction enzyme.

2. The preparation method according to claim 1, characterized in that, in, AATGATACGGCGACCACCGAGATCTACA is the P5 end sequence; CTCTTTCCCTACACGACGCTCTTCCGATCT is the sequencing primer binding site sequence used to capture the transcriptome; VHDBVHDBNHVNHVBNHVBDNHVBDNHVDNHBN is a random sequence used to capture transcriptome fragment localization; TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT is a probe sequence used to capture transcriptome fragments; TTTAAA is the restriction endonuclease cleavage site sequence; AAACAGGAACGAGTCAGCA is a probe sequence used to capture epigenome fragments; BNHVBDNHVDNHVDNHBDHVNHBDHVNHVDHVN is a random sequence used to capture epigenome fragment localization; AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC is the sequence of sequencing primer binding sites used to capture the epigenome; ATCTCGTATGCCGTCTTCTGCTTG is the P7 end sequence.

3. A chip prepared by the method of claim 1, characterized in that, It includes a solid-phase carrier modified with primers, on which a cluster of oligonucleotide probes is immobilized, wherein the oligonucleotide probes are a dual-omics probe chain, including a first probe with the sequence shown in SEQ ID NO.2 and a second probe with the sequence shown in SEQ ID NO.3; SEQ ID NO.2 is AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTVHDBVHDBNHVNHVBNHVBDNHVBDNHVDNHBNTCTTGTGACTACATCACCTCCGACTATCGATTTTTTTTTTTTTTTTTTTTTTTTTTTT; SEQ ID NO.3 is AAACAGGAACGAGTCAGCAACGTTAGACGACATCAGTACAGGATCGTBNHVBDNHVDNHVDNHBDHVNHBDHVNHVDHVNAGATCGGAAGAGCACACGTCTGAACTCCAGTCACTGCAAGCTATCTCGTATGCCGTCTTCTGCTTG.

4. The application of the chip for spatial multi-omics sequencing as described in claim 3 in in situ, synchronous analysis of transcriptome and epigenomic information in tissue slices.

5. A reagent kit, characterized in that, Includes the chip described in claim 3.

6. A method for in situ, simultaneous analysis of transcriptome and epigenomic information in tissue sections, characterized in that, Includes the following steps: S1) Obtain the chip according to claim 3; S2) The sample to be tested is hybridized with the chip, and after hybridization, the probe captures the corresponding gene.

Citation Information

Patent Citations

  • Method for establishing high-throughput sequencing library and application thereof

    CN103103624A

  • Spatial omics sequencing method, single cell epitranscriptomic sequencing method, and localization labeling method

    WO2022067565A1