Application of exosome loaded with ENO1 protein in preparation of product for treating fertility decline of elderly women

Abstract

The invention discloses an application of an exosome loaded with ENO1 protein in preparation of a product for treating female fertility decline. The method comprises the following steps: transfecting a lentivirus overexpression vector containing an ENO1 gene into a 293T cell, culturing, collecting a cell supernatant, and separating to obtain the exosome loaded with the ENO1 protein. Experimental results show that after the exosome delivers the protein ENO1, the number of primordial follicles, secondary follicles and sinus follicles can be remarkably increased, and the state of low ovarian function is improved; meanwhile, the mitochondrial function of granular cells is enhanced, and the energy metabolism level is promoted. A further research shows that the ENO1 can be specifically combined with mitochondrial outer membrane protein VDAC1, the mitochondrial membrane potential is stabilized, and the mitochondrial structure integrity of the oocyte is recovered, so that the energy metabolism in the oocyte is improved. Therefore, the invention provides a new treatment strategy for the fertility decline of the elderly women, and can be widely used for treating the fertility decline of the elderly women.

Description

Technical Field

[0001] This invention relates to the field of biomedical technology, and in particular to the application of exosomes loaded with ENO1 protein in the preparation of products for treating fertility decline in older women. Background Technology

[0002] Among patients seeking assisted reproductive technology (ART) at ART centers, those over 35 years old account for more than 50%. The main reason is the decline in the quality and quantity of eggs in older women, resulting in a lower success rate of ART. The core pathologies include gene mutations, telomere shortening, metabolic disorders, and abnormalities in mitochondrial structure.

[0003] Exosomes carrying miRNAs, mRNAs, and proteins have been shown to participate in bidirectional communication between granulosa cells and oocytes, regulating granulosa cell function and steroid hormone production, participating in oocyte maturation and ovulation, and mediating the maintenance and regulation of the ovarian microenvironment. In patent CN117562928A, exosomes from follicular fluid of young women, injected via the tail vein into aged mouse models, significantly increased the number of primordial follicles, secondary follicles, and antral follicles, indicating that exosomes from follicular fluid of young women improved the state of ovarian hypofunction in older mice. However, which factors in exosomes from follicular fluid of young women play a key regulatory role in improving ovarian function in older mice remains unknown.

[0004] Furthermore, the applicant's previous exosome proteomics analysis and experimental data showed that EON1 expression was significantly reduced in follicular fluid exosomes of older women, with an abundance 2.3 times lower than that of younger women (P<0.01) (Mol CellProteomics. 2025 Apr;24(4):100930). However, whether the reduction in EON1 expression is involved in the decline of ovarian reserve and fertility in older women remains unknown.

[0005] Therefore, existing technologies still need to be improved and developed. Summary of the Invention

[0006] In view of the shortcomings of the prior art, the purpose of this invention is to provide the application of exosomes loaded with ENO1 protein in the preparation of products for treating fertility decline in older women, aiming to solve the problem of the lack of utilization of ENO1 regulatory mechanism to improve ovarian function in older women in the prior art.

[0007] The technical solution of the present invention is as follows: In a first aspect, the invention provides the use of exosomes loaded with ENO1 protein in the preparation of products for treating female fertility decline.

[0008] Optionally, the exosomes are prepared by the following steps: constructing a lentiviral overexpression vector containing the ENO1 gene and transfecting it into 293T cells to obtain cells expressing ENO1; collecting the cell supernatant after culture and separating the exosomes.

[0009] Optionally, the product may be at least one of increasing the number of primordial follicles, increasing the number of secondary follicles, and increasing the number of antral follicles.

[0010] Optionally, the product is for improving ovarian mitochondrial function.

[0011] Optionally, the improvement of ovarian mitochondrial function includes enhancing the function of mitochondria in granulosa cells; and / or restoring the integrity of mitochondria in oocytes.

[0012] Optionally, the exosomes may be circular or elliptical in shape.

[0013] Optionally, the diameter of the exosomes is 30-150 nm.

[0014] Optionally, the product is an exosome suspension; the exosome suspension is prepared by resuspending exosomes loaded with ENO1 protein in phosphate buffer solution.

[0015] A second aspect of the invention provides a product for treating fertility decline in older women, the product comprising exosomes loaded with the ENO1 protein.

[0016] Beneficial effects: (1) Exosomes loaded with ENO1 protein significantly improve ovarian insufficiency: By constructing an exosome delivery protein α-enolase (ENO1) system and injecting it into elderly mice, the number of primordial follicles, secondary follicles and antral follicles were significantly increased, ovarian tissue structure and function were restored, and the ovarian reserve function of elderly women was improved.

[0017] (2) ENO1 can specifically bind to VDAC1 in granulosa cells, reducing VDAC1 oligomerization, stabilizing mitochondrial membrane potential, and improving energy metabolism in oocytes.

[0018] (3) Exosomes loaded with ENO1 protein can improve the reproductive function of older mice: After treatment with ENO1 delivered by exosomes, the maturation rate, fertilization rate and blastocyst formation rate of mouse oocytes increased significantly, and the pregnancy rate and number of offspring increased, proving that it can effectively improve the quality of reproductive cells and overall fertility.

[0019] (4) Exosomes loaded with ENO1 protein can activate primordial follicles and delay reproductive aging: Exosome delivery of ENO1 promotes the activation and development of primordial follicles by activating the PI3K / Akt / mTOR signaling pathway, delays the aging of germ cells in older mice, and prolongs the reproductive window period. Attached Figure Description

[0020] Figure 1 To construct the human ENO1 expression plasmid, exosomal ENO1 was collected; (A) PLV5-CMV-ENO1(human)-3xFLAG-CopGFP-Puro expression plasmid was constructed; (B) the procedure for preparing exosomal delivery of ENO1 was performed; (C) exosomal ENO1 was identified and expressed Alix, TSG101, CD81 and ENO1; (D) the particle size and distribution of ENO1-Exos were revealed by nanoparticle tracking analysis (NTA); (E) the size and morphology of ENO1-Exos were observed by transmission electron microscopy.

[0021] Figure 2 Evaluation of ovarian development, follicular maturation, and ovarian mitochondrial structure in aged mice treated with exosome delivery of ENO1. (A) Ovarian development after treatment in the young control group (2 months old, Young ctrl), aged group (8 months old, Aging ctrl), young female follicular fluid exosome treatment group (FYY-exo), and exosome delivery of ENO1 (ENO1-exo) (scale bar: 1 cm). (B) Ovarian tissue weight statistics for each group. n = 6 / group, * indicates P<0.05, **** indicates P<0.0001. Compared with Aging ctrl, # indicates P<0.01, ### indicates P<0.001. (C) HE staining evaluation of ovarian tissue in each group, showing follicular growth at each stage (scale bar: 400 nm). (D) Analysis of the number of follicles at each stage of ovarian tissue development. n = 5 per group, # represents the control group and Aging ctrl, # indicates P<0.05, and # indicates P<0.01. The identifier on the bar chart of the Aging ctrl group indicates that Aging ctrl is compared with the most recent YFF-Exos or ENO1-Exos, ns indicates no statistical significance, and * indicates P<0.05. (E) Transmission electron microscopy observation of the ultrastructure of mitochondria in ovarian tissue of each group. (Scale bar: 2μm, 500nm), the yellow box is the magnified part of the figure below, and the red arrow is the mitochondrial structure of ovarian tissue.

[0022] Figure 3 Delivery of ENO1 protein to exosomes can enhance mitochondrial function in granulosa cells; among which Figure 3 China A Figure 3In a human granulocyte culture system, immunoblotting quantitatively revealed that treatment with exosomes ENO1 upregulated the expression of ENO1. Figure 3 C, Figure 3 D: Mitochondria isolated from treated granulosa cells showed elevated ENO1 levels; Figure 3 E: Immunofluorescence confirmed that ENO1 is located near or overlapped with mitochondria; Figure 3 In the F-cell region, exosome delivery not only increased ENO1 expression but also rescued mitochondrial dysfunction in cisplatin-damaged cells, such as ΔΨm recovery (p<0.01). Figure 3 G: This indicates enhanced mitochondrial expression.

[0023] Figure 4 Exosome delivery of ENO1 protein specifically binds to VDAC1, reducing VDAC1 oligomerization, stabilizing mitochondrial membrane potential, and improving energy metabolism in oocytes. Specifically, (A) immunofluorescence results of ENO1 (red) and VDAC1 (green) in the granulosa cell control group, exosome incubation group, cisplatin-induced premature aging group, and exosome treatment rescue group showed that exosome delivery of ENO1 significantly increased ENO1 expression. (B) Immunofluorescence intracellular localization results of ENO1 (red) and VDAC1 (green) under a 63X confocal microscope in the granulosa cell control group, exosome incubation group, cisplatin-induced premature aging group, and exosome treatment rescue group showed that the two proteins co-localize. (C) Western blot results of VDAC1 protein haploid (monomer), its oligomeric diploid (Di), and triploid (Tri) in granulosa cell control group, hydrogen peroxide-induced ROS senescence group, and exosome-treated rescue group showed that exosome treatment could alleviate ROS-induced EDAC1 oligomerization in senescent granulosa cells. (D) The protein expression levels of VDAC1 protein haploid in granulosa cell control group, hydrogen peroxide-induced ROS senescence group, and exosome-treated rescue group were quantitatively analyzed by Image J (P-value < 0.01).

[0024] Figure 5 Two weeks after treatment with ENO1 protein via exosome delivery, aging mice were induced to superovulate by continuous injection of PMSG (5 IU) and hCG (5 IU) at 48-hour intervals. Figure 5 China A Figure 5 The results in Figure B show that after ENO1-exo treatment, there was no statistically significant difference in the number of oocytes between the older age group and the ENO1 treatment group; Figure 5 C, Figure 5 Mitotracker staining showed that ENO1-exo treatment reduced mitochondrial fragmentation in oocytes. Figure 5 Chinese E, Figure 5Further analysis using JC-1 assays showed that the mitochondrial membrane potential was restored (p<0.001), confirming functional recovery.

[0025] Figure 6 PI3K / AKT signaling was activated in exosomes from young women (rich in high ENO1), promoting the activation of primordial follicles. (A) After treatment with exosomes from young women, the expression levels of PI3K, AKT, and phosphorylation in collected primordial follicles were analyzed by immunohistochemical staining. The rectangular boxes represent primary follicles in each figure. Red arrows indicate oocytes, while blue arrows indicate granulosa cells surrounding the follicles. Scale bar = 100 μm. (B) After treatment with exosomes from young women, the expression levels of PI3K, AKT, and phosphorylation in collected activated follicles were analyzed by immunohistochemical staining. Red arrows indicate oocytes, while blue arrows indicate granulosa cells surrounding the follicles. Additionally, purple arrows indicate cumulus cells surrounding the oocytes. Scale bar = 100 μm. Detailed Implementation

[0026] This invention provides the application of exosomes loaded with ENO1 protein in the preparation of products for treating fertility decline in older women. To make the objectives, technical solutions, and effects of this invention clearer and more explicit, the invention is further described in detail below. It should be understood that the specific embodiments described herein are merely illustrative of the invention and are not intended to limit the invention.

[0027] Unless otherwise specified, the experimental methods used in the following examples are conventional methods, and the materials and reagents used are commercially available unless otherwise specified.

[0028] Terminology Explanation: In this invention, "exosome delivery of ENO1 protein" refers to "exosomes loaded with ENO1 protein", which means that ENO1 is precisely delivered through the exosome pathway.

[0029] ENO1 is a key enzyme in glycolysis, catalyzing the conversion of 2-phosphoglycerate to phosphoenolpyruvate, and also catalyzing the reverse reaction to convert phosphoenolpyruvate back to 2-phosphoglycerate. Besides its role in glycolysis, ENO1 also maintains mitochondrial membrane stability, regulates the AMPK-mTOR and PI3K-AKT signaling pathways, and participates in the production of important exosome components.

[0030] This invention provides the application of exosomes loaded with ENO1 protein in the preparation of products for treating female fertility decline.

[0031] Verification has demonstrated that ENO1 is a key factor in improving fertility by maintaining mitochondrial membrane stability, enhancing energy metabolism in the ovarian microenvironment, improving low ovarian reserve. Therefore, this invention utilizes exosomes for targeted delivery, ensuring ENO1's efficient effect in ovarian tissue. Compared to traditional hormone or chemical drug interventions, this invention offers advantages such as natural safety and low immune response.

[0032] Optionally, the exosomes are prepared by the following steps: constructing a lentiviral overexpression vector containing the ENO1 gene and transfecting it into 293T cells to obtain cells expressing ENO1; collecting the cell supernatant after culture and separating the exosomes.

[0033] By constructing a lentiviral overexpression vector, exosomes loaded with ENO1 protein are prepared, enabling ENO1 to be continuously expressed at a high level in cells and reducing the degradation or loss of ENO1 protein during extraction; moreover, this preparation process is suitable for clinical translation.

[0034] Optionally, the product may be at least one of increasing the number of primordial follicles, increasing the number of secondary follicles, and increasing the number of antral follicles.

[0035] In older mice, delivery of ENO1 protein via exosomes significantly improved ovarian development, significantly increasing the number of primordial follicles, secondary follicles, and antral follicles.

[0036] Optionally, the product is for improving ovarian mitochondrial function.

[0037] Exosome delivery of ENO1 protein primarily improves ovarian development by enhancing ovarian mitochondrial function.

[0038] Optionally, the improvement of ovarian mitochondrial function includes enhancing the function of mitochondria in granulosa cells; and / or restoring the integrity of mitochondria in oocytes.

[0039] In granulosa cells, exosome delivery of ENO1 protein can increase mitochondrial membrane potential and restore damaged mitochondrial activity; in oocytes, exosome delivery of ENO1 protein can significantly reduce mitochondrial breakage and restore their energy production capacity. Therefore, the repair mechanism of exosome delivery of ENO1 protein not only maintains the homeostasis of the follicular microenvironment but also provides energy support for oocyte maturation and ovulation.

[0040] Optionally, the exosomes may be circular or elliptical in shape.

[0041] Optionally, the diameter of the exosomes is 30-150 nm.

[0042] Optionally, the product is an exosome suspension; the exosome suspension is prepared by resuspending exosomes loaded with ENO1 protein in phosphate buffer solution.

[0043] Exosome suspensions facilitate injection or local application, maintaining the exosomes' activity and dispersibility. PBS resuspension systems offer good physiological compatibility, preventing exosome aggregation or sedimentation, and are beneficial for storage and clinical handling.

[0044] A second aspect of the invention provides a product for treating fertility decline in older women, the product comprising exosomes loaded with the ENO1 protein.

[0045] This product improves ovarian energy metabolism, repairs mitochondrial function, and promotes follicle development by providing exogenous ENO1, thereby restoring ovarian reserve function as a whole. Mouse experiments have demonstrated that this product can significantly increase oocyte maturation rate, fertilization rate, and blastocyst formation rate, exhibiting good safety and efficacy, and providing a safe treatment option for fertility decline in older women.

[0046] This invention provides the application of exosomes loaded with ENO1 protein in the preparation of products for treating fertility decline in older women.

[0047] The present invention will be further described below through specific embodiments.

[0048] Example 1 This embodiment provides a method for the preparation and identification of ENO1 exosomes, specifically including: (1) Constructing the PLV5-CMV-ENO1(human)-3xFLAG-CopGFP-Puro overexpression plasmid: In this embodiment, the ENO1 (human) gene is derived from the NCBI database, specifically: Homo sapiensenolase 1 (ENO1), transcript variant 1, mRNA NCBI Reference Sequence: NM_001428.5; using the LV5 vector (GenePharma).

[0049] The preparation process of the PLV5-CMV-ENO1(human)-3xFLAG-CopGFP-Puro overexpression plasmid is as follows: Primer design and PCR amplification: Primers were designed based on the restriction enzyme sites on the MCS (multiple cloning site) of the LV5 vector (GenePharma) and the target gene sequence. Selected restriction endonuclease recognition sequences and protective bases were added to the 5' ends of the forward and reverse primers, respectively (F: CTTGGTACCGAGCTCGGATCCGCCACCATGTCTATTCTCAAGATCCATGC; R: GAAGGGCCCTCTAGACTCGAGCTTGGCCAAGGGGTTTCT). PCR was performed using a template (cDNA, genomic DNA, or other plasmids) containing the ENO1 (human) gene to amplify the target gene fragment with the restriction enzyme sites.

[0050] Double digestion: The target gene fragment purified by PCR and the empty plasmid vector are simultaneously digested with two selected restriction endonucleases (SphI and BamHI); after digestion, the vector double digestion will produce two different sticky ends, which effectively prevents vector self-ligation.

[0051] Ligation: The digested and purified target gene fragment and vector fragment are mixed at a certain molar ratio (insert fragment:vector = 3:1 to 10:1). DNA ligase is added, and the mixture is incubated at an appropriate temperature (usually 16°C) for several hours to allow the two to ligate and form a complete circular recombinant plasmid.

[0052] Transformation and Screening: The ligation product was added to DH5α competent cells, and the plasmid was introduced into the bacteria via heat shock. The bacteria were plated on LB agar plates containing the appropriate antibiotic (e.g., ampicillin) and cultured overnight. Single colonies were picked, cultured by shaking, and then the plasmid was extracted for enzyme digestion or PCR identification. Correctly identified clones were sent for sequencing for final verification. The resulting overexpression plasmid, PLV5-CMV-ENO1(human)-3xFLAG-CopGFP-Puro, was obtained. Figure 1 (As shown in A).

[0053] (2) Preparation of exosomes: like Figure 1As shown in Figure B, when 293T cells (Zishan Biotechnology, STCC10301P) reached 80%-90% confluence in 10cm culture dishes, diluted lentivirus solution was added to the 293T cells, along with polybrene (concentration 4-8ug / ml) to enhance infection efficiency. After incubation for 24 hours, the virus-containing medium was removed and replaced with fresh medium. After screening and medium replacement, cells recovered growth for 1-2 days, and then were screened using puromycin. After 7 days, the untransduced control group cells died, indicating the completion of drug screening. The established stable cell lines were expanded, and after changing the culture medium, the supernatant was collected after 24-72 hours in an incubator. The cells were centrifuged at 300-500g for 10 minutes at 4℃ to remove cell debris. The collected supernatant was transferred to sterile centrifuge tubes and centrifuged at 3000-4000rpm for 10-15 minutes. The upper follicular fluid was then aspirated. Centrifuge the aspirated upper follicular fluid at 8000-10000g for 15-20 minutes. Transfer the centrifuged upper follicular fluid to an ultracentrifuge tube and centrifuge at 100000-120000g for 2-3 hours. Discard all follicular fluid to obtain exosomes.

[0054] (3) Preparation and identification of exosome delivery protein ENO1: like Figure 1 As shown in Figure B, the PLV5-CMV-ENO1(human)-3xFLAG-CopGFP-Puro overexpression plasmid was constructed, transfected into 293T cells to package the virus, and exosomes were collected from the supernatant. The exosomes in the follicular fluid were extracted using the size exclusion method (SEC) to obtain the exosome delivery protein ENO1.

[0055] (4) Identification of the exosome delivery protein ENO1, the specific steps are as follows: (i) Western blotting identified that the extracted nanoparticles were rich in the expression of exosome surface marker proteins CD63, CD81, and ENO1. The specific steps are as follows: Lysis buffer was added to the exosome suspension (volume ratio, 1:2), and the mixture was placed on ice for 30 minutes for lysis. The protein concentration of the sample was determined by the biuret assay (BCA) (catalog number: P0010, Beyotime). Each sample contained an equal amount of protein. Loading buffer was added, and the sample was boiled for 10 minutes to denature the protein for further protein electrophoresis. When the protein sample entered the separating gel, the voltage was increased to 120 V after the gradient markers appeared. Electrophoresis was stopped when the bromophenol blue stripe reached the bottom of the glass plate. The protein was transferred to a PVDF membrane (catalog number: G6045-0.22, Savill) at 30 mA for 90 minutes. The membrane was blocked with 5% BSA blocking buffer on a shaker at room temperature for 2 hours. Prepare the primary antibodies as needed: Alix (catalog number: 12422-1-AP, Proteintech) (1:250), TSG101 (catalog number: 28283-1-AP, Proteintech) (1:500), CD81 (catalog number: 66866-1-lg, Proteintech) (1:500), and ENO1 (catalog number: 11204-1-AP, Proteintech) (1:500). Incubate the membrane overnight at 4°C on a shaker. The next day, wash the membrane three times on a shaker in TBST buffer (catalog number: G0004, Sewell) for 10 minutes each time. Then add the corresponding secondary antibodies (catalog number: SA00001-1 / SA00001-2, Proteintech) (1:10,000 dilution) and incubate on a shaker at room temperature for 1 hour. Aspirate the secondary antibody and wash the PVDF membrane three times with TBST for 10 minutes each time. Use Pierce... ECL (catalog number: 36208ES60, Yisheng) combined with Western blotting substrate detection chemiluminescence. Results are as follows: Figure 1 As shown in C.

[0056] (ii) Electron microscopy and nanoparticle tracer analysis (NTA) were used to determine the size of these nanoparticles. Results are as follows: Figure 1 As shown in Figure D, the diameter of the particles is 30-150 nm; this indicates that it conforms to the size characteristics of exosomes.

[0057] (iii) Electron microscopy (TEM) scans of the extracted exosome structure, as shown in E in 1, show a double-membrane structure, which is consistent with the important appearance characteristics of exosomes.

[0058] Example 2 This embodiment verifies that the exosome delivery protein ENO1 prepared in Example 1 improves the fertility of mice. The specific steps are as follows: (1) In vivo experiment: This embodiment evaluates the effect of exosome delivery protein ENO1 on fertility in vivo. The specific steps are as follows: (i) Experimental subjects and grouping: Young blank control group: Six 2-month-old C57BL / 6J female mice were used as the young blank control group and were given a blank treatment.

[0059] Advanced age control group (Aging ctrl): Six 8-month-old female C57BL / 6J mice were used as the advanced age control group and were given a blank treatment.

[0060] Young-exo treatment group: Six 2-month-old female C57BL / 6J mice were used as experimental subjects. These mice were treated with the exosome delivery protein ENO1: 100 μl of exosomes loaded with ENO1 was injected, resulting in an exosome concentration of 3.6 × 10⁻⁶. 6 1 injection / ml, once a week for two consecutive weeks.

[0061] Aging-exo treatment group: Eight 8-month-old C57BL / 6J female mice were used as experimental subjects. These mice were treated with exosome delivery protein ENO1: 100 μl of exosomes loaded with ENO1 was injected, resulting in an exosome concentration of 3.6 × 10⁻⁶. 6 1 injection / ml, once a week for two consecutive weeks.

[0062] (ii) Superovulation Induction: After treatment, mice in the exosome treatment group and the blank control group underwent superovulation treatment. The specific steps were as follows: Between 4 PM and 5 PM, each mouse was injected with 10 U of pregnant mare serum gonadotropin (PMS). 48 hours later, at the same time, each mouse was injected with 10 U of human chorionic gonadotropin (hCG). After another 10-13 hours, the mice were anesthetized with CO2 and their spines were separated before sacrifice. The mice were dissected, their ovarian tissue and fallopian tubes were separated, the dilated portion of the fallopian tubes was opened, and oocytes were collected.

[0063] (iii) Fertility assessment: The number of oocytes retrieved, the number of mature oocytes, and the maturation rate were compared between the experimental group and the control group. After obtaining oocytes, in vitro fertilization experiments were performed to observe the fertilization rate, cleavage rate, and blastocyst formation rate. The effect of the exosome delivery protein ENO1 on fertility was also assessed in vitro.

[0064] (iv) Ovarian histological and metabolic examination: In vitro and in vivo experiments: To investigate the effect of exosome delivery protein ENO1 on follicle activation, ovarian tissue was obtained from approximately 10-day-old female C57BL / 6J mice. Follicular fluid exosomes were added to the complete culture medium of the ovarian tissue and treated for approximately 48 hours. After treatment, the ovarian tissue was collected and fixed in 4% paraformaldehyde for HE staining and sectioning. The effects of exosome delivery protein ENO1 on mitochondrial structure and fertility were assessed at the in vitro histological level by observing follicular development in the ovarian tissue. Figure 2 ).

[0065] Example 3 This embodiment verifies that the exosome delivery protein ENO1 prepared in Example 1 enhances mitochondrial function in granulosa cells. The specific steps are as follows: (1) Experimental subjects and grouping The control group in this embodiment used human ovarian granulosa cells. The steps were as follows: Granulosa cells were cultured in 90% D / F12 + 10% FBS + PS medium and cultured in an incubator at 37°C with 5% CO2. After reaching 50% confluence, the exosome delivery protein ENO1 from follicular fluid was added. The cells were then grouped and treated as follows:

[0066] (2) Detection method: (i) Western Blot Protein sample preparation: Collect cells from each group, add pre-chilled RIPA lysis buffer, and lyse on ice for 30 minutes. Then, centrifuge at 12000g for 15 minutes at 4°C, and collect the supernatant for protein quantification. Mix an equal volume of protein with loading buffer and boil for 10 minutes to denature the protein.

[0067] (ii) SDS-PAGE electrophoresis and incubation Electrophoresis was performed using a 12% separating gel to separate proteins of different molecular weights. A wet transfer method was used. The proteins in the gel were transferred to a PVDF membrane. Transfer conditions were constant voltage 110V, performed in an ice bath for 50 minutes. The membrane was blocked with PBST solution containing 5% BSA at room temperature for 1 hour. Primary antibody incubation: The membrane was incubated overnight at 4°C with specific ENO1 primary antibody (Proteintech). The ENO1 primary antibody was diluted 1:1000 according to the primary antibody instructions. Secondary antibody incubation: After washing the membrane with PBST, it was incubated at room temperature (Proteintech) with HRP-labeled secondary antibody for 1 hour; the dilution ratio was 1:10,000 depending on the primary antibody species selected. Chemiluminescence detection: The membrane was treated with Yeasen™ chemiluminescence substrate and developed in a chemiluminescence imager.

[0068] (iii) Immunofluorescence Cell fixation and permeabilization: Cell slides were fixed with 4% paraformaldehyde for 10 minutes, then permeabilized with 0.1% Triton X-100 for 10 minutes. Simultaneously, ENO1 primary antibody was added and incubated overnight at 4°C. The next day, cells were incubated with Alexa Fluor 488 / 594-labeled secondary antibodies at room temperature in the dark for 1 hour. Nuclei were stained with Hoechst 33258, and after mounting, the colocalization of ENO1 with mitochondria was observed under a confocal microscope.

[0069] (iv) Detection of mitochondrial membrane potential (ΔΨm) Dye loading: Discard the old culture medium and wash the cells twice with PBS. Add JC-1 fluorescent dye and incubate at 37°C in the dark for 30 minutes. Wash away excess dye with PBS and immediately observe and detect fluorescence intensity using a confocal microscope or a fluorescence microscope equipped with a live cell culture system. The red-green fluorescence intensity ratio of JC-1 reflects the integrity of mitochondrial membrane potential function.

[0070] (3) Results: such as Figure 3 As shown, Figure 3 The image shows the results of exosome ENO1 enhancing mitochondrial function in granulosa cells. Quantitative analysis using Western blotting revealed that treatment with the exosome delivery protein ENO1 upregulated ENO1 expression. Figure 3 China A Figure 3 Mitochondria isolated from treated granulosa cells showed elevated ENO1 levels (B); Figure 3 C, Figure 3 (Middle D). Immunofluorescence confirmed that ENO1 is located near or overlapping the mitochondria. Figure 3 (E); Exosome delivery not only increased ENO1 expression, but also rescued mitochondrial dysfunction in cisplatin-damaged cells, such as ΔΨm recovery (p<0.01). Figure 3 (F). These results suggest that exosome delivery of ENO1 can enhance mitochondrial expression, indirectly increasing energy metabolism in the ovarian microenvironment and maintaining mitochondrial homeostasis.

[0071] Example 4 This embodiment verifies that the exosome delivery protein ENO1 prepared in Example 1 can specifically bind to VDAC1, reduce VDAC1 oligomerization, stabilize mitochondrial membrane potential, and improve energy metabolism in oocytes. The specific steps are as follows: In this embodiment, the grouping and preparation methods of human granulocytes are the same as in Example 3.

[0072] (1) Immunoprecipitation assay: The interaction between ENO1 and VDAC1 was confirmed in granulocytes by immunoprecipitation assay. The specific steps are as follows: S1. Collect cells and lyse them. The lysate usually contains protease inhibitors to prevent protein degradation.

[0073] S2. After cell lysis, centrifuge to remove cell debris and collect the supernatant.

[0074] S3. Add beads that are specifically conjugated with protein A or G and incubate at 4°C to allow the antibody to bind to the target protein.

[0075] S4. After incubation, collect the beads by centrifugation to remove unbound proteins.

[0076] S5. Wash the beads several times with lysis buffer to remove non-specifically bound proteins.

[0077] S6. Finally, add sample buffer and boil the beads to release the bound protein complex.

[0078] S7. Separate proteins by SDS-PAGE electrophoresis, and then analyze them using Western blotting or mass spectrometry; (2) Mitochondrial function detection: Mitochondrial membrane potential was detected using Mitotracker Green and JC-1 dyes. Fluorescence intensity was measured using a fluorescent plate reader, and changes in mitochondrial membrane potential were compared between the experimental and control groups.

[0079] (3) Results analysis: such as Figure 4 As shown, Figure 4 The exosome delivery protein ENO1 specifically binds to VDAC1, reducing VDAC1 oligomerization, stabilizing mitochondrial membrane potential, and improving energy metabolism in oocytes. Figure 4 In the granulocyte control group, exosome incubation group, cisplatin-induced premature aging group, and exosome treatment rescue group, the immunofluorescence results of ENO1 (red) and VDAC1 (green) showed that exosome delivery of ENO1 significantly increased the expression level of ENO1. Figure 4 In the granulocyte control group, exosome incubation group, cisplatin-induced premature aging group, and exosome treatment rescue group, the intracellular immunofluorescence localization results of ENO1 (red) and VDAC1 (green) under a 63X confocal microscope showed that the two had immune colocalization. Figure 4 Western blot results of C: VDAC1 protein haploid (monomer) and its oligomerized diploid (Di) and triploid (Tri) in granulosa cell control group, hydrogen peroxide-induced ROS senescence group, and exosome-treated rescue group showed that exosome treatment can alleviate ROS oxidation-induced EDAC1 oligomerization in senescent granulosa cells. Figure 4The expression levels of the D:VDAC1 protein haploid in the granulosa cell control group, the hydrogen peroxide-induced ROS senescence group, and the exosome-treated rescue group were quantitatively analyzed by Image J (P-value < 0.01).

[0080] The above results indicate that ENO1 binding to VDAC1 reduces VDAC1 oligomerization, stabilizes mitochondrial membrane potential, leads to increased ATP production in oocytes, and improves energy metabolism in oocytes.

[0081] Example 5 This embodiment evaluates the effect of the exosome delivery protein ENO1 prepared in Example 1 on improving the reproductive function of aged mice, as detailed below: Thirty-six-week-old female C57BL / 6J mice were selected as experimental subjects and randomly divided into an aged control group (Aging) and an exosome injection experimental group (ENO1-exo); eight-week-old female C57BL / 6J mice were used as a young control group (Young). The young and aged control groups received a tail vein injection of 100 μl PBS, while the exosome injection experimental group received a tail vein injection of 100 μl follicular fluid exosome suspension. The concentration of the injected exosomes was approximately 1.1 × 10⁻⁶. 9 The dose was administered at a rate of [number] per ml for two consecutive weeks, once a week. After three weeks, mice were sacrificed, and oocytes were retrieved after superovulation. The number of retrieved oocytes, the number of mature oocytes (B), and the maturation rate were counted. After obtaining the oocytes, in vitro fertilization experiments were performed to observe the fertilization rate, cleavage rate, blastocyst formation rate, and to assess the effect of the exosome delivery protein ENO1 on fertility in vitro.

[0082] The results are as follows Figure 5 As shown: Figure 5 Two weeks after exosome delivery of ENO1, aging mice were induced to superovulate by continuous injection of PMSG (5 IU) and hCG (5 IU) at 48-hour intervals. Figure 5 China A Figure 5 The results in Figure B show that after ENO1-exo treatment, there was no statistically significant difference in the number of oocytes between the older age group and the ENO1 treatment group; Figure 5 C, Figure 5 Mitotracker staining showed that ENO1-exo treatment reduced mitochondrial fragmentation in oocytes. Figure 5 Chinese E, Figure 5 Further analysis using JC-1 assays showed that the mitochondrial membrane potential was restored (p<0.001), confirming functional recovery.

[0083] Example 6 This embodiment analyzes the molecular mechanism by which the exosome delivery protein ENO1 alters the ovarian energy metabolism status of older women, thereby improving the state of low ovarian reserve and enhancing fertility.

[0084] Oocytes were isolated from mice in the exosomal ENO1 group, ENO1 inhibitor group, and control group. Single-cell transcriptomics libraries were constructed and sequenced. Single-cell transcriptomics data were obtained, and differential gene analysis, functional enrichment analysis, pathway analysis, etc. were performed using various bioinformatics tools. The relationship between the PI3K / Akt / mTOR pathway, energy metabolism, mitochondrial homeostasis maintenance and ENO1 was explored. Confirmation of activation of the PI3K / Akt / mTOR signaling pathway; detection of the relative expression levels of genes involved in the signal transduction pathway by Real-time PCR.

[0085] The expression of p-AMPK, p-Akt, p-FOXO3a and downstream p-mTOR, p-TSC2, p-S6K, p-rpS6, and KITL was detected at the molecular and tissue levels to confirm the molecular mechanism by which the PI3K / Akt / mTOR signaling pathway is activated in primordial follicles.

[0086] The results are as follows Figure 6 As shown, Figure 6 This method activates PI3K / AKT signaling in the exosomes of young women (rich in high-abundance ENO1), promoting the activation of primordial follicles. Among these, Figure 6 In Figure A, the expression levels of PI3K, AKT, and phosphorylation in collected primordial follicles were analyzed using immunohistochemical staining after exosome processing in young women. The rectangular boxes represent primary follicles in each figure. Red arrows indicate oocytes, while blue arrows indicate granulosa cells adjacent to the follicles. Scale bar = 100 μm. Figure 6 In Figure B, the expression levels of PI3K, AKT, and phosphorylation in activated follicles collected after exosome treatment in young women were analyzed by immunohistochemical staining. Red arrows indicate oocytes, while blue arrows indicate granulosa cells surrounding the follicles. Additionally, purple arrows indicate cumulus cells surrounding the oocytes. Scale bar = 100 μm.

[0087] The above results indicate that exosome delivery of the protein ENO1 significantly increases the number of primordial follicles, secondary follicles, and antral follicles, improving ovarian hypofunction; it also enhances mitochondrial function in granulosa cells and promotes increased energy metabolism. Further research shows that ENO1 specifically binds to the mitochondrial outer membrane protein VDAC1, stabilizing mitochondrial membrane potential and restoring the structural integrity of oocyte mitochondria, thereby improving energy metabolism within oocytes and enhancing fertility in older women. Therefore, this invention provides a new treatment strategy for fertility decline in older women and can be widely used in the treatment of fertility decline in older women.

[0088] In summary, the exosome delivery protein α-enolase provided by this invention promotes energy metabolism in the ovarian microenvironment, thereby improving ovarian function decline and enhancing fertility in older women. It can be applied to products for women experiencing fertility decline and is a practical and feasible new treatment method to improve fertility in older women.

[0089] It should be understood that the application of the present invention is not limited to the examples above. Those skilled in the art can make improvements or modifications based on the above description, and all such improvements and modifications should fall within the protection scope of the appended claims.

Claims

1. Use of exosomes loaded with ENOl protein in the preparation of a product for treating female fertility decline.

2. Use according to claim 1, characterized in that, The exosomes are prepared by the following steps: constructing a lentivirus overexpression vector containing an ENOl gene, and transfecting the lentivirus overexpression vector into 293T cells to obtain cells expressing ENOl; collecting the cell supernatant after culture, and separating the exosomes.

3. Use according to claim 1, characterized in that, The product is at least one of increasing the number of primary follicles, increasing the number of secondary follicles, and increasing the number of antral follicles.

4. Use according to claim 1, characterized in that, The product is improving ovarian mitochondrial function.

5. Use according to claim 4, characterized in that, The improvement of ovarian mitochondrial function includes enhancing the function of mitochondria in granulosa cells; and / or, restoring the integrity of mitochondria in oocytes.

6. Use according to claim 1, characterized in that, The shape of the exosomes is round or oval.

7. Use according to claim 1, characterized in that, The diameter of the exosomes is 30-150 nm.

8. The use according to claim 1, characterized in that, The product is an exosome suspension; the exosome suspension is prepared by resuspending the exosomes loaded with ENOl protein in a phosphate buffered saline solution.

9. A product for the treatment of declining fertility in older women, characterized in that, The product includes exosomes loaded with ENOl protein.

Images