Mutant of polymyxin efflux transporter and application thereof

By constructing the T38W mutant of the polymyxin efflux transporter PmxD, the problems of low polymyxin yield and insufficient self-resistance in the existing technology were solved, and the polymyxin transport capacity and self-resistance were significantly improved.

CN121293300APending Publication Date: 2026-01-09SHANDONG AGRICULTURAL UNIVERSITY

Patent Information

Application Number
CN202511626667.7
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-11-07
Publication Date
2026-01-09

AI Technical Summary

Technical Problem

Currently, there is no highly active positive mutant of the polymyxin efflux transporter protein PmxD, which has failed to effectively increase polymyxin production and enhance the self-resistance of Bacillus polymyxin to polymyxin.

Method used

A mutant of the polymyxin efflux transporter PmxD is provided, with the mutation site being T38W and the amino acid sequence shown in SEQ ID NO: 1. By constructing recombinant cells and increasing the content and activity of the PmxD transporter mutant, the transport capacity and self-resistance of polymyxin are enhanced.

Benefits of technology

At the same bacterial load, the PmxD transporter mutant showed a 450.46% increase in polymyxin transport capacity and an 85.72% increase in total polymyxin efflux, significantly enhancing the strain's growth capacity in high-concentration polymyxin environments and improving the self-resistance of Bacillus polymyxin to polymyxin.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121293300A_ABST
    Figure CN121293300A_ABST
Patent Text Reader

Abstract

The invention belongs to the technical field of gene engineering, and particularly relates to a mutant of polymyxin efflux transporter and application of the mutant. The mutant is a PmxD transporter mutant, the amino acid sequence of the PmxD transporter mutant is shown as SEQ ID NO: 1, and compared with wild type PmxD, the polymyxin transport capacity of the PmxD transporter mutant (T38W) is improved by 450.46%; and the total discharge amount of polymyxin is increased by 85.72%. Meanwhile, the mutant can significantly improve the growth ability of the strain on a plate containing 250 [mu] g / mL of polymyxin B, namely significantly improve the autoresistance of paenibacillus polymyxa to polymyxin.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of genetic engineering technology, specifically relating to a mutant of a polymyxin efflux transporter and its applications. Background Technology

[0002] In 1947, scientists first discovered polymyxin Bacillus (Bacillus polymyxa). Paenibacillus polymyxa Polymyxin, a lipopeptide antibiotic, was discovered in the products of [a specific organism / organism]. With the widespread use of antibiotics in clinical treatment, increasingly drug-resistant "superbugs" have gradually emerged. Due to the lack of novel antibiotics targeting Gram-negative multidrug-resistant strains (MDRs), polymyxins have been widely used since the mid-1990s, even playing a role in the treatment of COVID-19. Polymyxins are considered key antibiotics for treating Gram-negative MDR infections. Furthermore, *Bacillus polymyxa* is also widely used in biocontrol, and its polymyxins play an important role in antagonizing plant pathogenic bacteria.

[0003] Currently, strategies to increase polymyxin production mainly focus on optimizing fermentation media, co-culturing strains, and constructing engineered strains. For example, Cheng Jingsheng's research group increased polymyxin production through two different methods: (1) co-culturing recombinant Corynebacterium glutamicum with Bacillus polymyxinus; and (2) constructing engineered strains using Bacillus subtilis. Li Rongjie et al. successfully increased polymyxin E production to 710,000 u / mL by optimizing the culture medium composition. Similarly, Li Conghui et al. obtained the Bacillus polymyxinus mutant strain SIPI PB-N14 using traditional mutagenesis breeding techniques, increasing polymyxin B production to 1297±60 mg / L, and further improved polymyxin B production through subsequent fermentation optimization.

[0004] Polymyxin Bacillus can synthesize polymyxin intracellularly; however, high concentrations of polymyxin can damage its own cells. To reduce this damage, it needs to secrete polymyxin transmembrane via efflux transporters such as PmxC, PmxD, and YwjA. However, there are currently no formal reports on highly active positive mutants of the polymyxin efflux transporter PmxD, nor are there any studies on increasing polymyxin production or enhancing the self-resistance of polymyxin Bacillus to polymyxin through positive PmxD mutants. Summary of the Invention

[0005] To address the shortcomings of the prior art, the present invention aims to provide a PmxD transporter mutant and its applications.

[0006] To achieve the above objectives, the present invention adopts the following technical solution: In a first aspect, the present application provides a mutant of polymyxin efflux transporter, the mutant is a PmxD transporter mutant, the mutation site is T38W, and the amino acid sequence is shown as SEQ ID NO: 1.

[0007] MKKGGWLSQVKELGYLLMFMNRKRKTQYAIGLAVTALWQTLFLIAFSLVVHNLVDFAVSRDTSLMVEAFIILGAALFLENVISPWFIYLYQRSVELTVLNIRERLYDKLCRVRPRFLEQTHHGDLLSRVNNDVTTVEFTFSQVYFVLLLQVVFCIGSIVSMVLIDWRFAGVSCVILLLSSVVSLKFARDIRALSEQGLQTLGKMTEKFKDFMGGIQIVKLFRIRTIYGQYEALNEQMTQTLRQTAQKNGMQAAVNHFISYVTFCGIIVIGSLLYAYGLMGMGSVAALAVLQVNLTHALLNLGMVLSMTQNSLAGAHRIQEVLREEEEPDRLGSPHSELVSEAAVEFRDVEFSYQADKKVLVDISMQVFPGQVAAIVGASGSGKSTLIKLLLGFYPVDSGEILLQGKPFGHYTLDEIRRQIAYVPQEPFLFTGTIEENIRYGNPDATDEEVIEAAKAAYAHHFIQELPEQYKTPVGERGASLSGGQRQRIAIARAILKNAPILLLDEATSALDNESQHWVQQALNVLMKGRTTILIAHRLSTVEHADLITVMNQGTVVERGRHQDLLALGGYYARLYG (SEQ ID NO: 1).

[0008] In a second aspect, the present application provides a polynucleotide encoding the mutant of polymyxin efflux transporter.

[0009] In some embodiments of the present application, the sequence of the polynucleotide is shown as SEQ ID NO: 2.

[0010] ATGAAAAAGGGCGGATGGCTCTCGCAAGTGAAAGAACTCGGCTACTTGCTGATGTTTATGAACCGAAAGCGCAAAACCCAGTACGCCATTGGCCTGGCCGTGACG G

[0011] In a third aspect of the present application, a vector is provided, wherein the vector comprises the polynucleotide according to the present application.

[0012] In a fourth aspect of the present application, a recombinant cell is provided, wherein the recombinant cell comprises the vector according to the present application.

[0013] In a fifth aspect of the present application, the mutant or the polynucleotide or the vector or the recombinant cell according to the present application is used in any one of the following: (a1) preparing polymyxin; (a2) preparing a product containing polymyxin; (a3) improving the transport capacity of polymyxin or preparing a product improving the transport capacity of polymyxin; (a4) improving the yield of polymyxin or preparing a product improving the yield of polymyxin; (a5) improving the self-resistance of Paenibacillus polymyxa to polymyxin or preparing a product improving the self-resistance of Paenibacillus polymyxa to polymyxin.

[0014] In some embodiments of the present application, the product containing polymyxin comprises a bacteriostatic agent; preferably, the bacteriostatic agent is against gram-negative multi-drug resistant strains or plant pathogenic bacteria.

[0015] In a sixth aspect of the present application, a method for producing polymyxin is provided, comprising the following steps: Step one, constructing a recombinant cell or a recombinant microorganism capable of expressing the PmxD transporter mutant according to the present application; Step two, culturing the recombinant cell or the recombinant microorganism to obtain polymyxin.

[0016] In a seventh aspect of the present application, a method for improving the yield of polymyxin is provided, which is at least one of (b1) or (b2): The (b1) comprises the following steps: inserting the PmxD transporter mutant gene into the bacterial genome to improve the yield of polymyxin in the bacteria; The (b2) comprises the following steps: improving the content and / or activity of the PmxD transporter mutant in the bacteria, or improving the expression amount of the PmxD transporter mutant gene in the bacteria, to improve the yield of polymyxin in the bacteria; The amino acid sequence of the PmxD transporter mutant is shown in SEQ ID NO: 1; The nucleotide sequence of the PmxD transporter mutant gene is shown in SEQ ID NO: 2.

[0017] In an eighth aspect of the present application, there is provided a method for improving the ability of a polymyxin transporter, which is at least one of (c1) or (c2) as follows: The (c1) comprises the following step: inserting a PmxD transporter mutant gene into the genome of a bacterium to improve the ability of the bacterium to transport polymyxin. The (b2) comprises the following step: increasing the content and / or activity of the PmxD transporter mutant in the bacterium, or increasing the expression amount of the PmxD transporter mutant gene in the bacterium to improve the ability of the bacterium to transport polymyxin. The amino acid sequence of the PmxD transporter mutant is shown in SEQ ID NO: 1. The nucleotide sequence of the PmxD transporter mutant gene is shown in SEQ ID NO: 2.

[0018] In a ninth aspect of the present application, there is provided a method for improving the self-resistance of Paenibacillus polymyxa to polymyxin, which is at least one of (d1) or (d2) as follows: The (d1) comprises the following step: inserting a PmxD transporter mutant gene into the genome of a bacterium to improve the self-resistance of Paenibacillus polymyxa to polymyxin. The (d2) comprises the following step: increasing the content and / or activity of the PmxD transporter mutant in the bacterium, or increasing the expression amount of the PmxD transporter mutant gene in the bacterium to improve the self-resistance of Paenibacillus polymyxa to polymyxin. The amino acid sequence of the PmxD transporter mutant is shown in SEQ ID NO: 1. The nucleotide sequence of the PmxD transporter mutant gene is shown in SEQ ID NO: 2.

[0019] Compared with the prior art, the technical scheme of the present application has the following beneficial effects: In the present application, the amino acid sequence of the PmxD transporter mutant is SEQ ID NO. 1. Compared with the wild-type PmxD, the polymyxin transport capacity of the PmxD transporter mutant (PmxD T38W ) is increased by 450.46%, and the total amount of polymyxin efflux is increased by 85.72%. At the same time, the mutant can significantly improve the growth ability of the strain on a plate containing 250 μg / mL polymyxin B, i.e., the self-resistance of Paenibacillus polymyxa to polymyxin can be significantly improved. BRIEF DESCRIPTION OF DRAWINGS

[0020] In order to more clearly illustrate the technical solutions in the present application or the related art, the accompanying drawings needed in the embodiments or the related art description will be briefly introduced. Obviously, the accompanying drawings in the following description are only embodiments of the present application, and other drawings can be obtained by those skilled in the art without creative effort on the basis of these drawings.

[0021] Figure 1 Figure 2 shows the polymyxin production of PmxD expressing strains with different site mutants in the embodiments of the present application, wherein PSM2-PP represents strain SC2-M1- P pmx ∷ P xylA - ΔC / D -p; PSM2-PD represents strain SC2-M1- P pmx ∷ P xylA - Δ C / D -pPmxD; PSM2-PD T38W represents strain SC2-M1- P pmx ∷ P xylA - ΔC / D -pPmxD T38W ; PSM2-PD T38V represents strain SC2-M1- P pmx ∷ P xylA - ΔC / D -pPmxD T38V ; PSM2-PD T38R represents strain SC2-M1- P pmx ∷ P xylA - ΔC / D -pPmxD T38R ; PSM2-PD K383A represents strain SC2-M1- P pmx ∷ P xylA - ΔC / D -pPmxD K383A ; marked **, representing a highly significant difference, P <0.01; Figure 2 Figure 3 shows the polymyxin production of mutant PmxD (T38W) expressing strains under high-density culture conditions in the embodiments of the present application, wherein PSM2-PD represents strain SC2-M1- Ppmx ∷ P xylA - ΔC / D -pPmxD; PSM2-PD T38W represents strain SC2-M1- P pmx ∷ P xylA - ΔC / D -pPmxD T38W ; ** indicates a highly significant difference, P <0.01; Figure 3 is a schematic representation of the effect of mutant PmxD (T38W) on the polymyxin self-resistance of the expression strain, wherein PSM2-PP represents strain SC2-M1- P pmx ∷ P xylA - ΔC / D -p; PSM2-PD represents strain SC2-M1- P pmx ∷ P xylA - ΔC / D -pPmxD; PSM2-PD T38W represents strain SC2-M1- P pmx ∷ P xylA - ΔC / D -pPmxD T38W . DETAILED DESCRIPTION

[0022] It should be noted that the following detailed description is exemplary in nature and is intended to provide further description of the application. Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application belongs.

[0023] It is also important to note that the terms used herein are not intended to limit the exemplary embodiments to the specific embodiments which can be illustrated by the examples, but rather, exemplary embodiments are meant to provide illustrative examples of how embodiments of the application can be made and utilized. Other embodiments of the application will be apparent to those skilled in the art from consideration of the specification and practice of the application disclosed herein. Furthermore, it is intended that the specification and examples be considered as exemplary methods of practicing the application, and that other embodiments of the application can be utilized as well. It is therefore intended that the specification and examples be considered as illustrative of the more general application which can be practiced in other ways. It is also intended that the specification and examples be considered as non- limiting examples of the application described herein.

[0024] As mentioned earlier, there are no formal reports in the prior art regarding highly active positive mutants of the polymyxin efflux transporter PmxD, nor are there any studies on improving polymyxin production and enhancing the self-resistance of *Bacillus polymyxinus* to polymyxin through positive mutants of PmxD. Therefore, this invention, based on a strain model of polymyxin secretion and synthesis, investigates the effects of mutants of the polymyxin efflux transporter PmxD on polymyxin efflux capacity and self-resistance, aiming to identify key mutation sites affecting polymyxin efflux capacity and self-resistance, and to provide a molecular basis for related research on improving polymyxin production.

[0025] This invention, through research on multiple mutation sites of the PmxD transporter protein, found that the mutant with the T38W mutation site, compared with the wild-type strain, exhibits a 450.46% increase in polymyxin transport capacity and an 85.72% increase in total polymyxin efflux. Simultaneously, this mutant significantly enhances the strain's growth ability on plates containing 250 μg / mL polymyxin B, thus significantly improving the self-resistance of *Bacillus polymyxinus* to polymyxin.

[0026] To enable those skilled in the art to better understand the technical solution of the present invention, the technical solution of the present invention will be described in detail below with reference to specific embodiments.

[0027] The strains and plasmids used in the following examples are shown in Table 1. Among them, *Bacillus polymyxa* (… P . polymyxa SC2-M1) is mentioned in the article "Metabolic engineering of" by Jikun Zhang, Jianzhi Zhao, Quanbin Fu, Haiyang Liu, Min Li, Zhongyue Wang, Wei Gu, Xueming Zhu, Rongshan Lin, Li Dai, Kai Liu, and Chengqiang Wang*. Paenibacillus polymyxa for effective production of 2,3-butanediol from poplar hydrolysate. Bioresource Technology The plasmid pHY300PLK was published in the article Hui Li, Yanqin Ding, Jianzhi Zhao, Ruofei Ge, Benhua Qiu, Xiaoli Yang, Liangtong Yao, Kai Liu, Chengqiang Wang*, Binghai Du. Identification of a native promoter.P LH-77 for gene expressionin Paenibacillus polymyxa . Journal of biotechnology, 2019;295:19-27. In the present invention, Paenibacillus polymyxa (PSM2, PSM2-PP and PSM2-PD) and plasmid PHY300PLK- cm r - P lipA1 In the patent "Wangchengqiang, Liu Kai, Pei Jian, Dai Li, Liu Haiyang, Li Min, Hou Yao-hui, Wang Chunxue. A polymyxin secretion engineering strain and its construction method and application, Chinese invention patent, application number: 202410673453.4, application date: 2024.5.28. Applicant (patent right): Shandong Agricultural University." is disclosed. The above strains and plasmids can be obtained from Shandong Agricultural University, and the above biological materials are only used for repeating the relevant experiments of the present invention and cannot be used for other purposes.

[0028] Table 1 Strains and plasmids

[0029] The culture medium used in the following examples is shown in Table 2.

[0030] Table 2 Culture medium

[0031] The primers required in the following examples are shown in Table 3.

[0032] Table 3 Primers

[0033] Example 1 Screening of mutation sites Download all Paenibacillus polymyxa genome sequences from NCBI, use TB Tools software to screen the amino acid sequence of PmxD in each strain, and find the conservative and non-conservative amino acid sequence by Cluster X online alignment. Using the amino acid sequence and transmembrane region of the multi-drug resistant protein Sav1866 in Staphylococcus aureus as a template, the three-dimensional structure of PmxD was homology modeled using SWISS-MODLE software. Homologous alignment of Sav1866 and PmxD was performed to predict the transmembrane domain sequence of protein PmxD, and T38W, T38V, T38R and K383A mutations were obtained by screening.

[0034] Example 2 Construction of expression vector and transformation of engineering bacteria 1. Construction of mutant vector (1) pHY300PLK- cmr- PlipA1 - pmxD T38W Construction: Based on Bacillus polymyxa P. polymyxa Using the SC2-M1 genome as a template, amplification was performed using primers PMD-F (SEQ ID NO: 3) and PMD-R (SEQ ID NO: 4) to obtain... pmxD Gene fragments. The upper fragment of the mutated gene was amplified using primer PMD-F (SEQ ID NO: 3) and primer R (SEQ ID NO: 6) for the mutation site, and the lower fragment was amplified using primer F (SEQ ID NO: 5) and primer PMD-R (SEQ ID NO: 4). After amplification of both fragments, gene fragment fusion was performed using primers PMD-F (SEQ ID NO: 3) and PMD-R (SEQ ID NO: 4) to obtain the mutated gene fragment. Specifically, the obtained fragments... pmxD Using the gene fragment as a template, amplification was performed using primer sets PMD-F and T38W-R, and primer sets T38W-F and PMD-R, respectively, to obtain products 1 and 2. Products 1 and 2 were mixed, denatured, and then extended using DNA polymerase to obtain product 3. Using product 3 as a template, amplification was performed using primer sets PMD-F and PMD-R, followed by gel extraction and sequencing to verify the sequence was correct. pmxD T38W Gene fragments. Restriction endonucleases were used. Bam HⅠ and Eco R Ⅰ linearized carrier pHY300PLK- cm r - P lipA1 The linearized vector pHY300PLK- was ligated using the OK Clon DNA Ligation Kit (catalog number: AG11812) manufactured by Acrel Biotech. cm r - P lipA1 and pmxD T38W Gene fragment ligation yielded plasmid pHY300PLK- cm r - P lipA1 - pmxD T38W For specific steps, please refer to the kit instructions.

[0035] (2) pHY300PLK- cmr - PlipA1 - pmxD T38V pHY300PLK- cmr - PlipA1 -pmxD T38R , pHY300PLK- cmr - PlipA1 - pmxD K383A , pHY300PLK- cmr - PlipA1 - pmxD T38W , pHY300PLK-

[0036] 2. Paenibacillus polymyxa transformation (1) Paenibacillus polymyxa SC2-M1- P pmx ∷ P xylA - ΔC / D Preparation of competent cells Take the original strain SC2-M1- P pmx ∷ P xylA - ΔC / D Streak activation, pick single colonies into liquid LB medium, shake flask culture for 12 h, inoculate 50 mL sorbitol LB liquid medium at 2% inoculation amount, shake flask culture to OD 600 = 0.6-0.8, ice for 10 min; 5000 rpm centrifugation for 10 min, remove supernatant, resuspend the precipitate with 2 mL Solution A, 5000 rpm centrifugation for 10 min, repeat the above steps twice, resuspend with 2 mL Solution A and then distribute 100 μL per 1.5 mL centrifuge tube, store in -80℃ refrigerator for standby.

[0037] (2) Electroporation of Paenibacillus polymyxa SC2-M1- P pmx ∷ P xylA - ΔC / D Competent cells Take the competent cells from the -80℃ refrigerator and place in an ice water bath, after the cells are thawed, add 10 μL recombinant plasmid pHY300PLK- cm r - P lipA1 - pmxD T38WGently mix, and take 100 μL of the mixture into a pre-cooled sterile 1 mm size electrotransformation cup. Set the electroshock parameters: voltage U = 2000 V, capacitance C = 25 μF, resistance R = 200 Ω, and quickly wipe off the moisture around the electrotransformation cup for electroshock. After the electroshock is completed, add 600 μL of Solution B solution into the electrotransformation cup and mix well. Take the mixture in the electrotransformation cup into a sterile centrifuge tube, and incubate at 37°C with shaking at 180 rpm for 3 h. After the incubation, centrifuge at 8000 rpm for 3 min to collect the bacterial cells, which are then spread on a chloramphenicol-resistant plate and incubated at 37°C. After colonies grow on the plate, single colonies are picked for colony PCR. The strains successfully transformed are PSM2-PD T38W .

[0038] (3) Refer to the electrotransformation steps of pHY300PLK- cm r - P lipA1 - pmxD T38W , respectively, to construct PSM2-PD T38V , PSM2-PD T38W , and PSM2-PD K383A .

[0039] Example 3 Verification of the ability of PmxD and its mutant PmxD strains to overexpress polymyxin efflux Strains PSM2-PP, PSM2-PD, PSM2-PD T38R , PSM2-PD T38V , PSM2-PD T38W , and PSM2-PD K383A were taken out from the -80°C refrigerator and activated on a plate. After being transferred into 10 μg / mL chloramphenicol-resistant liquid LB medium and incubated at 37°C with shaking at 180 rpm for 12 h, the strains were activated twice to calculate the inoculation amount, which was then inoculated into the fermentation medium to adjust the initial strain OD 600=0.1, cultured on a shaker at 37℃ and 180 rpm. At 6 h, 0.5% Xylose (0.1 g / mL) was added, and 1 mL was taken as a sample at 24 h. Centrifuged at 12000 rpm for 10 min, and the supernatant was collected and stored at -20℃. 50 mL of agar was horizontally spread in petri dishes, with 24 Oxford cups placed in each dish. After the semi-solid LB medium temperature dropped below 50℃, 1% *E. coli* DH5α was added, shaken well, and 50 mL was spread evenly in the petri dishes. After the semi-solid medium solidified, the Oxford cups were removed, and 80 μL of the 24-hour fermentation supernatant was added to each well. The mixture was incubated at 37℃ for 12 h, and the diameter of the antagonistic zone was measured. The antagonistic zone diameter was substituted into the polymyxin antagonism standard curve formula to calculate the polymyxin efflux. Simultaneously, 24-hour fermentation suspensions of each strain were diluted, plated, and the viable cell count was determined. The results are as follows: Figure 1 As shown, under the same bacterial load, compared with the overexpression of wild-type protein PmxD, the polymyxin efflux of the PmxD (T38W) mutant strain was increased by 450.46% ( P <0.01), the polymyxin efflux of overexpression mutants T38R and T38V was not significantly different from that of wild-type protein, while the polymyxin efflux transport rate of overexpression mutant K383A was similar to that of empty plasmid strain (PSM2-PP), and the protein mutant had no transport activity.

[0040] The strain PSM2-PD and the strain with the highest polymyxin efflux efficiency were selected. T38W OD of initial inoculation 600 The concentration was increased to 6, and the culture medium was inoculated at a high density. After shaking culture for 24 h, the fermentation broth was collected. The antagonistic zone diameter was measured and substituted into the polymyxin antagonism standard curve formula to calculate the polymyxin yield. The results are as follows: Figure 2 As shown, within 24 hours, the polymyxin production of the mutant PmxD(T38W) expression strain was increased by 85.72% compared to the wild-type PmxD expression strain. P The difference was <0.01, indicating a highly significant difference.

[0041] Example 4: Drop plate experiment to verify strain self-resistance strains PSM2-PP, PSM2-PD, and PSM2-PD (which showed the highest polymyxin efflux efficiency) were taken from a -80℃ freezer. T38W The strain was activated on plates, then transferred to liquid culture medium for a second transfer. The initial OD of the strain was adjusted. 600 =0.1, 37℃, 180 rpm shaking culture until OD 600 =0.6. The cultured strains were serially diluted 10-fold to 10-10.-4 , 2 μL of different dilution gradient bacterial solution was dropped on solid LB plates containing different concentrations (0 μg / mL, 150 μg / mL, 250 μg / mL) of polymyxin B, and incubated at 37°C for 24 h. After incubation, the plates were photographed and recorded. As shown in Figure 3 , the mutant PmxD (T38W) expression strain grew better than the wild-type transporter PmxD expression strain in the medium containing 150 μg / mL polymyxin B, and could grow in the medium containing 250 μg / mL polymyxin B, and the resistance to polymyxin was significantly higher than that of the wild-type PmxD expression strain, indicating that PmxD (T38W) could significantly enhance the self-resistance of the strain to polymyxin.

[0042] Finally, it should be noted that the above only describes the preferred embodiments of the present application and is not intended to limit the present application. Although the present application has been described in detail with reference to the foregoing embodiments, those skilled in the art can still modify the technical solutions described in the foregoing embodiments or make equivalent replacements to some parts. Any modification, equivalent replacement, improvement, etc. made within the spirit and principles of the present application shall be included in the protection scope of the present application.

Claims

1. A mutant of a polymyxin efflux transporter, characterized in that, The mutant is a PmxD transporter mutant, and its amino acid sequence is shown in SEQ ID NO:

1.

2. A polynucleotide, characterized in that, The polynucleotide encodes the mutant as described in claim 1.

3. A carrier, characterized in that, The vector comprises the polynucleotide of claim 2.

4. A recombinant cell, characterized in that, The recombinant cells comprise the vector as described in claim 3.

5. The use of the mutant of claim 1, the polynucleotide of claim 2, the vector of claim 3, or the recombinant cell of claim 4 in any of the following: (a1) Preparation of polymyxin; (a2) Prepare products containing polymyxin; (a3) Improve polymyxin transport capacity or prepare products that improve polymyxin transport capacity; (a4) Increase the yield of polymyxin or prepare products that increase the yield of polymyxin; (a5) Improve the self-resistance of Bacillus polymyxin to polymyxin or prepare products that improve the self-resistance of Bacillus polymyxin to polymyxin.

6. The application as described in claim 5, characterized in that, The products containing polymyxin include antibacterial agents.

7. The application as described in claim 6, characterized in that, The antibacterial agent is effective against Gram-negative multidrug-resistant strains or plant pathogenic bacteria.

8. A method for producing polymyxin, characterized in that, Includes the following steps: Step 1: Construct recombinant cells or recombinant microorganisms capable of expressing the mutant described in claim 1; Step 2: Cultivate the recombinant cells or recombinant microorganisms to obtain polymyxin.

9. A method for improving polymyxin transport capacity, characterized in that, It is at least one of the following (c1) or (c2): The (c1) step includes the following steps: inserting a PmxD transporter mutant gene into the bacterial genome to improve the polymyxin transport capacity in bacteria; The (b2) includes the following steps: increasing the content and / or activity of PmxD transporter mutants in bacteria, or increasing the gene expression level of PmxD transporter mutants in bacteria, thereby improving the polymyxin transport capacity in bacteria; The amino acid sequence of the PmxD transporter mutant is shown in SEQ ID NO: 1; The nucleotide sequence of the PmxD transporter mutant gene is shown in SEQ ID NO:

2.

10. A method for improving the self-resistance of *Bacillus polymyxa* to polymyxins, characterized in that, It is at least one of the following (d1) or (d2): The (d1) step includes the following steps: inserting the PmxD transporter mutant gene into the bacterial genome to enhance the self-resistance of polymyxin-resistant Bacillus polymyxin in bacteria; The (d2) step includes the following steps: increasing the content and / or activity of PmxD transporter mutants in bacteria, or increasing the expression level of PmxD transporter mutant genes in bacteria, thereby improving the self-resistance of polymyxin-resistant Bacillus polymyxin in bacteria; The amino acid sequence of the PmxD transporter mutant is shown in SEQ ID NO: 1; The nucleotide sequence of the PmxD transporter mutant gene is shown in SEQ ID NO: 2.

Citation Information

Patent Citations

  • Polymyxin secretion engineering strain as well as construction method and application thereof

    CN118792230A

Cited By

  • Polymyxin secretion engineering strain as well as construction method and application thereof

    CN118792230A

  • A polymyxin secretion engineering strain, a construction method and application thereof

    CN118792230B

  • Recombinant polymyxin enzyme as well as preparation and application methods thereof

    CN121555478A