Method for constructing anti-spinetoram neoseiulus californicus and ovarian targeting peptide thereof

By successfully knocking out the NcnAChRα6 gene in *Neoseiu Seymite* California using ReMOT Control technology, an ethyl spinosad-resistant strain with 23-fold resistance was established. This solved the problem of difficulty in improving drug resistance in *Neoseiu Seymite* California using existing technologies, and achieved stable genetics and efficient strain construction.

CN121406646APending Publication Date: 2026-01-27NANJING AGRICULTURAL UNIVERSITY
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202511285766.3
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-09-10
Publication Date
2026-01-27

AI Technical Summary

Technical Problem

Existing technologies make it difficult to efficiently improve drug resistance in Neoseido Seymite California through embryo microinjection, especially by knocking out drug resistance receptor genes. Moreover, the process is laborious and it is difficult to achieve stable genetic improvement of homozygous strains.

Method used

Using ReMOT Control technology, the ovarian-targeting peptide NcvgP2C and the Cas9 fusion protein NcvgP2C-Cas9, combined with sgRNA and saponins, were directly injected into the hemolymph of female adult Neoseis caecilians to edit the NcnAChRα6 gene. Subsequently, the strain was purified to obtain ethyl spinosad resistant strains.

Benefits of technology

A homozygous spinosad-resistant strain with 23 times the resistance was successfully established in Neoseido Seymite of California, reducing time and cost, expanding the possibilities for gene function research, and improving the compatibility of biological control.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121406646A_ABST
    Figure CN121406646A_ABST
Patent Text Reader

Abstract

The invention discloses a method for constructing an anti-spinetoram neoseiulus californicus gene and an ovary targeting peptide of the anti-spinetoram neoseiulus californicus gene. According to the invention, a segment of yolk protein targeted peptide binding region is identified in Neoseiulus californicus, and the yolk protein targeted peptide binding region and a Cas9 sequence are fused and constructed on a PET28a carrier, and the NcvgP2C-Cas9 protein is obtained through prokaryotic expression. NcvgP2C-Cas9 protein, sgNcnAChR alpha 6 and an endosome escape reagent are mixed and injected into female adult mites, NcnAChR alpha 6 gene large fragment deleted neoseiulus californicus offspring is obtained and shows a phenotype with 23.2 times of resistance to spinetoram, and the resistance of a knockout strain to the spinetoram belongs to an autosome partial recessive genetic mode. The invention provides a new method for the genetic improvement of the drug resistance of Neoseiulus californicus, and enhances the compatibility between biological control and pesticide treatment strategies.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of biotechnology, and the transformation events involved include the development of ovarian targeting peptides of Neoseis californica, Cas9 fusion protein, microinjection of Neoseis californica, and methods for establishing homozygous ethyl spinosad knockout strains. Technical Background

[0002] *Neoseiulus californicus* (McGregor), belonging to the class Arachnida, order Acarion, family Phytoseiidae, and genus *Neoseiulus*, primarily inhabits plants such as citrus, grapes, strawberries, avocados, corn, cassava, and vegetables, and effectively controls pests. *Neoseiulus californicus* has a short generation cycle, is tolerant of high temperatures and low humidity, has a broad-spectrum diet, strong resilience, exhibits consistent spatial distribution with other pests in the field, and shows some resistance to pesticides. Spider mites are common pests on vegetables and flowers. Due to their short lifespan, high reproductive capacity, and rapid development of resistance to most types of pesticides and acaricides, their populations grow rapidly. Therefore, it is necessary to adopt alternative pesticide control strategies to minimize losses. Utilizing natural enemies for biological control is a key component of Integrated Pest Management (IPM) and can reduce dependence on chemical pesticides. The currently available method is to combine predatory mites with insecticides to control spider mites without adversely affecting the predatory mites.

[0003] Currently, research on the application of predatory mites in integrated pest management (IPM) is progressing rapidly, with the most extensive research focusing on mites within the Phytoseiidae family. Among the many natural enemies of spider mites, *Neoseiuthis California* exhibits stronger resilience and a wider feeding range than other predatory mites, but its use in field IPM strategies is limited by the use of chemical pesticides. To alleviate this issue, previous studies have focused on evaluating the effects of pesticides on *Neoseiuthis California*, aiming to enhance the compatibility between biological control and pesticide management strategies. It is crucial to enhance the resistance of natural enemies to pesticides; however, genetic modification for pesticide resistance in natural enemies typically relies on multi-generational screening using chemical pesticides, a lengthy and laborious process. In contrast, genetic modification using CRISPR / Cas9 technology offers a promising approach to improving pesticide resistance in natural enemies.

[0004] Typically, CRISPR-Cas9 gene editing technology for genetic modification of arthropods involves injecting embryos with a ribonucleoprotein (RNP) complex composed of gene-specific single guide RNA (sgRNA) and Cas9 protein. However, due to the small size and extreme fragility of Neoseis caesarea embryos, embryonic microinjection presents significant challenges, hindering basic biological research and the advancement of drug resistance genetic modification in this predatory mite.

[0005] Recently, a technology called "ReMOT Control" (Receptor-Mediated Ovary Transduction of Cargo) has been developed. This method involves directly injecting the Cas9 RNP complex into the hemolymph of arthropods, delivering it to developing germ cells via receptors to edit offspring. This allows for targeted and heritable mutations through adult injection rather than embryonic injection. However, current applications of this technology in small species primarily target genes with visible phenotypes, such as those related to eye color and body color. No articles have been published on using ReMOT Control to knock out drug-resistant receptor genes. The challenge in using ReMOT Control to knock out drug-resistant receptor genes in small species lies in purifying the offspring strains. ReMOT Control technology can modify small, beneficial organisms, introducing pesticide resistance and other traits into natural enemies, pointing towards the future IPM strategy, which tightly integrates biological and chemical control strategies. Summary of the Invention

[0006] This invention addresses the shortcomings of methods for genetically modifying drug resistance in Neoseis californica by providing a method for obtaining a stable genetically modified Neoseis californica strain resistant to ethyl spinosad.

[0007] Firstly, this invention obtained the CDS sequence information of *Neoseuido catarrhalis* NcnAChRα6 through homology alignment analysis, PCR, and RACE amplification, revealing two different alternative splices at the third exon position. The nucleotide sequences of the two different alternative splice variants of NcnAChRα6 are shown in SEQ ID NO. 1 and SEQ ID NO. 2. The corresponding amino acid sequences are shown in SEQ ID NO. 3 and SEQ ID NO. 4.

[0008] Secondly, based on the obtained sequence information of NcnAChRα6, this invention designs sgRNAs at the positions of exons 2 and 9 of NcnAChRα6, respectively. The template of the sgRNA includes the following operable elements from the 5' end to the 3' end: a T7 promoter, an NcnAChRα6 gene target, and gRNA. The nucleotide sequence of the first NcnAChRα6 gene target at the position of exon 2 is shown in SEQ ID NO. 5, and the nucleotide sequence of the second NcnAChRα6 gene target at the position of exon 9 is shown in SEQ ID NO. 6.

[0009] Thirdly, based on an ovarian targeting peptide ligand (“NFTKTKNY”) identified in the closely related species *Ixodes scapularis*, this invention identified an ovarian targeting peptide ligand “NMTKTVDY” in the vitellogenin Ncvg1 gene of *Neoseiu's caesarea* through homology comparison. This targeting sequence is named “NcvgP2C”. The sequence information of the NcvgP2C ovarian targeting peptide ligand is shown in SEQ ID NO. 7.

[0010] Fourthly, this invention provides a method for expressing and purifying a fusion protein. A Cas9 sequence is fused with NcvgP2C, and the NcvgP2C-Cas9 fusion sequence information is shown in SEQ ID NO. 8. An EGFP sequence is fused with NcvgP2C, and the NcvgP2C-EGFP sequence information is shown in SEQ ID NO. 9. The two fusion sequences and the EGFP sequence are respectively constructed into the expression vector PET28a, and then NcvgP2C-Cas9, NcvgP2C-EGFP fusion proteins and EGFP protein are obtained through prokaryotic expression and protein purification.

[0011] Fifthly, this invention provides a method for detecting whether the NcvgP2C vitellin targeting peptide can target the ovary. An EGFP tag is attached to the NcvgP2C peptide, which is then injected into the female adult mite. The location of the green fluorescence within the mite is then directly observed using a confocal microscope, taking advantage of the nearly translucent yellow color of *Neoseiurea caesarea*.

[0012] Sixthly, this invention provides a method for detecting whether NcvgP2C and endosomal escape reagent (EER, saponin) can improve gene editing efficiency. In the ReMOT Control experiment, CRISPR / Cas9 ribonucleoproteins (RNPs) targeting NcnAChRα6 were prepared by mixing NcvgP2C-Cas9 protein (8 μg / μL), sgNcα6 (sgNcα6-1+sgNcα6-2, 10 μg / μL), and saponin (0.5 μg / μL), with all labeled concentrations being the final concentrations of each component in the mixture. To verify the effectiveness of NcvgP2C in promoting ovarian targeted delivery, Cas9+sgNcα6+saponin RNPs were used as a control. In addition, two injection groups without saponin were set up (Cas9+sgNcα6) and (NcvgP2C-Cas9+sgNcα6) to evaluate the impact of saponin on editing efficiency.

[0013] Seventhly, this invention provides an injection technique for *Neoseiu's chalcogenide* and a method for constructing ethyl spinosad-resistant strains. The timing of injection into adult female mites is primarily determined by the expression level of the vitellogenin gene *Ncvgs*. The injected adult female mites (G... -1 After laying eggs, the G0 to G1 generations self-pollinate within the colony until the G2 generation is produced. Then, male adults of the G2 generation are selected using 5 mg / L spinosad. Surviving G2 generation males are hybridized with unmated G2 generation females to produce the G3 generation. Subsequently, all prenymphs of the G3 generation are selected using 5 mg / L spinosad, and surviving G3 generation individuals are colony-crossed. After producing a sufficient number of G4 generation individuals, DNA is extracted from the G3 generation individuals for genotyping.

[0014] Eighthly, the present invention provides primer pairs for detecting the above-mentioned knockout strain genotype, namely an inner primer and an outer primer, wherein the inner primer sequence is Ncα6-f1 / r1 and the outer primer sequence is Ncα6-F1 / R1 (Table 3).

[0015] The objective of this invention can be achieved through the following technical solutions:

[0016] A targeting peptide ligand NcvgP2C for the egg yolk protein of *Neoseius californicus* is encoded by the gene shown in SEQ ID NO.7.

[0017] The application of the described NcvgP2C, a yolk protein targeting peptide ligand of *Neoseiu Seymite californica*, in the preparation of reagents or drugs targeting the ovaries of female adult *Neoseiu Seymite californica*, wherein the drug is a nucleic acid drug or a protein drug.

[0018] A gene-editing composition for NcnAChRα6 of Neoseis californica, comprising the fusion protein NcvgP2C-Cas9 of Cas9 and the aforementioned NcvgP2C, sgRNA of NcnAChRα6, and an endosome escape agent.

[0019] As a preferred embodiment of the present invention, the Cas9 fusion protein NcvgP2C-Cas9 is composed of the ovarian targeting peptide ligand NcvgP2C and the Cas9 sequence, as shown in SEQ ID NO.8; the sgRNA includes sgNcα6-1 and sgNcα6-2, with target sequences as shown in SEQ ID NO.5 and SEQ ID NO.6, respectively; and the endosome escape reagent is saponin.

[0020] As a further preferred embodiment of the present invention, the final concentration of the Cas9 fusion protein NcvgP2C-Cas9 in the composition is 8 μg / μL, the final concentration of the sgRNA of NcnAChRα6 is 10 μg / μL, and the final concentration of saponin is 0.5 μg / μL, wherein the sgRNA is composed of sgNcα6-1 and sgNcα6-2.

[0021] The application of the described NcnAChRα6 gene-editing composition for Neoseis caecifolius in the creation of a stably inherited strain of Neoseis caecifolius resistant to spinosad.

[0022] The application of the described NcnAChRα6 gene editing composition of *Neoseiu Seymite Californiae* in the construction of *Neoseiu Seymite Californiae* with the NcnAChRα6 gene knocked out.

[0023] A method for obtaining a stably inherited spinosad-resistant strain of *Neoseiu Seymite californicum* involves knocking out the *Neoseiu Seymite californicum* NcnAChRα6 gene using the aforementioned *Neoseiu Seymite californicum* NcnAChRα6 gene editing composition, followed by strain purification to obtain a stably inherited spinosad-resistant strain of *Neoseiu Seymite californicum*.

[0024] As a preferred embodiment of the present invention, the NcnAChRα6 gene-editing composition of *Neoseiu Seymite* California is injected into female adult *Neoseiu Seymite* California.

[0025] As a preferred embodiment of the present invention, the strain purification method involves injecting female mites G... with the described NcnAChRα6 gene-editing composition of *Neoseiuthecus californicus*. -1After laying eggs, the G0 generation self-pollinates to produce the G1 generation, and the G1 generation produces the G2 generation in the same way. Then, male adult mites of the G2 generation are screened using ethyl spinosad at a concentration of 5 mg / L. The surviving male adult mites of the G2 generation are paired with unmated female adult mites of the G3 generation to produce the G3 generation. Subsequently, all pronymphs of the G3 generation are screened using ethyl spinosad at a concentration of 5 mg / L. The surviving individuals are homozygous mutants. These surviving individuals are then crossbred to produce offspring, which yields a stable genetic strain of Neoseis caecilian ethyl spinosad resistance.

[0026] Beneficial effects:

[0027] This invention cloned and analyzed the NcnAChRα6 gene of *Neoseiu Seymboroides chalcogenide*, and verified the structural characteristics of the NcnAChRα6 subunit through amino acid sequence alignment. For the first time, ReMOT Control technology was used to modify natural enemies, and the NcnAChRα6 gene of *Neoseiu Seymboroides chalcogenide* was successfully knocked out. Through a series of strain purification processes, a homozygous mutant strain with 23-fold resistance to spinosad was obtained. Using CRISPR / Cas9 technology combined with the ReMOT Control method, the resistant strain could be obtained in just four generations. Furthermore, compared to embryo microinjection, the ReMOT Control method offers greater convenience, time efficiency, and cost-effectiveness, allowing for convenient application to different species by targeting oviposition in adult mites rather than embryos.

[0028] The successful establishment of ReMOT Control technology in *Neoseiu Seymbolica calica* not only broadens the possibilities for gene function research in this species but also demonstrates its potential for modifying other predatory mites. *Neoseiu Seymbolica calica* contains a Cas9 fusion protein containing eight amino acids of vitellin (NcvgP2C), which can effectively target the ovaries of adult female mites. Therefore, when NcvgP2C-Cas9 is injected together with RNPs, it can be effectively delivered to developing oocytes, thereby achieving gene editing in G0 embryos. The highly conserved domains of the vitellin (Vg) gene, especially those related to protein transport and nutrient storage functions, suggest that the NcvgP2C ligand may have broader species applicability. Given that the ReMOT Control method is relatively easier than embryo injection methods, it is expected to become a valuable tool for advancing current biocontrol research and practice. Attached Figure Description

[0029] Figure 1Protein sequence alignment of the nicotinic acetylcholine receptor α6 (Ncα6) from *Neoseiuthis caecilian*. (A) Alignment of α6 amino acid sequences and corresponding Ncα6 sequences from *Drosophila melanogaster* (AAM13392.1), *Rhizoctonia solani* (KX772401.1), and *Ixodes scapulae* (UOU03418.1). Exons 2 and 9 are enclosed in red. Transmembrane regions (TM) and six loops are indicated by black horizontal lines. The two cysteine ​​residues forming the cysteine ​​loop are marked with a red asterisk. Identical amino acid sequences are highlighted in orange, with dashed lines indicating gaps. (B) Amino acid sequence alignment of alternative splicing exons 3a / 3b from *Rhizoctonia solani* (3a: KX772401.1; 3b: XP_037288661.1) and *Neoseiuthis caecilian* (3a: PQ664594; 3b: PQ664595).

[0030] Figure 2 Recombinant protein expression and NcvgP2C-mediated EGFP localization. (A) Schematic diagram of the PET28a vector construction showing the expression of EGFP, NcvgP2C-EGFP, and NcvgP2C-Cas9 proteins regulated by the T7 promoter in E. coil cells. NcvgP2C consists of 8 amino acids of Ncvg1, located at positions 201 to 208 of the Ncvg1 protein sequence. (B) Detection of E. coli cell lysates expressing 6x His-tagged NcvgP2C-Cas9, EGFP, and NcvgP2C-EGFP using chemiluminescence. M: protein marker; 1: NcvgP2C-Cas9-6x His; 2: EGFP-6x His; 3: NcvgP2C-EGFP-6x His. (C) Image showing that the EGFP-tagged NcvgP2C protein peptide targets the ovaries of *Neoseiformis chapensis*. NcvgP2C directed the NcvgP2C-EGFP fusion protein into the ovaries of *Neoseiuthischianus*, and green fluorescence was visible near the ovaries 1 day post-injection. In the EGFP injection group, fluorescence was only observed at the injection site.

[0031] Figure 3 The expression level of the vitellogenin gene in *Neoseuido californica* was used to optimize the microinjection procedure and timing of *Neoseuido californica*. (A) Schematic diagram of *Neoseuido californica* injection procedure. (B) Expression profile of the *Ncvgs* gene in *Neoseuido californica* at different developmental stages. Error bars represent the standard error (SE) of the mean of at least three independent replicates. Lowercase letters (a, b, c, and d) indicate significance between treatments as determined by one-way ANOVA and Tukey's test (P < 0.05).

[0032] Figure 4 Construction process of NcnAChRα6 knockout homozygous strain of Neoseis calica

[0033] Figure 5 Gene editing of NcnAChRα6 in *Neoseiuthischianus* mediated by ReMOT Control technology. (A) Schematic diagram showing the genomic structure of NcnAChRα6, sgRNA target site, and allele-specific PCR amplification primer positions. (B) Representative DNA sequences obtained from *Neoseiuthischianus* individuals showing the NcnAChRα6 knockout mutation. Target and PAM sequences are highlighted in blue and red, respectively.

[0034] Figure 6 Genetic linkage between the Nca6 deletion mutation in *Neoseiurea caecifolium* and resistance to ethyl spinosad. The genotype of Ncα6 in individual mites was determined based on PCR product bands amplified using a mixture of two primer pairs (Ncα6-F1 / R1 and Ncα6-f1 / r1). For the outer primer pair (Ncα6-F1 / R1), the wild type did not produce an amplified fragment because the fragment (>35 kb) was too long to amplify under our PCR conditions. In contrast, the knockout line was expected to amplify a short fragment (~700 bp) using the outer primer pair. The inner primer pair (Ncα6-f1 / r1) amplified a small fragment (~100 bp) from the wild type, but not from the knockout individuals. (A) Primer positions in the wild-type and knockout lines of NcnAChRα6. (B) PCR amplification products from untreated F2 female mites (n=30). (C) PCR amplification products of F2 surviving individuals (n=27) after treatment with 5 mg / L spinosad. Detailed Implementation

[0035] Through extensive research and repeated experiments, the inventors combined the microinjection technique of *Neoseiuthis Californiae*, the establishment of knockout strains, and molecular biological manipulation with the selection of gene mutation sites, the identification of ovarian targeting peptides, and the expression of Cas9 fusion proteins to construct a homozygous knockout strain of *Neoseiuthis Californiae* Ncα6 exhibiting 23-fold resistance to ethyl spinosad. This resistant strain helps increase the compatibility between biological and chemical control techniques in the field.

[0036] Example 1: Obtaining and verifying the NcnAChRα6 gene sequence of *Neoseiuthischianus*.

[0037] We searched the NCBI database for nAChRα6 sequences in arachnids and identified annotated nAChRα6 sequences in *Ixodes scapularis* (MZ027288.1) and *Rhipicephalus microplus* (ASU46163.1). Based on these two sequences, we performed a comparative analysis on the genome of *Neoseiu caesarea* (GCA_031001865.1) and identified the NcnAChRα6 gene. Subsequently, primers were designed based on the identified NcnAChRα6 sequence information, and the complete transcript sequence of NcnAChRα6 was obtained using the HiScript TS 5' / 3' RACE kit (Novizan, Nanjing, China). The specific steps are as follows:

[0038] Table 1 Primers used for NcnAChRα6 sequence amplification

[0039]

[0040] (1) Using RNA from different developmental stages as templates (RNA from each developmental stage was mixed in equal proportions), 5' cDNA and 3' cDNA were obtained using the HiScript-TS5' / 3'RACE Kit (RA101, Vazyme) for subsequent PCR amplification. The specific synthesis systems are shown below.

[0041]

[0042] After adding the sample according to the above system, incubate at 72°C for 3 minutes, then place on ice for 2 minutes.

[0043] (2) Based on the reaction product obtained in step 1), the reverse transcription reaction system was prepared as follows:

[0044]

[0045] The above components were gently mixed using a pipette, briefly centrifuged, and then incubated at 42°C for 90 min and 70°C for 15 min. The resulting 5' cDNA and 3' cDNA templates were then diluted 3-fold for subsequent experiments.

[0046] (3) The next experiment involved amplifying the 5' and 3' ends of the NcnAChRα6 gene sequence using the 5'RACE-R1 and 3'RACE-F1 primers designed in Primer Table 1. The PCR reaction system is as follows:

[0047]

[0048] After mixing the above components, run the following program in the PCR instrument: 98℃, 1 min; (98℃, 10 s; 72℃, 3 min) 5 cycles; (98℃, 10 s; 70℃, 15 s; 72℃, 3 min) 5 cycles; (98℃, 10 s; 68℃, 15 s; 72℃, 3 min) 25 cycles; 72℃, 5 min.

[0049] (4) Take the PCR product from step 3) above, dilute it 20 times, and the PCR reaction system is as follows:

[0050]

[0051]

[0052] After mixing the above components, run the following program in the PCR instrument: 98℃, 1 min; (98℃, 10 s; 68℃, 15 s; 72℃, 3 min) 25 cycles; 72℃, 5 min.

[0053] (5) The PCR products were recovered by agarose gel electrophoresis, ligated into the TOPO vector in the Ultra-Universal TOPOCloning Kit (Vazyme, Nanjing), and sequenced. The sequence information of NcnAChRα6 was obtained by sequence splicing.

[0054] The full-length cDNA sequence of NcnAChRα6 was cloned using PCR and RACE kits. The two alternative splicing coding sequences in the NcnAChRα6 gene are 1650 bp (shown in SEQ ID NO.1 and SEQ ID NO.2), encoding 549 amino acids (shown in SEQ ID NO.3 and SEQ ID NO.4). The amino acid sequence of NcnAChRα6 was compared with that of nAChRα6 in Drosophila melanogaster (AAM13392.1), Boletus microticus (KX772401.1), and Ixodes scapulae (MZ027288.1). The comparison results showed that nAChRα6 possesses conserved regions corresponding to the Cys loop ligand-gated ion channel (LGIC) superfamily, namely four transmembrane domains (TM1-4), six loop regions (AF), and one conserved Cys loop (…). Figure 1A). The amino acid similarity between Ncα6 and Rmα6, and between Isα6 and Dmα6 is relatively high, at 68%, 65%, and 57%, respectively. By comparing the sequence information of Ncα6 with the genome of *Rhizoctonia solani* (GenBank: GCA_000255335.1), it was found that Ncα6 has conserved intron / exon splicing sites, containing a total of 11 exons. Sequencing results revealed two distinct splicing variants in the third exon of Ncα6 (exon 3a, exon 3b), and these were compared with the alternative splicing variants of *R. microplus*. Figure 1 B).

[0055] Example 2: Vector construction and protein expression and purification of recombinant Cas9 protein for ReMOT control technology

[0056] The application of ReMOT Control technology first requires the identification of vitellogenin peptides that target the ovary in *Neoseiulus barkeri*. Based on previously reported vg sequences (vg1: ASB34115.1; vg2: ASB34116.1; vg3: ASB34117.1) of *Neoseiulus barkeri*, three vitellogenin genes were identified in the transcriptome of *Neoseiulus barkeri* and named Ncvg1 (PQ664591), Ncvg2 (PQ664592), and Ncvg3 (PQ664593). Based on an ovarian targeting peptide ligand (NFTKTKNY) identified in the closely related species *Ixodes scapularisin*, a vitellin-binding region “NMTKTVDY” (SEQ ID NO. 5) was identified in the Ncvg1 gene of *Neoseiformis caesarea* through homology comparison. This targeting sequence was named “NcvgP2C”. Figure 2 A).

[0057] The Cas9 sequence information is shown in SEQ ID NO. 8, 28bp-4131bp (marked with a gray background). This fragment was synthesized by Qingke Biotechnology Co., Ltd. Then, the NcvgP2C fragment and the Cas9 sequence were fused together by PCR using the primers in Table 2 to obtain the NcvgP2C-Cas9 (SEQ ID NO. 8) sequence. The NcvgP2C fragment and the EGFP sequence were then fused together by PCR to obtain the NcvgP2C-egfp (SEQ ID NO. 9) sequence.

[0058] Table 2 Primers for protein expression vector construction

[0059]

[0060] PET28a was digested with restriction endonucleases NcoI and NotI (Takara), and then digested with AxyPrep. TM The linearized PET28A vector was recovered using the DNA Gel Extraction Kit. The NcvgP2C-cas9, NcvgP2C-egfp, and egfp sequences were recombined into the linearized PET28a using a 5x one-tube cloningmix recombinase (EnzyArtisan, Shanghai, China). Positive colonies were then detected by spot testing and sent to Qingke Biotechnology Co., Ltd. for sequencing, yielding the PET28a-NcvgP2C-cas9, PET28a-NcvgP2C-egfp, and PET28a-egfp vectors.

[0061] The plasmids PET28a-NcvgP2C-cas9, PET28a-NcvgP2C-egfp, and PET28a-egfp were introduced into BL21 competent cells (New England Biolabs, City, MA). Single colonies were then picked and transferred to 1 ml of culture medium, and then diluted 1:100 to 10 ml of medium. The cells were incubated overnight at 37°C and 220 rpm. The culture was then transferred 1:100 to 500 ml of medium and shaken at 37°C and 220 rpm. When the OD600 of the bacterial culture reached 0.6-0.8, 0.2 mM isopropyl-β-D-thiogalactopyranoside (IPTG) was added, and the cells were induced for 30 h at 16°C and 200 rpm. Bacterial cells were collected at 12,000 rpm, 4°C, and 5 min. After discarding the supernatant, the cells were resuspended in binding buffer (20 mM Na₂HPO₄·12H₂O, 0.5 M NaCl, 20 mM imidazole, pH 7.4). Then, a protease inhibitor (1 mM) was added, and the cells were disrupted using an ultrasonic homogenizer (5 s, 3 s interval). After disruption, the supernatant was collected by centrifugation (12,000 rpm, 4°C, 5 min), and incubated on Ni-NTA agarose beads (Qiagen) at 4°C for 4–6 h. The protein was then purified and eluted using affinity chromatography. First, wash the Ni-NTA agarose beads continuously with binding buffer (20mM Na2HPO4·12H2O, 0.5M NaCl, 20mM imidazole, pH=7.4) to remove other unbound proteins. Then, elute the target protein with elution buffer (20mM Na2HPO4·12H2O, 0.5M NaCl, 500mM imidazole, pH=7.4). Desalt the target protein using a Sephadex™ G-25M (Cytiva) desalting column (Cytiva, Marlborough, MA, USA) (following the instructions). Finally, concentrate the target protein using Merck ultrafiltration tubes. Protein bands were analyzed by immunoblotting using His antibody diluted 1:3000 (Sigma-Aldrich, St. Louis, MO, USA) and Western Lightning Plus ECL chemiluminescent substrate (PerkinElmer, Waltham, MA, USA). The expected molecular weights were 160 kDa for NcvgP2C-cas9, 29 kDa for NcvgP2C-egfp, and 28 kDa for egfp. Figure 2 B).

[0062] Example 3: Design and Synthesis of sgRNA

[0063] Based on the nAChRα6 subunit sequence information of *Neoseilles caecifolius* obtained through cloning and sequencing in Example 1, and according to the design principles of sgRNA in the CRISPR / Cas9 system, target sequences satisfying 5'-NGG-3' or 5'-CCN-3' were found on the 2nd and 9th exons of *Neoseilles caecifolius* nAChRα6, respectively. Here, N can be any nucleotide. The sgRNA sequence should be 18-20 bp in length, excluding PAM, and contain one or two 5' terminal guanines to promote transcription by T7 RNA polymerase. The nucleotide sequence of the first NcnAChRα6 gene target is shown below. CCA ACGAATCAGAACCGCTT (SEQ ID NO.4, underlined PAM sequence), the nucleotide sequence of the second NcnAChRα6 gene target site is as follows: CCT GTATCATGATGATGGTGGCC (SEQ ID NO. 5, underlined PAM sequence) was used to examine the editing efficiency of the sgRNA sequence using the following online tool: CRISPR (http: / / crispor.tefor.net / ). Based on the target location, two pairs of detection primers, Ncα6-F1 / R1 and Ncα6-f1 / r1, were designed to detect the knockout results (Table 3).

[0064] Table 3 Primers for sgNcα6 synthesis and primers for knockout strain detection

[0065]

[0066] The sgNcα6-F1 / R1 and sgNcα6-F2 / R2 primers were diluted to 0.3 μM. Then, GeneArt was used... TM The Precision gRNA Synthesis Kit (Thermo Fisher Scientific, Lithuania) provides a template for sgRNA synthesis via PCR reaction.

[0067]

[0068] PCR reaction program: 98℃ for 10s; 98℃ for 5s, 55℃ for 15s, for a total of 32 cycles; 72℃ for 1min.

[0069] 1) Purify the above PCR product using a purification kit (QIAGEN, Germany), and finally add 20 μl of Nuclease-free water.

[0070] 2) In vitro transcription to synthesize sgRNA, the reaction system is as follows:

[0071]

[0072] React at 37℃ for 2-3 hours, then add 1 μL LDNase I to the reaction system and react at 37℃ for 15 minutes.

[0073] 3) Purification of sgRNA:

[0074] 1. Add 130 μL of Nuclease-free Water to the above in vitro transcription system to a final volume of 150 μL. Then add an equal volume of phenol-chloroform-isoamyl alcohol (phenol:chloroform:isoamyl alcohol = 25:24:1, pH < 5.0), vortex to mix, and centrifuge at 13000g, 4℃ for 10 min.

[0075] 2. Transfer the supernatant to a new 1.5 mL RNase-free centrifuge tube, add an equal volume (chloroform:isoamyl alcohol = 24:1), vortex to mix, centrifuge at 13000 g, 4 °C for 10 min, and repeat twice;

[0076] 3. Transfer the supernatant to a new 1.5 mL RNase-free centrifuge tube, add an equal volume of isopropanol, vortex to mix, and incubate at -20°C for 4-6 hours.

[0077] 4.13000g, centrifuged at 4℃ for 30min, discard the supernatant;

[0078] 5. Add 1 mL of freshly prepared 75% ethanol, centrifuge at 13000 g for 10 min at 4 °C, and wash twice;

[0079] 6. Discard the supernatant, place the precipitate upright in a clean bench to air dry. When the precipitate begins to change from white to transparent gel, add Nuclease-free water and mix by blowing and stirring. Then dispense 5 μL into each tube and store at -80°C.

[0080] Example 4: Microinjection and fluorescence observation of adult female Neoseui mites of California

[0081] In the wild-type population (FZ) of *Neoseiu's mites* in California, a synchronized instar population was established to ensure uniformity in the state of injected adult females. During injection, the female adult mite's back was gently pressed against double-sided tape for fixation (abdomen facing upwards). All subsequent injections were performed on the right spiracles near the third pair of legs (ventral side). Figure 3 A). Injection timing was based on the expression level of the vg gene in the hemolymph of *Neoseiuthischianus* (California). Figure 3B) The expression level of the vg gene is highest on the second day of adulthood. To confirm whether NcvgP2C targets the ovary (aggregates in the ovary), female adult mites (on the second day of adulthood) were injected with NcvgP2C-egfp (3 μg / μL) and egfp (3 μg / μL) respectively using a quartz capillary needle until obvious abdominal swelling of the adult mites could be observed. After injection, the mites were gently removed from double-sided tape with an insect needle (00#) and reared separately. Taking advantage of the almost translucent yellow body color of *Neoseiu Seymite*, female adult *Neoseiu Seymite* were first photographed using a stereomicroscope (Nikon SMZ25) connected to a digital camera (Nikon DSRi2) to confirm that the ovary is located between the third and fourth pairs of legs, in the middle of the abdomen. Then, samples were collected 24 hours after injection. After cryo-vertigo, the samples were placed on a concave microscope slide, covered with a coverslip, and photographed under a confocal laser scanning microscope (Leica Microsystems, Deerfield, IL, USA) to confirm the location of fluorescence. According to the confocal results, 24 hours after injection, female mites injected with NcvgP2C-EGFP protein showed green fluorescence around the ovary, while female mites injected with EGFP protein only showed fluorescence near the injection site (right lower abdominal spiracles), and no fluorescence was observed around the ovary. Figure 2 C), thus concluding that the NcvgP2C ligand can be directed into the ovaries of *Neoseiuthischianus*.

[0082] In the ReMOT Control experiment, CRISPR / Cas9 ribonucleoproteins (RNPs) targeting NcnAChRα6 were prepared by mixing NcvgP2C-Cas9 protein (8 μg / μL), sgNcα6 (sgNcα6-1+sgNcα6-2, 10 μg / μL), and saponin (0.5 μg / μL). All labeled concentrations are the final concentrations of each component in the mixture. To verify the effectiveness of NcvgP2C in promoting ovarian targeted delivery, RNPs of Cas9+sgNcα6+saponin were used as controls. In addition, injection groups without saponin (Cas9+sgNcα6) and (NcvgP2C-Cas9+sgNcα6) were set up to evaluate the effect of saponin on editing efficiency. Table 4 lists the specific components of all experimental groups. The injection was performed on the second day after the mites reached adulthood. These female mites, used in the gene-editing experiments, had already mated with wild-type male mites on the second day of adulthood. The injected female mites (G... -1The mites were individually placed in new culture dishes (the bottom of the dishes was covered with black plastic film, and Tanglefoot was used to draw a circle around them to prevent escape). The survival rate and egg production of female adults were then assessed 48 hours after injection. In Table 4, in the two injection groups without saponin, the survival rate of the NcvgP2C-Cas9 group was 44.5 ± 2.1%, while the survival rate of the Cas9 group was 44.3 ± 2.1%. In contrast, the addition of saponin reduced the survival rates of these two injection groups to 24.2 ± 2.6% and 25.2 ± 2.1%, respectively (Table 4). Subsequent strain construction methods are as follows... Figure 4 As shown, all individuals in the G3 generation were treated with 5 mg / L spinosad at the prenymphal stage until the G3 generation was obtained. All surviving individuals were genotyped and confirmed as homozygous knockouts of Ncα6. Survival rates of the G3 generation varied across different experimental groups. For example, in the injection group without saponins, the survival rate of the NcvgP2C-Cas9 group was 4.3 ± 0.4%, while no individuals in the Cas9 group survived after selection. In contrast, the addition of saponins increased the survival rate of the NcvgP2C-Cas9 group to 10.6 ± 1.1% and the survival rate of the Cas9 group to 0.4 ± 0.4% (Table 4). In conclusion, both NcvgP2C and saponins can improve the gene editing efficiency of *Neoseiuthischiana*, although the addition of saponins had a negative impact on the survival rate of injected female mites compared to the injection group without saponins.

[0083] Table 4. Effects of CRISPR-Cas9 injection components on exposure to 5 mg / L -1 Survival rate of female Neoseui cyanobacterium acnes of the G3 generation using ethyl spinosad

[0084]

[0085] a. The number of female mites that survived the injection.

[0086] b G3 pre-generation nymphal mites were treated with 5mg L. -1 Screening of ethyl spinosad. Injection system and procedures are detailed below. Figure 4 All individuals that survived the screening were homozygous.

[0087] Example 5: Purification and Genotyping of NcnAChRα6 Knockout Lines

[0088] Because most Phytoseiid predatory mites reproduce pseudoparthenogenesis, females must mate before laying fertilized eggs. During early embryonic development, in the eggs laid by these pseudoparthenogenic predatory mites, the paternal genome is eliminated in the male eggs, resulting in haploidity, while diploid eggs develop into female mites. This haploid-diploid characteristic is an advantage for the successful application of ReMOT Control technology because mutations in the reproductive cells of adult female mites can be identified in haploid male mites. Based on their reproductive characteristics, the injected female mite (G... -1 After laying eggs, the G0 generation produces the G1 generation through in-colony self-pollination, and the G1 generation produces the G2 generation in the same way. Then, male adults of the G2 generation are selected using 5 mg / L spinosad. Surviving male adults of the G2 generation mate with unmated female adults of the G3 generation to produce the G3 generation. Figure 4 Subsequently, all G3 pronymphs were screened using 5 mg / L spinosad, and the surviving individuals were functionally homozygous mutants. By retaining the surviving G3 individuals selected after 5 mg / L spinosad treatment in the NcvgP2C-Cas9+sgNcα6+saponin injection group, the subsequent knockout strain FZ-α6KO was established. After hybridization between surviving G3 individuals to obtain the G4 generation, the G3 parents were used... DNA was extracted using a blood and tissue kit (Qiagen). PCR amplification and sequencing analysis were performed using primers Ncα6-F1 / R1 and Ncα6-f1 / r1. All surviving G3 generation individuals carried NcnAChRα6 DNA deletion, and seven different gene-editing mutations were identified. These mutations all resulted in large deletions of 35 kb, with four also containing insertions of varying lengths: Ncα6-KO-2 (+8 bp), Ncα6-KO-3 (+4 bp), Ncα6-KO-4 (+2 bp), and Ncα6-KO-5 (+4 bp). Figure 5 Then, individuals carrying these seven types of edits were combined to create functional homozygous knockout strains with multiple mutation types.

[0089] Example 6: Bioassay

[0090] The pesticides we used were spinosad (60 g / L suspension concentrate, Covestro, Shanghai), spinosad (25 g / L suspension concentrate, Covestro, Shanghai), and abamectin (74.1% TC, Hebei Weiyuan Biochemical Co., Ltd., Shijiazhuang). Triton X-100 was purchased from Beijing Solarbio Technology Co., Ltd. For abamectin benzoate, a preliminary concentration of 10 g / L was prepared using Triton X-100 (10% w / v) and acetone. The prepared insecticides were then serially diluted with 0.1% Triton X-100. Each agent was diluted to five concentrations: spinosad (0.25 mg / L, 0.5 mg / L, 1 mg / L, 2 mg / L, and 4 mg / L), spinosad (2.5 mg / L, 5 mg / L, 10 mg / L, 20 mg / L, and 40 mg / L), and abamectin (1.25 mg / L, 2.5 mg / L, 5 mg / L, 10 mg / L, and 20 mg / L). We used the residual contact bottle method to determine the susceptibility of the wild-type strain of *Neoseiu's calica* (FZ) and the Ncα6 knockout strain (FZ-α6KO) to spinosad, spinosad, and abamectin. The bioassay concentration gradient for ethyl spinosad in the FZ-α6KO strain was (3.125 mg / L, 6.25 mg / L, 12.5 mg / L, 25 mg / L, and 50 mg / L). The bioassay concentrations for the other two pesticides were the same as above. 0.1% Triton X-100 was used as a blank control. 1 mL of pesticide was added to a 20 mL covered plastic measuring cup, which was then rotated to cover the surface of the cup until it air-dried. Twenty female adult mites were tested at each concentration, for a total of 100 female adult mites across the five concentrations. Mortality was recorded after 24 hours. Mites showing no movement when touched with a fine-bristled brush were considered dead. The mortality data were analyzed using SPSS 22.0 software. If the 95% confidence limits did not overlap between different strains, the LC50 was considered acceptable. 50 The values ​​show significant differences.

[0091] The susceptibility of Ncα6 knockout (FZ-α6KO) and wild-type (FZ) lines to three insecticides was analyzed. Data showed that the FZ-α6KO line exhibited a 23.2-fold increase in resistance to spinosad compared to the FZ line (Table 5). Conversely, resistance levels to abamectin and spinosad showed no significant change, with resistance folds of 1.2-fold and 0.9-fold, respectively. This indicates that Ncα6 knockout primarily enhanced resistance to spinosad without significantly affecting susceptibility to other insecticides.

[0092] Table 5. Sensitivity of nAChRα6 knockout strain (FZα6-KO) and wild type (FZ) to three insecticides.

[0093] a resistance multiple = FZα6 - KO's LC 50 / FZ's LC 50 .

[0094] Example 7: Genetic linkage analysis of resistance to ethyl spinosad in NcnAChRα6 knockout strains

[0095] Eighty susceptible male mites were paired with 80 female mites from the Ncα6 knockout strain (G5 generation) (FZ♂XFZ-α6KO♀), and then another pairing was performed, pairing 80 susceptible female mites with 80 Ncα6 knockout male mites (G5 generation) (FZ♀X FZ-α6KO♂). After mating, the offspring from these two hybridizations were collected and reared to adulthood. The susceptibility of F1 generation female adult mites from both hybrid strains to ethyl spinosad was determined. Following the bioassay method in Example 6, the bioassay was repeated three times. Dominance (D) was calculated according to the method described by Stone (1968) (Stone, 1968), with D values ​​ranging from -1 (complete recessive resistance) to +1 (complete dominant resistance). The susceptibility of the FZ strain, the FZ-α6KO strain, and their reciprocal F1 progeny to ethyl spinosad was evaluated using concentration-response curves. LC-MS / MS of ethyl spinosad were also investigated. 50 Value analysis shows that F1 a and F1 b The resistance ratios (RR) of the offspring were 1.2 and 1.5 times that of the susceptible lines, respectively, and the F1 generation... a and F1 b The 95% confidence intervals overlapped. This overlap indicates that resistance to ethyl spinosad in the FZ-α6KO line is controlled by autosomal factors. Furthermore, F1... a and F1 b The dominance (D value) of resistance to ethyl spinosad in the offspring was -0.98 and -0.96, respectively. This indicates that the resistance of the FZ-α6KO line to ethyl spinosad follows an autosomal recessive inheritance pattern (Table 6).

[0096] Table 6. Survival rates of *Neoseiu's caecifolium* from FZα6-KO, FZ strains, and their F1 generation under ethyl spinosad treatment.

[0097] a resistance multiple = FZα6 - KO's LC 50 Or the LC of the F1 generation 50 / FZ's LC 50 ...

[0098] b The D value is calculated according to Stone's (1968) method. The D value ranges from +1 to -1: +1 indicates that the resistance is completely dominant, and -1 indicates that the resistance is completely recessive.

[0099] To perform linkage analysis, 50 female mites (rs) from the F1 generation were backcrossed with 50 male mites (r) from the FZ-a6KO strain to generate the F2 generation. Female adults from the F2 generation were randomly selected and exposed to 5 mg / L spinosad. Genomic DNA was extracted from surviving treated female adults and untreated females, and the genotype of NcnAChRa6 was determined by cloning and sequencing specific PCR amplification products using the method described in Example 5. To verify the association between NcnAChRa6 and spinosad resistance, F1 female mites (rs) were backcrossed with male mites (r) from the FZ-a6KO strain to generate the F2 generation. Sixty female adults were selected from the F2 generation and screened at a concentration of 5 mg / L spinosad; the survival rate was 45% (27 / 60, Table 7). Thirty untreated F2 generation female mites were randomly selected, and DNA was extracted for PCR detection. Figure 6 B), these individuals were found to be either heterozygous (17 / 30) or homozygous (13 / 30), indicating an expected rs / rr ratio of 1:1. However, the rs / rr ratio was 0 rs:27 rr ( Figure 6 C) showed a significant deviation from the 1:1 ratio (P<0.0001, Fisher's test). These results confirm that the NcnAChRa6 deletion in the FZ-a6KO line is genetically linked to ethyl spinosad resistance (Table 7).

[0100] Table 7. Genetic linkage analysis between Ncα6 knockout of *Neoseiuthischianus* and resistance to ethyl spinosad.

[0101]

Claims

1. A targeting peptide ligand NcvgP2C for the egg yolk protein of *Neoseiuthischianus*, characterized in that, The encoding gene is shown in SEQ ID NO.

7.

2. The use of the NcvgP2C yolk protein targeting peptide ligand of *Neoseiu Seymite caecifolium* as described in claim 1 in the preparation of reagents or drugs targeting the ovaries of female adult *Neoseiu Seymite caecifolium*, wherein the drug is a nucleic acid drug or a protein drug.

3. A gene-editing composition for *Neoseiuthischianus* NcnAChRα6, characterized in that, It consists of Cas9 and the fusion protein NcvgP2C-Cas9 of NcvgP2C as described in claim 1, sgRNA of NcnAChRα6, and an endosome escape reagent.

4. The NcnAChRα6 gene editing composition for Neoseis californica according to claim 3, characterized in that, The Cas9 fusion protein NcvgP2C-Cas9 is composed of the ovarian targeting peptide ligand NcvgP2C and the Cas9 sequence, as shown in SEQ ID NO.8; the sgRNA includes sgNcα6-1 and sgNcα6-2, and the target sequences are shown in SEQ ID NO.5 and SEQ ID NO.6, respectively. The endosome escape reagent is saponin.

5. The NcnAChRα6 gene editing composition for *Neoseiuthischianus* according to claim 4, characterized in that, The final concentration of the Cas9 fusion protein NcvgP2C-Cas9 in the composition is 8 μg / μL, the final concentration of the sgRNA of NcnAChRα6 is 10 μg / μL, and the final concentration of saponin is 0.5 μg / μL. The sgRNA is composed of sgNcα6-1 and sgNcα6-2.

6. The use of the NcnAChRα6 gene-editing composition of any one of claims 3-5 in the creation of a stably inherited strain of N. cyanide-resistant Neoseis ca.

7. The use of the NcnAChRα6 gene editing composition of *Neoseiu Seymite Californiae* according to any one of claims 3-5 in the construction of *Neoseiu Seymite Californiae* with the NcnAChRα6 gene knocked out.

8. A method for obtaining a stably inherited strain of Neoseii Californiais resistant to ethyl spinosad, characterized in that, By knocking out the NcnAChRα6 gene of *Neoseiu Seymite* using the gene editing composition of any one of claims 3-5, and then purifying the strain, a stably inherited strain of *Neoseiu Seymite* resistant to ethyl spinosad is obtained.

9. The method according to claim 8, characterized in that, The aforementioned NcnAChRα6 gene-editing composition for *Neoseiu Seymite* of California is injected into female adult *Neoseiu Seymite* of California.

10. The method according to claim 8, characterized in that, The strain purification method described above involves injecting female mites (G) with the gene-edited composition of *Neoseiuthischianus* NcnAChRα6 as described in any one of claims 3-5. -1 After laying eggs, the G0 generation self-pollinates to produce the G1 generation, and the G1 generation produces the G2 generation in the same way. Then, male adult mites of the G2 generation are screened using ethyl spinosad at a concentration of 5 mg / L. The surviving male adult mites of the G2 generation are paired with unmated female adult mites of the G3 generation to produce the G3 generation. Subsequently, all pronymphs of the G3 generation are screened using ethyl spinosad at a concentration of 5 mg / L. The surviving individuals are homozygous mutants. These surviving individuals are then crossbred to produce offspring, which yields a stable genetic strain of Neoseis caecilian ethyl spinosad resistance.