Application of NFATC2IP gene knockout mouse model
By constructing the NFATC2IP gene knockout mouse model, the problems of insufficient model specificity and reproducibility in existing ovarian dysfunction research have been solved. It provides a stable and reproducible animal model for the study of ovarian dysfunction mechanisms and drug screening, achieving higher clinical comparability and innovation.
Patent Information
- Application Number
- CN202511931064.8
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-12-19
- Publication Date
- 2026-01-23
AI Technical Summary
Existing animal models for ovarian dysfunction research suffer from a lack of specific mechanisms, poor reproducibility, and insufficient innovation. They are unable to stably simulate the gradual decline of human ovarian function and lack comprehensive assessment models based on new genes.
A mouse model with NFATC2IP gene knockout was constructed. The NFATC2IP gene was knocked out in mouse fertilized eggs using CRISPR/Cas9 technology to establish a stable genetic animal model. The model exhibited characteristic changes such as decreased ovarian weight and volume, disordered estrous cycle, and decreased fertility, which can be used for research on ovarian dysfunction.
It provides a stable and reproducible animal model that can realistically simulate the gradual decline of human ovarian function, has high clinical comparability, and can be used for research on the mechanism of ovarian dysfunction and drug screening, thereby improving the reliability and innovation of experiments.
Smart Images

Figure CN121371233A_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The present application belongs to the field of animal model construction, and particularly relates to a kind of NFATC2IP The use of a gene knockout mouse model. BACKGROUND
[0002] At present, ovarian dysfunction is one of the main causes of female infertility and premature ovarian insufficiency (POI). Its pathogenesis is complex, involving multiple aspects such as follicular development, hormone regulation, oocyte quality maintenance, and ovarian microenvironment homeostasis. Research at the cellular level alone cannot simulate the pathological microenvironment of the entire ovary and the impact of hypothalamic-pituitary-ovarian axis dysregulation. Animal models can reproduce this complexity. Through animal models, various pathogenic factors (such as genetic mutations, chemotherapy, environmental toxins, and autoimmune attacks) can be accurately simulated to systematically study their pathogenic mechanisms.
[0003] In the prior art, animal models for studying ovarian dysfunction mainly focus on the following categories: 1. Chemically induced models: Commonly used models include cyclophosphamide, cisplatin, bleomycin, or high-dose GnRH antagonist-induced premature ovarian failure models. This type of model can form a phenotype of reduced ovarian function in a short period of time by damaging ovarian tissue or inhibiting follicular development through chemical drugs, and is used for drug protection and treatment experiments.
[0004] However, this model has the following disadvantages: (1) The mechanism is not specific. Oxidative stress, apoptosis, and inflammatory response are involved in the non-specific pathways caused by chemical drugs, making it difficult to distinguish the specific role of genes in ovarian dysfunction.
[0005] (2) Poor repeatability. Drug dosage, treatment time, and individual differences in animals can significantly affect the consistency of the phenotype, resulting in large fluctuations in experimental results. It cannot reflect the occurrence process of genetic ovarian dysfunction. Chemical damage is an acute damage model that lacks a genetic background and long-term disease characteristics, making it difficult to simulate the physiological process of gradual decline in clinical ovarian function.
[0006] 2. Known key gene knockout models: Some animal models with knockout of genes related to ovarian function have been reported in existing research, such as GDF9, BMP15, FSHR, AMHR2 These models reveal important pathways for follicular development and ovarian hormone regulation, and to some extent, promote molecular research on ovarian dysfunction.
[0007] However, this type of model still has the following defects: (1) Research is focused on known pathways, and innovation is lacking. Most current models focus on the TGF-beta family or sex hormone receptor pathways, and there is still a lack of research on new or unknown ovarian regulatory genes. Model phenotypes are extreme or infertile, making it difficult to reflect clinically reversible dysfunction. For example GDF9, BMP15 Knockout mice often exhibit complete infertility and cannot be used to study mild to moderate dysfunction such as ovarian reserve decline and irregular estrus cycles.
[0008] (2) There is a lack of systematic evaluation related to hormone dynamics and long-term fertility. Most existing models do not comprehensively evaluate AMH, FSH, ovarian weight, and long-term litter production, so their application in the overall study of ovarian function is still limited.
[0009] Therefore, it is necessary to provide a genetic animal model that can stably and repeatedly simulate the progressive decline of human ovarian function (especially mild to moderate dysfunction) and is based on newly discovered genes to reveal new mechanisms. SUMMARY
[0010] Based on the above technical problems, the present application provides a use of a NFATC2IP gene knockout mouse model, which is proved by experiments that NFATC2IP after gene knockout, the mouse exhibits characteristic changes such as ovarian weight reduction, volume reduction, irregular estrus cycle, reduced fertility, decreased AMH, and increased FSH, indicating that NFATC2IP the gene is a key factor for maintaining ovarian reserve and endocrine balance, NFATC2IP the gene knockout mouse can be used as an animal model for the study of diseases related to ovarian disorders.
[0011] The specific technical solutions provided by the present application are as follows: In a first aspect of the present application, a use of a mouse model is provided, wherein the mouse model is NFATC2IP a gene knockout mouse, and the use is as shown in any one of the following: (1) preparing a tool for screening or evaluating drugs for treating ovarian dysfunction; (2) serving as a model for the study of ovarian dysfunction.
[0012] As a preferred embodiment of the present application, NFATC2IP the gene knockout mouse is constructed according to the following steps: a mouse NFATC2IPa sgRNA specific to the 5th exon of the gene; constructing a CRISPR / Cas9 recombinant plasmid comprising the sgRNA expression frame; transcribing the recombinant plasmid in vitro to obtain Cas9 mRNA and sgRNA; co-injecting the Cas9 mRNA and sgRNA into a mouse zygote and then transplanting the zygote into a pseudopregnant female mouse to obtain F0 generation mice; identifying the genotype of the F0 generation mice and their offspring to screen for NFATC2IP homozygous mice with gene knockout.
[0013] Further preferably, the sequence of the sgRNA is: gRNA-1: 5'-GCTTGGGGCTCAGGCAGGAG-3'; gRNA-2: 5'-GTAAAGAGTCGAGAGCTCTG-3'.
[0014] Further preferably, primers SEQ ID NO. 3 and SEQ ID NO. 4 are used for PCR amplification and sequencing to identify NFATC2IP knockout of the gene; Seq Nfatc2ip F: 5'-CTAGATCCTCATGCCTTCACCTCC-3', SEQ ID NO. 3; Seq Nfatc2ip R: 5'-TCTCTCTTTTGCTACCATCCTTGCC-3', SEQ ID NO. 4.
[0015] Further preferably, the mouse is a Balb / c mouse.
[0016] Further preferably, the CRISPR / Cas9 recombinant plasmid is pX330-U6-Chimeric_BB-CBh-hSpCas9 plasmid.
[0017] As a preferred embodiment of the present application, the ovarian dysfunction includes decreased ovarian reserve function or premature ovarian failure.
[0018] As a preferred embodiment of the present application, the research includes research on the mechanism of ovarian dysfunction or discovery and verification of biomarkers related to ovarian dysfunction.
[0019] Compared with the prior art, the present application has the following beneficial effects: The experimental results of the present application show that, NFATC2IP After the knockout of the gene, the mice exhibit characteristic changes such as decreased ovarian weight, reduced volume, irregular estrous cycle, decreased fertility, decreased AMH, and increased FSH. This phenotype indicates that NFATC2IPGenes are key factors to maintain ovarian reserve and endocrine balance, which provides a new breakthrough point for the molecular mechanism research of ovarian dysfunction, breaks the limitation of traditional model research which is only limited to known hormone receptors or growth factor pathways, and expands a new direction of genetic research of ovarian dysfunction.
[0020] NFATC2IP The gene-specific knockout mice stably exhibit the same physiological and reproductive phenotypes (ovarian shrinkage, cycle disorder, and reduced number of offspring, etc.) after continuous breeding for three generations, have good genetic stability and experimental repeatability, and provide a reliable tool for long-term tracking of ovarian function changes and evaluation of drug intervention effects.
[0021] With GDF9 Or FSHR Unlike the complete infertility of knockout mice, the NFATC2IP The knockout mice still have certain fertility, but the pregnancy rate and total number of offspring after mating are significantly reduced, and the hormone changes are similar to human ovarian reserve function decline (DOR / POI), which can more truly simulate the gradual decline of human ovarian function, and has higher clinical comparability and scientific research value.
[0022] The NFATC2IP The gene-specific knockout mouse model of the application can not only be used to reveal the mechanism of ovarian dysfunction, but also be used for screening of new ovarian protection drugs, research of hormone regulation mechanism, discovery and verification of biomarkers, and establishment of molecular diagnosis model of genetic infertility.
[0023] The NFATC2IP The gene-specific knockout mouse model of the application can replace the traditional drug-induced model, reduce the cost of experimental materials and repetitive verification (save about 30-40% of experimental expenditure), and be used for early animal verification of pharmaceutical companies in the development of ovarian function protection drugs and assisted reproductive drugs, so as to improve the drug screening efficiency; and has a wide application prospect in assisted reproduction, gynecological diseases and anti-aging research. Meanwhile, the model has transformation potential, and can be used as an important patent resource in the field of fertility health and reproductive aging. BRIEF DESCRIPTION OF DRAWINGS
[0024] Figure 1 is the SgRNA target location.
[0025] Figure 2 is a comparison chart of knockout mouse gene sequence and wild type.
[0026] Figure 3 is the ovarian and body weight ratio of 8-week and 6-month-old knockout mice (KO) and wild-type mice (WT) in the same litter, * P<0.05, **P<0.01. NFATC2IP
[0027] Figure 4 This is an assessment of mouse reproductive capacity. (A) NFATC2IP Knockout mice (KO) showed a significant decrease in litter size. (B) NFATC2IP The total number of offspring in knockout mice (KO) was significantly reduced. * P<0.05, ** P<0.01.
[0028] Figure 5 The estrous cycle detection experiment is used to detect the estrous cycle in mice; P (Proestrus, proestrus). E (Estrus, late estrus), M (Metestrus, estrus), D (Diestrus, diaestrus).
[0029] Figure 6 yes NFATC2IP Effects on mouse hormones, **P<0.01. Detailed Implementation
[0030] It should be understood that the expression “one or more of…” individually includes each of the objects described after the expression, as well as various different combinations of two or more of the described objects, unless otherwise understood from the context and usage. The expression “and / or” combined with three or more described objects should be understood to have the same meaning, unless otherwise understood from the context.
[0031] The terms “including,” “having,” or “containing,” including the use of their grammatical synonyms, should generally be understood as open-ended and non-restrictive, for example, not excluding other unstated elements or steps, unless otherwise specifically stated or understood from the context.
[0032] It should be understood that the order of the steps or the order in which certain actions are performed is not important as long as the invention remains operational. Furthermore, two or more steps or actions can be performed simultaneously.
[0033] The use of any and all instances or exemplary language such as “e.g.” or “including” in this document is merely intended to better illustrate the invention and is not intended to limit the scope of the invention unless the claims are made. No language in this specification should be construed as indicating that any unclaimed element is essential to the practice of the invention.
[0034] The following issues exist in existing research on ovarian dysfunction: (1) Existing models mostly rely on chemical drug induction, which has a complex mechanism and poor specificity, making it difficult to accurately reflect the genetic and molecular regulatory basis of ovarian dysfunction; (2) Existing gene knockout models are concentrated on a few known pathways, lacking innovation, and some models have phenotypes that are too severe (such as complete infertility), which cannot simulate the natural process of gradual decline in ovarian function; (3) There is a lack of an experimental animal model that can stably and reproducibly express a comprehensive phenotype of ovarian dysfunction, abnormal hormone levels and decreased fertility. (4) There is a lack of research models that use new genes as a starting point to reveal the molecular mechanisms of declining ovarian reserve and to screen drugs.
[0035] Based on this, the present invention provides a NFATC2IP Novel applications of gene-specific knockout mouse models. This invention demonstrates through experiments that... NFATC2IP Gene knockout mice exhibit characteristic changes such as decreased ovarian weight and volume, disrupted estrous cycles, decreased fertility, decreased AMH levels, and increased FSH levels. This indicates... NFATC2IP Genes are key factors in maintaining ovarian reserve and endocrine balance. NFATC2IP Gene knockout mice can be used to reveal the mechanisms of ovarian dysfunction, as well as to screen new ovarian protective drugs, study hormone regulation mechanisms, and discover and validate biomarkers.
[0036] 1. NFATC2IP Construction of knockout mice Using cytosolic microinjection of fertilized eggs, the CRISPR / Cas9 system (purified Cas9 mRNA and sgRNA were co-injected into the pronucleus of Balb / c mice) was injected into Balb / c mouse fertilized eggs for targeted knockout. NFATC2IP Genes. By designing to target NFATC2IP A CRISPR / Cas9 expression plasmid was constructed using the specific sgRNA from exon 5 of the gene. Cas9 mRNA and sgRNA were obtained through in vitro transcription and then injected into the cytoplasm of fertilized eggs. Following embryo transfer, genotyping of offspring after birth, and strain propagation, a stable lineage was finally established. NFATC2IP Gene knockout mouse strains were developed for research related to ovarian dysfunction. The specific construction process is as follows:
[0037] 1.1 sgRNA design and vector construction 1.1.1 Target Site Selection Reference mice NFATC2IP Gene sequence (NCBI Gene ID: 18020), exon 5 was selected as the target region. Figure 1 This allows for the introduction of frameshift mutations in the coding region, which in turn causes premature termination of downstream protein translation, achieving the goal of functional knockout.
[0038] 1.1.2 sgRNA sequence design Combination NFATC2IPBased on the exon 5 sequence of the gene, two independent and highly specific single-stranded guide RNAs (sgRNAs) were designed, with the following target sequences (PAM sequence is NGG and is not included in the sgRNA sequence): gRNA-1: 5'GCTTGGGGCTCAGGCAGGAG3', SEQ ID NO.1; gRNA-2: 5'GTAAAGAGTCGAGAGCTCTG3', SEQ ID NO. 2.
[0039] Both of the above sgRNAs are located in NFATC2IP Within exon 5 of the gene, Cas9 can be used to cleave at two sites, resulting in small deletions or insertions, thus causing frameshift mutations. The sgRNA sequence was compared with public databases to ensure that it had no potential off-target sites with significant high homology in the mouse genome, reducing the risk of non-specific editing.
[0040] 1.1.3. Sources and Construction of Expression Vectors This invention uses the pX330-U6-Chimeric_BB-CBh-hSpCas9 plasmid (Addgene plasmid number #42230) as a CRISPR-Cas9 expression vector. This vector is widely used for gene editing in mammalian cells and contains a human codon-optimized Streptococcus pyogenes Cas9 (hSpCas9) nuclease gene, as well as a single-stranded guide RNA expression cassette transcribed by the U6 promoter.
[0041] The specific construction steps are as follows: 1) Based on the sequences of gRNA1 and gRNA2, synthesize a pair of complementary oligonucleotides, and design a sticky end at the 5' end of the primer that is compatible with the BbsI restriction site. 2) The pX330U6Chimeric_BBCBhhSpCas9 plasmid was completely digested with BbsI restriction enzyme, and the linearized vector fragment was recovered. 3) The annealed oligonucleotides were ligated to the linearized pX330 vector to construct pX330gRNA1 containing gRNA1 and pX330gRNA2 containing gRNA2, respectively. 4) Transform the above-constructed product into competent Escherichia coli DH5α, select single clones, extract a small amount of plasmid, and then perform sequencing to verify that the sgRNA insertion sequence and orientation are correct.
[0042] Through the above steps, a plasmid vector containing Cas9 and its respective sgRNA expression cassette is obtained as a template for in vitro transcription.
[0043] 1.2 In vitro transcription and purification of CassmRNA and sgRNA 1.2.1 Template Preparation 1) Using a verified Cas9 expression plasmid as a template, a fragment containing the T7 promoter and Cas9 coding sequence was amplified by PCR, and the product was used for in vitro transcription of Cas9 mRNA.
[0044] 2) Using pX330-gRNA-1 and pX330-gRNA-2 as templates, fragments containing the T7 promoter and their respective sgRNA sequences were amplified by PCR and used as templates for in vitro transcription of sgRNA.
[0045] 1.2.2 In vitro transcription: In vitro transcription of Cas9 mRNA was performed using the MMESSAGE MMACHINE T7 ULTRA Transcription Kit (Thermo Fisher Scientific) to prepare high-quality mRNA with cap structure and poly(A) tail modification.
[0046] In vitro transcription of sgRNA can be performed using the Takara / Clontech Guide-it sgRNA In VitroTranscription Kit, which contains sgRNA with good integrity and activity.
[0047] 1.2.3 RNA purification and quality testing After the in vitro transcription reaction was completed, the Cas9 mRNA and sgRNA were purified and concentrated using the RNAprep pure Tissue Kit (Tiangen Biotech) to remove residual template DNA, enzyme proteins and small molecule impurities.
[0048] RNA fragment integrity was detected by agarose gel electrophoresis with 1% denaturant, confirming no significant degradation.
[0049] The concentration and purity of RNA were determined using a NanoDrop spectrophotometer. 260 / A 280 The ratio should be between 1.8 and 2.1. Dilute appropriately according to the concentration required for subsequent microinjection and dispense into vials. Store at −80℃ for later use.
[0050] 1.3 Fertilized egg collection and cytoplasmic microinjection Donor and recipient mouse preparation Healthy female Balb / c mice aged 6-8 weeks were selected as donor mice and mated with mature male mice of the same strain in the same cage. The vaginal plug was checked the next morning, and the presence of vaginal plugs in female mice was considered a successful mating.
[0051] The recipient mice were healthy female ICR mice aged 8-10 weeks, which were mated with male mice with vasectomized vas deferens to prepare pseudopregnant female mice.
[0052] Fertilized egg collection Approximately 18-20 hours after successful mating, the oviduct of the donor female mouse was dissected, and single-cell fertilized eggs located in the ampulla of the oviduct were retrieved. These eggs were then briefly cultured in a culture dish containing a suitable culture medium (such as M2) to screen out fertilized eggs with normal morphology and intact zona pellucida for injection.
[0053] Microinjection system configuration The purified Cas9 mRNA was diluted to a final concentration of approximately 50 ng / μL.
[0054] Dilute gRNA-1 and gRNA-2 to a final concentration of approximately 25 ng / μL.
[0055] The Cas9 mRNA and two sgRNAs were dissolved and mixed in an appropriate microinjection buffer (UltraPure™ Tris HCl Buffer from Thermo Fisher Scientific) to prepare the injection working solution.
[0056] Cytoplasmic microinjection and embryo transfer Using an inverted microinjection system and micromanipulation instruments, the above-mentioned mixed RNA solution was injected into the cytoplasm of single-cell stage fertilized eggs, with the injection volume controlled within 5% to 10% of the egg cell volume. After injection, the fertilized eggs were briefly cultured under suitable conditions (37°C, 5% CO2) for several hours, and morphologically damaged or fragmented embryos were removed.
[0057] Surviving injected fertilized eggs were transferred to the ampulla of the oviduct of pseudopregnant ICR female mice, with approximately 20-30 embryos transferred to each surrogate mother. F0 generation offspring mice were obtained after pregnancy and delivery.
[0058] 1.4 Genotyping of offspring mice Genomic DNA extraction After F0 generation mice are born and weaned, at approximately 3 weeks of age, a 0.5–1 cm section of the tail tip is harvested. Genomic DNA is extracted using either alkaline lysis or conventional proteinase K digestion, and used as a PCR template. The extracted DNA is soluble in TE buffer or nuclease-free water and stored at -20°C.
[0059] NFATC2IP Design identification primers for the knockout region: Seq Nfatc2ip F: 5' - CTAGATCCTCATGCCTTCACCTCC - 3', SEQ ID NO.3; Seq Nfatc2ip R: 5' - TCTCTCTTTTGCTACCATCCTTGCC - 3', SEQ ID NO.4.
[0060] The target fragment is amplified by polymerase chain reaction (PCR).
[0061] The PCR reaction system consisted of: 1 μL template DNA, 0.2 μL each of forward and reverse primers, 2 μL 10×PCR Master Mix, and water to a final volume of 20 μL.
[0062] The amplification procedure is shown in Table 1.
[0063] Table 1. Amplification procedures for PCR identification in F1 generation mice. The primers described above can amplify gene fragments spanning the CRISPR / Cas9 editing region. The wild-type allele is 671 bp in length, while the knockout allele, due to an 8 bp deletion, produces a PCR product of 663 bp. The deletion site is [not specified in the original text]. NFATC2IP The fifth exon region is located at positions 2905-2912. See the comparison image of the knockout mouse gene sequence with the wild-type. Figure 2 .
[0064] 1.5 Establishment of stable genetic strains F1 generation preparation and screening Confirmed by PCR and sequencing as NFATC2IP Knockout-positive F0 generation mice were mated with wild-type Balb / c mice to obtain F1 generation offspring. Genotyping of the F1 generation mice was performed using the method described above, and mice carrying the same 8bp deletion mutation were screened. NFATC2IP Heterozygous individuals.
[0065] Acquisition of homozygotes and strain fixation Select individuals with a good genetic background, normal health status, and carrying the same mutated allele. NFATC2IP Heterozygous mice were intercrossed to obtain F2 and subsequent generations. Homozygotes were then screened by genotyping. NFATC2IP Knockout mice. Through continuous breeding and observation of phenotypic stability, a stable genetic lineage was established. NFATC2IP The gene knockout Balb / c strain.
[0066] The obtained NFATC2IP Knockout mice exhibit a stable phenotype of ovarian dysfunction in terms of ovarian function, hormone levels, and fertility, and can serve as an experimental animal model for studying the molecular mechanisms of declining ovarian reserve and screening drugs for ovarian dysfunction.
[0067] 2. NFATC2IP Knockout mice have a reduced ovary-to-body weight ratio Wild-type female mice and knockout female mice were housed in a temperature- and humidity-controlled environment with ample water and food. At 8 weeks and 6 months of age, pregnant mare serum gonadotropin (PMSG, 5 IU / mouse) was injected. Forty-eight hours afterward, the mice were weighed and recorded as body weight. Subsequently, the mice were euthanized by isoflurane overdose, and both ovaries were quickly dissected and weighed, recorded as ovarian weight.
[0068] The formula for calculating the ovarian organ coefficient in mice is: Ovarian organ coefficient (%) = ovarian weight (g) / body weight (g) × 100%.
[0069] The results show that ( Figure 3 ), NFATC2IP The ovarian organ coefficient of knocked-out mice was significantly lower than that of wild-type mice.
[0070] 3. NFATC2IP Effects of knockout on mouse fertility Wild-type and knockout mice were kept in cohabitation with healthy, reproductively capable male mice for 5 months after reaching 8 weeks of age. Male mice were replaced if they exceeded 15 weeks of age during the cohabitation period to ensure their vigorous reproductive capacity. Day 0 was recorded from the start of cohabitation. The health status, pregnancy, and birthing of female mice were observed and recorded regularly, including the birth date of each female mouse, the number of pups per litter, and the growth of the pups.
[0071] turn out( Figure 4 ), NFATC2IP Knockout mice produced fewer litters per unit time and a smaller cumulative litter size. However, the average litter size and health status of the offspring were not affected. Preliminary findings. NFATC2IP It will affect the release (reserve) of follicles but will not affect the quality of eggs.
[0072] 4. NFATC2IP Effect of knockout on mouse estrous cycle Wild-type female mice and gene knockout female mice were housed in a temperature- and humidity-controlled SPF environment with 12 hours of alternating light and dark lighting, and provided with ample water and food. After the mice reached 8 weeks of age, their estrous cycles were monitored at fixed times from 9:00 AM to 11:00 AM daily.
[0073] Gently fix the mouse and use a small cotton swab dipped in physiological saline to gently insert it into the mouse's vaginal opening to a depth of about 0.5 cm, rotating it 2-3 times to obtain exfoliated vaginal cells. Gently wipe the surface of the slide with the cotton swab and allow it to air dry at room temperature. Then add Wright-Gymsza stain A (mainly composed of Wright's dye powder and methanol) to completely cover the cell area, and let it stand for 1-2 minutes for fixation and staining. Subsequently, without discarding stain A, directly add an equal volume of Wright-Gymsza stain B (phosphate buffer, pH 6.8), and gently blow and aspirate the solution with a bulb syringe to mix the surface; a metallic film will be visible. Continue staining at room temperature for 10-15 minutes. After staining, gently rinse the slide with running water from one end until the water runs clear. Place the slide upright on a slide holder and allow it to dry completely at room temperature. Finally, mount the slide with neutral resin, observe and record cell morphology.
[0074] The estrous cycle phase was determined based on the dominant cell type observed under a microscope: proestrus was defined as when a large number of nucleated epithelial cells predominated; estrus was defined as when a large number of anucleated keratinized epithelial cells predominated; mesestrus was defined as when the proportions of leukocytes, nucleated epithelial cells, and keratinized epithelial cells were similar; and estrus was defined as when almost entirely leukocytes predominated. The mice were monitored continuously for 21 days, and the cycle phase was recorded daily for each mouse.
[0075] turn out( Figure 5 ), NFATC2IP The knockout mice exhibited disordered estrous cycles.
[0076] 5. NFATC2IP Effects of knockout on mouse hormones Wild-type female mice and gene knockout female mice were housed in a temperature- and humidity-controlled SPF-grade environment with 12-hour alternating light and dark lighting, and provided with ample water and food. After 8 weeks of rearing, once vaginal swab testing confirmed the mice were in the interestrus stage, whole blood samples were collected from the orbital fossa. These samples were allowed to stand at room temperature for 2 hours, then centrifuged at 3000 rpm for 15 minutes. The supernatant was carefully aspirated to obtain serum samples, which were then aliquoted and stored at -80°C for later testing. For testing, the frozen serum was removed and slowly thawed on ice. After thawing, the samples were allowed to equilibrate at room temperature for 20 minutes.
[0077] This experiment used the Beinlai ELISA kits (AMH: MU30399, FSH: MU31953), and all reagents used in the experiment were provided with the kits. The experimental procedures were performed in accordance with the instructions, and the specific steps are as follows.
[0078] Standard dilution: First, take 6 EP tubes and add 150 μL of diluent to each tube. Then, add 150 μL of standard to tube 1 and mix well. Add 150 μL of the mixture to tube 2 and mix well. Continue in this manner. The standard concentrations in tubes 1 to 6 of the AMH kit are 8 ng / mL, 4 ng / mL, 2 ng / mL, 1 ng / mL, 0.5 ng / mL, and 0 ng / mL, respectively. The standard concentrations in tubes 1 to 6 of the FSH kit are 12 ng / mL, 6 ng / mL, 3 ng / mL, 1.5 ng / mL, 0.75 ng / mL, and 0 ng / mL, respectively.
[0079] Sample addition: Set up blank wells (blank control wells without sample, enzyme-labeled reagent, and biotin-labeled anti-AMH / FSHR antibody; all other steps are the same) and sample wells. Add 40 μL of sample to the sample wells on the enzyme-labeled plate, followed by 10 μL of biotin-labeled antibody. Place the sample at the bottom of the wells, avoiding contact with the well walls, and gently shake to mix.
[0080] Add enzyme: Add 50 μL of enzyme-labeled reagent to each well, except for blank wells.
[0081] Incubation: After sealing the plate with sealing film, incubate at 37°C for 30 minutes.
[0082] Washing: Carefully peel off the sealing film, discard the liquid, shake dry, fill each hole with washing solution, let stand for 30 seconds and then discard, repeat this 5 times, and pat dry.
[0083] Color development: Add 50 μL of color developer A to each well, then add 50 μL of color developer B, gently shake to mix, and develop at 37°C in the dark for 10 minutes.
[0084] Termination: Add 50 μL of stop solution to each well to stop the reaction (the blue color will immediately turn yellow).
[0085] Measurement: Zero the instrument using the blank well, and measure the absorbance (OD value) of each well sequentially at a wavelength of 450 nm. The measurement should be performed within 15 minutes after adding the stop solution.
[0086] turn out( Figure 6 ), NFATC2IP Knockout mice showed significantly reduced levels of anti-Müllerian hormone (AMH) and significantly increased levels of follicle-stimulating hormone (FSH).
[0087] The above description is only a preferred embodiment of the present invention. It should be noted that for those skilled in the art, several improvements and modifications can be made without departing from the principle of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.
Claims
1. A kind NFATC2IP The uses of gene knockout mouse models are characterized by, The intended use is shown in any of the following: (1) Prepare tools for screening or evaluating drugs for treating ovarian dysfunction; (2) As a research model for ovarian dysfunction.
2. The use according to claim 1, characterized in that, NFATC2IP The gene knockout mouse model was constructed according to the following steps: Designed for mice NFATC2IP A specific sgRNA for exon 5 of the gene was obtained; a CRISPR / Cas9 recombinant plasmid containing the sgRNA expression cassette was constructed; the recombinant plasmid was transcribed in vitro to obtain Cas9 mRNA and sgRNA; the Cas9 mRNA and sgRNA were co-injected into mouse zygotes and then transplanted into pseudopregnant mice to obtain F0 generation mice; the F0 generation and its offspring mice were genotyped and screened to obtain... NFATC2IP Gene knockout homozygous mice.
3. The use according to claim 2, characterized in that, The sequence of the sgRNA is as follows: gRNA-1: 5' - GCTTGGGGCTCAGGCAGGAG - 3'; gRNA-2: 5'-GTAAAGAGTCGAGAGCTCTG - 3'.
4. The use according to claim 2, characterized in that, PCR amplification and sequencing were performed using primers SEQ ID NO.3 and SEQ ID NO.4 to identify [the target cells]. NFATC2IP Gene knockout; Seq Nfatc2ip F: 5' - CTAGATCCTCATGCCTTCACCTCC - 3'; Seq Nfatc2ip R: 5' - TCTCTCTTTTGCTACCATCCTTGCC - 3'.
5. The use according to claim 2, characterized in that, The CRISPR / Cas9 recombinant plasmid is pX330-U6-Chimeric_BB-CBh-hSpCas9 plasmid.
6. The use according to claim 2, characterized in that, The mice in question were Balb / c mice.
7. The use according to claim 1, characterized in that, The ovarian dysfunction includes decreased ovarian reserve or premature ovarian failure.
8. The use according to claim 1, characterized in that, The research includes studies on the mechanisms of ovarian dysfunction, or the discovery and validation of biomarkers related to ovarian dysfunction.