Traditional Chinese medicine preparation for treating diabetic nephropathy and preparation method thereof
By combining Chinese medicinal herbs such as Angelica sinensis into a traditional Chinese medicine preparation, the problem of diabetic nephropathy that Western medicine cannot reverse has been solved. The preparation has achieved significant effects in inhibiting inflammatory damage and improving renal function, providing a new approach to the treatment of diabetic nephropathy.
Patent Information
- Application Number
- CN202512047787.8
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-12-31
- Publication Date
- 2026-06-23
- Estimated Expiration
- 2045-12-31
AI Technical Summary
Current Western medicine drugs for treating diabetic nephropathy cannot reverse the condition, while traditional Chinese medicine has significant clinical effects in this area but lacks effective formulations.
This invention provides a traditional Chinese medicine preparation composed of herbs such as Angelica sinensis, Eucommia ulmoides, Astragalus complanatus, Broussonetia papyrifera, Mantis egg case, Curcuma longa, Dendrobium nobile, Polygonatum odoratum, Adenophora stricta, Ligustrum lucidum, Campsis grandiflora, Lagerstroemia indica, Kochia scoparia, Lygodium japonicum, Pyrrosia lingua, and Scutellaria barbata. It utilizes the core treatment principles of nourishing Yin and tonifying the kidneys, promoting blood circulation and unblocking collaterals, and clearing heat and dampness. The preparation is available in various forms, including honey pills, decoctions, powders, granules, oral liquids, pills, capsules, and tablets, for the treatment of diabetic nephropathy.
It significantly inhibits high glucose-induced podocyte inflammation and apoptosis, improves blood glucose, urinary protein, renal function and renal pathological damage in DN rats, and provides an effective drug option for the treatment of diabetic nephropathy using traditional Chinese medicine.
Smart Images

Figure CN121570565B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of traditional Chinese medicine pharmaceutical technology, specifically to a traditional Chinese medicine preparation for treating diabetic nephropathy and its preparation method. Background Technology
[0002] Diabetic nephropathy (DN) is one of the microvascular complications caused by diabetes. In recent years, the incidence of diabetes in China has increased significantly, with a prevalence of 12.8% in people aged 18 and above, mainly type 2 diabetes (accounting for more than 90%). DN is present in 20% to 40% of diabetic patients, and has become a major cause of chronic kidney disease and end-stage renal failure. Early development of diabetic nephropathy is insidious, and symptoms are not easily detected. By the time it is discovered, it has often progressed to stage III. Early intervention can effectively slow the progression of DN and delay the need for renal replacement therapy (dialysis or kidney transplantation). Currently, Western medicine treatment for DN focuses on intervening in risk factors, primarily controlling blood glucose, blood pressure, proteinuria, and blood lipids. While drugs such as sodium-glucose cotransporter-2 (SGLT-2) inhibitors, glucagon-like peptide-1 (GLP-1) receptor agonists, and mineralocorticoid receptor antagonists (MRAs) can effectively slow the progression of DN, they cannot reverse diabetic nephropathy, which will eventually develop into uremia.
[0003] In recent years, traditional Chinese medicine has achieved many research results in the treatment of diabetic nephropathy (DN), proving the effectiveness of TCM treatment. TCM treatment can not only significantly improve patients' clinical symptoms and signs such as blood sugar, blood lipids, and proteinuria, but also reduce the degree of oxidative stress, inflammation, and fibrosis by inhibiting the activation of signaling pathways, thus delaying the progression of DN and effectively treating corresponding complications. It has the advantages of being less burdensome, more efficient, gentler, and having higher compliance. Summary of the Invention
[0004] (a) Technical problems to be solved
[0005] In view of the shortcomings of the prior art, the present invention provides a traditional Chinese medicine preparation for treating diabetic nephropathy and its preparation method.
[0006] (II) Technical Solution
[0007] To achieve the above objectives, the present invention provides the following technical solution:
[0008] This invention provides a traditional Chinese medicine preparation for treating diabetic nephropathy, which is made from the following traditional Chinese medicinal materials in parts by weight: Angelica sinensis 5-20 parts, Eucommia ulmoides 5-20 parts, Astragalus complanatus 5-20 parts, Broussonetia papyrifera 5-20 parts, Mantis egg case 5-20 parts, Curcuma longa 5-20 parts, Dendrobium nobile 5-20 parts, Polygonatum odoratum 5-20 parts, Adenophora stricta 5-20 parts, Ligustrum lucidum 5-20 parts, Campsis grandiflora 5-20 parts, Lagerstroemia indica 5-20 parts, Kochia scoparia 5-20 parts, Lygodium japonicum 5-20 parts, Pyrrosia lingua 5-20 parts, and Scutellaria barbata 5-20 parts.
[0009] Furthermore, the traditional Chinese medicine preparation is made from the following traditional Chinese medicinal materials in parts by weight: Angelica sinensis 5-15 parts, Eucommia ulmoides 5-15 parts, Astragalus complanatus 5-15 parts, Broussonetia papyrifera 5-15 parts, Mantis religiosa ootheca 5-15 parts, Curcuma longa 5-15 parts, Dendrobium nobile 5-15 parts, Polygonatum odoratum 5-15 parts, Adenophora stricta 5-15 parts, Ligustrum lucidum 5-15 parts, Campsis grandiflora 5-15 parts, Lagerstroemia indica 5-15 parts, Kochia scoparia 5-15 parts, Lygodium japonicum 5-15 parts, Pyrrosia lingua 5-15 parts, and Scutellaria barbata 5-15 parts.
[0010] Furthermore, the traditional Chinese medicine preparation is made from the following traditional Chinese medicinal materials in parts by weight: 10 parts Angelica sinensis, 12 parts Eucommia ulmoides, 12 parts Astragalus complanatus, 10 parts Broussonetia papyrifera, 8 parts Mantis egg case, 10 parts Curcuma longa, 15 parts Dendrobium nobile, 12 parts Polygonatum odoratum, 12 parts Adenophora stricta, 12 parts Ligustrum lucidum, 10 parts Campsis grandiflora, 10 parts Lagerstroemia indica, 8 parts Kochia scoparia, 10 parts Lygodium japonicum, 10 parts Pyrrosia lingua, and 12 parts Scutellaria barbata.
[0011] The traditional Chinese medicine preparation for treating diabetic nephropathy provided by the present invention is made by adding medically acceptable excipients to the above-mentioned weight proportions of traditional Chinese medicinal materials to form an oral dosage form, wherein the dosage form is any one of decoction, powder, granules, oral liquid, pills, capsules, and tablets.
[0012] This invention also provides a method for preparing a traditional Chinese medicine preparation for treating diabetic nephropathy, wherein the traditional Chinese medicine preparation is prepared into honey pills according to the following steps:
[0013] (1) Weigh the Chinese medicinal materials according to the above weight proportions, wash them, dry them at below 60℃ with a moisture content of less than 10%, then pulverize them, pass them through a 100-120 mesh sieve, and mix them evenly to obtain medicinal powder;
[0014] (2) Refine honey at 110-120℃ until it turns yellowish-brown. When picked up, the honey thread can be stretched without breaking. This is refined honey.
[0015] (3) While it is still hot, mix the refined honey and the medicinal powder in a weight ratio of 1.1-1.4:1. Add the medicinal powder to the refined honey in small amounts several times, and stir and mix thoroughly to obtain a medicinal ball;
[0016] (4) Roll the medicine ball into a long strip with uniform thickness and smooth surface, then cut it into short sections of medicine particles with the same length and diameter. Place the medicine particles in a pill-making machine to make round and smooth spheres. Dry them at 60°C or below until the moisture content is less than 5%. Each pill weighs 0.3±0.05g, and the traditional Chinese medicine preparation in the form of honey pills is obtained.
[0017] This invention's traditional Chinese medicine preparation addresses the core pathogenesis of diabetic nephropathy, namely, kidney yin deficiency, kidney meridian obstruction, and internal damp-heat accumulation. It adopts the core treatment principles of nourishing yin and benefiting the kidney, promoting blood circulation and unblocking meridians, and clearing heat and promoting diuresis. It follows the principles of syndrome differentiation and treatment in traditional Chinese medicine and rationally combines the various herbs in the formula. In this formula, Dendrobium is sweet and slightly cold in nature, and enters the stomach and kidney meridians. It nourishes kidney yin, consolidates essence, and clears deficiency heat, thus having both "tonifying" and "clearing" effects. Glehnia littoralis is sweet and cold in nature, and enters the lung and stomach meridians. It can tonify the yin of the lungs and stomach, and generate fluids to moisten dryness. Polygonatum odoratum is sweet and neutral in nature, and enters the lung and stomach meridians. Its yin-nourishing and dryness-moistening power is mild and long-lasting, without being greasy or cloying to the stomach. When combined with Glehnia littoralis, it enhances the yin-nourishing function of the lungs and stomach, forming a synergistic effect of nourishing the upper body and moistening the kidney yin. Ligustrum lucidum is sweet, bitter, and cool in nature, and enters the liver and kidney meridians. It has the effects of nourishing the yin of the liver and kidneys and clearing deficiency heat. The four herbs are used together as the principal herbs, with the core of nourishing yin and benefiting the kidneys. They tonify the yin of the lungs and stomach to replenish the source of kidney yin, and clear deficiency heat to control dryness and heat. The aim is to quickly replenish the depleted yin fluids and curb the development of the disease from the source.
[0018] This formula also uses Angelica sinensis, Eucommia ulmoides, Astragalus complanatus, Broussonetia papyrifera, Mantis egg case, and Curcuma longa as assistant herbs, which assist the principal herbs from multiple dimensions such as nourishing blood and promoting blood circulation, warming yang and consolidating essence, and resolving blood stasis and unblocking collaterals. Angelica sinensis is sweet, pungent, and warm, and enters the liver, heart, and spleen meridians. It can nourish the liver and kidneys by nourishing blood, and also promote blood circulation to unblock the kidney collaterals. Its warming and unblocking properties can promote blood circulation and prevent excessive yin nourishment from hindering qi and blood, thus achieving nourishment without stagnation. Eucommia ulmoides and Astragalus complanatus are both sweet and warm, and enter the liver and kidney meridians. Their function is to nourish the liver and kidneys, strengthen the waist and knees, and consolidate essence. When combined with Ligustrum lucidum, their warm and cool properties are balanced, and together they achieve the effect of nourishing the liver and kidneys, consolidating essence, and improving eyesight. Broussonetia papyrifera is sweet and cold, and enters the liver and kidney meridians. It has the effects of nourishing the kidneys and clearing the liver, improving eyesight, and promoting diuresis, and can assist the principal herbs. It enhances the yin-nourishing effect, while its liver-clearing effect can alleviate internal heat due to yin deficiency, and its diuretic effect can expel dampness and turbidity, thus taking into account both yin-nourishing and dampness-removing properties. Mantis egg case is sweet, salty, and neutral, and enters the liver and kidney meridians. It can strengthen the kidneys, reduce urination, and consolidate essence to stop seminal emission. It not only assists the principal drug in tonifying the kidneys, but also consolidates essence to reduce the loss of vital essence. Turmeric is bitter, pungent, and warm, and enters the liver and spleen meridians. It can invigorate blood and remove blood stasis to unblock the kidney meridians, and promote qi circulation and relieve pain caused by blood stasis. At the same time, its warming properties can harmonize the cold properties of the whole formula and prevent the yin-nourishing drugs from damaging yang qi.
[0019] The trumpet creeper flower has the effects of breaking up blood stasis, clearing the meridians, cooling the blood, and dispelling wind. It is good at clearing away latent heat in the blood. When combined with turmeric, it enhances the power of promoting blood circulation, clearing the meridians, and eliminating masses, while also clearing blood heat. The crape myrtle flower clears heat and cools the blood, which can not only help the trumpet creeper flower clear away the stagnant heat in the blood, but also help to restrain the warm and drying properties of the assistant herbs such as eucommia, turmeric, and angelica, preventing damage to yin. The kochia fruit, lygodium spores, and pyrrosia lingua form a diuretic and urinary tract clearing effect, clearing away damp heat in the lower burner and guiding the turbid evil out through urination. Scutellaria barbata has the effects of clearing heat and detoxifying, resolving blood stasis, and promoting diuresis. It is good at clearing the toxins transformed from damp turbidity. The combined use of these herbs acts as an adjuvant, providing a way for the evil to be expelled and guiding the medicine to its destination. The six herbs combined not only assist the principal and assistant herbs in clearing away damp heat and promoting blood circulation and resolving blood stasis, but also restrain the cooling nature of the principal herb and the warming nature of the assistant herbs, harmonizing the properties of the entire formula.
[0020] This formula is based on nourishing Yin and benefiting the kidneys, while also addressing symptoms such as blood stasis and dampness. It combines warming and cooling herbs, as well as tonifying and purging methods, to achieve the effects of nourishing Yin and benefiting the kidneys, promoting blood circulation and clearing heat and dampness. This provides an effective medication option for the treatment of diabetic nephropathy using traditional Chinese medicine.
[0021] Cellular and animal experiments further demonstrated that the traditional Chinese medicine preparation of this invention can significantly inhibit high glucose-induced inflammatory damage and apoptosis of podocytes; it can improve blood glucose, proteinuria, renal function, and renal pathological damage in diabetic nephropathy rats by upregulating the expression levels of podocin and nephrin and inhibiting inflammatory mediators. This traditional Chinese medicine preparation provides a new approach for the treatment of diabetic nephropathy and has good prospects for development and application. Attached Figure Description
[0022] Figure 1 The results show the effects of the traditional Chinese medicine preparation of this invention on the inflammatory factors TNF-α (A), IL-1β (B), and podocyte apoptosis rate (C) induced by high glucose injure podocytes; Note: *P<0.05 compared with the control group; compared with the high glucose group, # P<0.05; compared with formulation 1, & P<0.05.
[0023] Figure 2 The results show the effects of the traditional Chinese medicine preparation of this invention on 24hUTP (A), FBG (B), serum BUN (C), and Scr (D) in DN rats; Note: Compared with the normal control group, *P<0.05; compared with the model group, # P<0.05; compared with the positive control group, & P<0.05.
[0024] Figure 3 The results show the effects of the traditional Chinese medicine preparation of this invention on the renal hypertrophy coefficient (A), and the expression levels of inflammatory factors TNF-α (B), IL-6 (C), Podocin (D), and Nephrin (E) mRNA in renal tissue of DN rats; Note: *P<0.05 compared with the normal control group; compared with the model group,# P<0.05; compared with the positive control group, & P<0.05.
[0025] Figure 4 The results of PAS staining, Mosson staining and immunohistochemical staining of kidney tissue from DN rats in each group are shown. Detailed Implementation
[0026] To make the objectives, technical solutions, and advantages of the embodiments of the present invention clearer, the technical solutions of the embodiments of the present invention will be clearly and completely described below in conjunction with the embodiments of the present invention. Obviously, the described embodiments are only some embodiments of the present invention, not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.
[0027] Example 1
[0028] A traditional Chinese medicine preparation for treating diabetic nephropathy, comprising the following medicinal materials in parts by weight: Angelica sinensis 10 parts, Eucommia ulmoides 12 parts, Astragalus complanatus 12 parts, Broussonetia papyrifera 10 parts, Mantis egg case 8 parts, Curcuma longa 10 parts, Dendrobium nobile 15 parts, Polygonatum odoratum 12 parts, Adenophora stricta 12 parts, Ligustrum lucidum 12 parts, Campsis grandiflora 10 parts, Lagerstroemia indica 10 parts, Kochia scoparia 8 parts, Lygodium japonicum 10 parts, Pyrrosia lingua 10 parts, and Scutellaria barbata 12 parts, supplemented with medically acceptable excipients, and prepared into an oral dosage form, wherein the dosage form is any one of decoction, powder, granules, oral liquid, pills, capsules, or tablets.
[0029] Specifically, the traditional Chinese medicine preparation is made into honey pills according to the following steps:
[0030] (1) Weigh the Chinese medicinal materials according to the above weight proportions, wash them, dry them at below 60℃ with a moisture content of less than 10%, then pulverize them, pass them through a 100-120 mesh sieve, and mix them evenly to obtain medicinal powder;
[0031] (2) Refine honey at 110-120℃ until it turns yellowish-brown. When picked up, the honey thread can be stretched without breaking. This is refined honey.
[0032] (3) While it is still hot, mix the refined honey and the medicinal powder in a weight ratio of 1.1-1.4:1. Add the medicinal powder to the refined honey in small amounts several times, and stir and mix thoroughly to obtain a medicinal ball;
[0033] (4) Roll the medicine ball into a long strip with uniform thickness and smooth surface, then cut it into short sections of medicine particles with the same length and diameter. Place the medicine particles in a pill-making machine to make round and smooth spheres. Dry them at 60°C or below until the moisture content is less than 5%. Each pill weighs 0.3±0.05g, and the traditional Chinese medicine preparation in the form of honey pills is obtained.
[0034] Specifically, the traditional Chinese medicine preparation is prepared into a decoction according to the following steps:
[0035] Weigh the Chinese medicinal materials according to the above weight proportions, wash and dry them, then soak them in 3-4 times their weight of water for 30 minutes. After boiling over high heat, reduce to medium heat and simmer for 30 minutes. Filter the decoction, add 2-3 times their weight of water to the dregs and simmer for another 30 minutes. Combine the two decoctions and concentrate to 400 mL. Take in two doses, one dose per day.
[0036] Specifically, the traditional Chinese medicine preparation is prepared into an oral liquid according to the following steps:
[0037] (1) Weigh the Chinese medicinal materials according to the above weight proportions, and pre-treat each raw material by cleaning, cutting and crushing, and set aside for later use;
[0038] (2) Take the coarse powder of Angelica sinensis, Curcuma longa, Ligustrum lucidum and Astragalus complanatus, add 8 times the volume of 70% ethanol, soak for 1 hour, and then heat and reflux extract twice at 75-80℃, each time for 1.5-2 hours. Filter and combine the two ethanol extracts. Set aside the residue. Concentrate the ethanol extract under reduced pressure at a vacuum of -0.08 to -0.09 MPa and a temperature of 55-60℃ until the relative density is 1.10-1.20 to obtain the ethanol extract.
[0039] (3) Mix the residue after alcohol extraction with the remaining medicinal materials such as Dendrobium, Polygonatum odoratum, Adenophora stricta, and Broussonetia papyrifera, add 10-12 times the amount of purified water, soak for more than 2 hours, heat and decoct three times, the first decoction for 2 hours, the second and third decoctions for 1.5 hours each, filter and collect the decoction after each decoction, and finally combine the three decoctions; concentrate the decoction under reduced pressure at a vacuum degree of -0.08 to -0.09 MPa and a temperature of 60-65℃, concentrate to a relative density of 1.15-1.25, and obtain water extract for later use;
[0040] (4) Mix the alcohol extract and water extract evenly, add 3-4 times the amount of purified water to dilute, stir until there are no flocculent substances, let stand at 6°C for more than 24 hours, then centrifuge and filter the refrigerated medicine solution to obtain a clear purified medicine solution for later use.
[0041] (5) Add sucralose and potassium sorbate to the refined drug solution, and adjust the pH of the drug solution to 5.5-6.5 with 6% citric acid solution. Then add purified water to dilute to a relative density of 1.05-1.10. Then sterilize and fill to obtain the oral solution.
[0042] Example 2
[0043] The difference between this embodiment and Embodiment 1 is that the traditional Chinese medicine preparation is made from the following parts by weight of traditional Chinese medicinal materials: 5 parts Angelica sinensis, 5 parts Eucommia ulmoides, 5 parts Astragalus complanatus, 5 parts Broussonetia papyrifera, 5 parts Mantis egg case, 5 parts Curcuma longa, 5 parts Dendrobium nobile, 5 parts Polygonatum odoratum, 5 parts Adenophora stricta, 5 parts Ligustrum lucidum, 5 parts Campsis grandiflora, 5 parts Lagerstroemia indica, 5 parts Kochia scoparia, 5 parts Lygodium japonicum, 5 parts Pyrrosia lingua, and 5 parts Scutellaria barbata.
[0044] Example 3
[0045] The difference between this embodiment and Embodiment 1 is that the traditional Chinese medicine preparation is made from the following parts by weight of traditional Chinese medicinal materials: Angelica sinensis 20 parts, Eucommia ulmoides 20 parts, Astragalus complanatus 20 parts, Broussonetia papyrifera 20 parts, Mantis egg case 20 parts, Curcuma longa 20 parts, Dendrobium nobile 20 parts, Polygonatum odoratum 20 parts, Adenophora stricta 5-20 parts, Ligustrum lucidum 20 parts, Campsis grandiflora 20 parts, Lagerstroemia indica 20 parts, Kochia scoparia 20 parts, Lygodium japonicum 20 parts, Pyrrosia lingua 20 parts, Scutellaria barbata 20 parts.
[0046] Example 4
[0047] The difference between this embodiment and Embodiment 1 is that the traditional Chinese medicine preparation is made from the following parts by weight of traditional Chinese medicinal materials: Angelica sinensis 16 parts, Eucommia ulmoides 16 parts, Astragalus complanatus 16 parts, Broussonetia papyrifera 16 parts, Mantis egg case 16 parts, Curcuma longa 16 parts, Dendrobium nobile 18 parts, Polygonatum odoratum 18 parts, Adenophora stricta 18 parts, Ligustrum lucidum 18 parts, Campsis grandiflora 16 parts, Lagerstroemia indica 16 parts, Kochia scoparia 16 parts, Lygodium japonicum 16 parts, Pyrrosia lingua 16 parts, and Scutellaria barbata 16 parts.
[0048] Example 5
[0049] The difference between this embodiment and Embodiment 1 is that the traditional Chinese medicine preparation is made from the following parts by weight of traditional Chinese medicinal materials: 8 parts Angelica sinensis, 6 parts Eucommia ulmoides, 8 parts Astragalus complanatus, 8 parts Broussonetia papyrifera, 6 parts Mantis egg case, 8 parts Curcuma longa, 10 parts Dendrobium nobile, 10 parts Polygonatum odoratum, 8 parts Adenophora stricta, 8 parts Ligustrum lucidum, 6 parts Campsis grandiflora, 6 parts Lagerstroemia indica, 6 parts Kochia scoparia, 6 parts Lygodium japonicum, 8 parts Pyrrosia lingua, and 8 parts Scutellaria barbata.
[0050] Example 6
[0051] The difference between this embodiment and Embodiment 1 is that the traditional Chinese medicine preparation is made from the following parts by weight of traditional Chinese medicinal materials: Angelica sinensis 12 parts, Eucommia ulmoides 10 parts, Astragalus complanatus 10 parts, Broussonetia papyrifera 12 parts, Mantis egg case 8 parts, Curcuma longa 10 parts, Dendrobium nobile 12 parts, Polygonatum odoratum 12 parts, Adenophora stricta 14 parts, Ligustrum lucidum 10 parts, Campsis grandiflora 8 parts, Lagerstroemia indica 6 parts, Kochia scoparia 8 parts, Lygodium japonicum 10 parts, Pyrrosia lingua 8 parts, and Scutellaria barbata 6 parts.
[0052] Example 7
[0053] The difference between this embodiment and Embodiment 1 is that the traditional Chinese medicine preparation is made from the following parts by weight of traditional Chinese medicinal materials: 10 parts Angelica sinensis, 12 parts Eucommia ulmoides, 8 parts Astragalus complanatus, 10 parts Broussonetia papyrifera, 6 parts Mantis egg case, 12 parts Curcuma longa, 14 parts Dendrobium nobile, 12 parts Polygonatum odoratum, 12 parts Adenophora stricta, 14 parts Ligustrum lucidum, 10 parts Campsis grandiflora, 6 parts Lagerstroemia indica, 6 parts Kochia scoparia, 8 parts Lygodium japonicum, 10 parts Pyrrosia lingua, and 8 parts Scutellaria barbata.
[0054] Example 8
[0055] The difference between this embodiment and Embodiment 1 is that the traditional Chinese medicine preparation is made from the following parts by weight of traditional Chinese medicinal materials: Angelica sinensis 9 parts, Eucommia ulmoides 9 parts, Astragalus complanatus 12 parts, Broussonetia papyrifera 9 parts, Mantis egg case 6 parts, Curcuma longa 9 parts, Dendrobium nobile 15 parts, Polygonatum odoratum 15 parts, Adenophora stricta 12 parts, Ligustrum lucidum 12 parts, Campsis grandiflora 9 parts, Lagerstroemia indica 6 parts, Kochia scoparia 6 parts, Lygodium japonicum 9 parts, Pyrrosia lingua 9 parts, and Scutellaria barbata 9 parts.
[0056] Experimental Example 1
[0057] The effects of the traditional Chinese medicine preparation of this invention on high glucose-induced podocyte inflammatory damage and apoptosis
[0058] 1. Experimental drugs
[0059] Traditional Chinese Medicine Preparation 1: Angelica sinensis 10g, Eucommia ulmoides 12g, Astragalus complanatus 12g, Broussonetia papyrifera 10g, Mantis religiosa ootheca 8g, Curcuma longa 10g, Dendrobium nobile 15g, Polygonatum odoratum 12g, Adenophora stricta 12g, Ligustrum lucidum 12g, Campsis grandiflora 10g, Lagerstroemia indica 10g, Kochia scoparia 8g, Lygodium japonicum 10g, Pyrrosia lingua 10g, Scutellaria barbata 12g
[0060] Traditional Chinese Medicine Preparation 2: Eucommia ulmoides 12g, Astragalus complanatus 12g, Broussonetia papyrifera 10g, Mantis egg case 8g, Dendrobium nobile 15g, Ligustrum lucidum 12g, Campsis grandiflora 10g, Lagerstroemia indica 10g, Kochia scoparia 8g, Lygodium japonicum 10g, Pyrrosia lingua 10g, Scutellaria barbata 12g
[0061] Traditional Chinese Medicine Preparation 3: Angelica sinensis 10g, Broussonetia papyrifera fruit 10g, Mantis egg case 8g, Curcuma longa 10g, Polygonatum odoratum 12g, Adenophora stricta 12g, Campsis grandiflora 10g, Lagerstroemia indica 10g, Kochia scoparia fruit 8g, Lygodium japonicum 10g, Pyrrosia lingua 10g, Scutellaria barbata 12g
[0062] Traditional Chinese Medicine Preparation 4: Angelica sinensis 10g, Eucommia ulmoides 12g, Astragalus complanatus 12g, Curcuma longa 10g, Dendrobium nobile 15g, Polygonatum odoratum 12g, Adenophora stricta 12g, Ligustrum lucidum 12g, Campsis grandiflora 10g, Lagerstroemia indica 10g, Kochia scoparia 8g, Lygodium japonicum 10g
[0063] Traditional Chinese Medicine Preparation 5: Angelica sinensis 10g, Eucommia ulmoides 12g, Astragalus complanatus 12g, Broussonetia papyrifera 10g, Mantis religiosa ootheca 8g, Curcuma longa 10g, Dendrobium nobile 15g, Polygonatum odoratum 12g, Adenophora stricta 12g, Ligustrum lucidum 12g, Pyrrosia lingua 10g, Scutellaria barbata 12g
[0064] Weigh each ingredient according to the above weight, wash them, soak them in 4 times their weight of water for 30 minutes, then decoct them twice, each time for 40 minutes. After each decoction, filter to remove the dregs, take the decoction and combine them, concentrate the decoction under reduced pressure to a drug concentration of 1.0 g / mL (each milliliter contains 1.0 g of raw drug), refrigerate and use for later use.
[0065] 2. Experimental Methods
[0066] (1) Grouping and processing
[0067] Human glomerular podocytes (HGPCs) were seeded in DMEM-F12 medium (10% FBS), and the culture medium was changed every 2-3 days. The cells were then cultured in a 37°C, 5% CO2 incubator. Cells in the logarithmic growth phase were used for subsequent experiments.
[0068] HGPC cells in the logarithmic growth phase were seeded into 96-well plates at a density of 8 × 10⁸ cells per well. 3 Students were randomly divided into a control group (5 mmol / L glucose), a high-glucose group (30 mmol / L glucose), preparation 1 group (30 mmol / L glucose + 50 μg / mL traditional Chinese medicine preparation 1), preparation 2 group (30 mmol / L glucose + 50 μg / mL traditional Chinese medicine preparation 1), preparation 3 group (30 mmol / L glucose + 50 μg / mL traditional Chinese medicine preparation 3), preparation 4 group (30 mmol / L glucose + 50 μg / mL traditional Chinese medicine preparation 4), and preparation 5 group (30 mmol / L glucose + 50 μg / mL traditional Chinese medicine preparation 5). The treatment lasted for 24 hours, with each group repeated 3 times, and each time 3 parallel replicates.
[0069] (2) ELISA method for detecting inflammatory factors TNF-α and IL-1β in podocyte supernatant
[0070] Twenty-four hours after intervention in each group, cell supernatant was collected. Following the instructions of the TNF-α and IL-1β kits, the podocyte supernatant was added to 96-well plates and incubated at 37 °C for 30 min. After washing, enzyme-labeled reagent was added and the plates were incubated for 30 min, followed by chromogenic reagent and incubation for 10 min. OD values were measured at 450 nm using a microplate reader, and the levels of TNF-α and IL-1β were calculated based on the standard curve.
[0071] (3) Hoechst 33258 staining method to determine HGPC cell apoptosis
[0072] Cells from each group after 24 hours of drug intervention were incubated with 10% Hoechst 33258 working solution in the dark for 10 minutes. The Hoechst 33258 fluorescence signal was observed and photographed under a fluorescence microscope. Apoptotic cells showed a high-intensity blue signal, while normal cells showed a low-intensity blue signal. The apoptosis rate was the percentage of apoptotic cells to the total number of cells.
[0073] (4) Statistics and Analysis
[0074] Data were analyzed using Prism 8.0.2 statistical software, expressed as mean ± standard deviation. The results indicate that a t-test was performed, and one-way ANOVA was used for comparisons among multiple groups. P < 0.05 was considered statistically significant.
[0075] 3. Results
[0076] (1) Effect of the traditional Chinese medicine preparation of the present invention on high glucose-induced podocyte inflammatory damage
[0077] like Figure 1 As shown in AB, compared with the control group, the levels of inflammatory factors TNF-α and IL-1β in the supernatant of podocytes in the high glucose group were significantly increased (P<0.05); compared with the high glucose group, the levels of inflammatory factors TNF-α and IL-1β in the supernatant of podocytes in each preparation group were significantly decreased (P<0.05); among them, the levels of inflammatory factors TNF-α and IL-1β in the supernatant of podocytes in preparation 1 group were significantly lower than those in preparation 2 group and preparation 3 group (P<0.05).
[0078] (2) Effect of the traditional Chinese medicine preparation of the present invention on high glucose-induced podocyte apoptosis
[0079] like Figure 1 As shown in Figure C, compared with the control group, the apoptosis rate of podocytes in the high glucose group was significantly increased (P<0.05); compared with the high glucose group, the apoptosis rate of podocytes in each preparation group was significantly decreased (P<0.05); among them, the apoptosis rate of podocytes in preparation 1 group was significantly lower than that in preparation 2 group, preparation 3 group and preparation 5 group (P<0.05).
[0080] Inflammatory responses play a crucial role in the development of diabetic nephropathy. TNF-α and IL-1β are important mediators of inflammation and sensitive indicators of impaired cell function and tissue damage. Multiple studies have demonstrated that regulating the release levels of TNF-α and IL-1β is closely related to controlling cellular inflammatory responses. Apoptosis plays a vital role in the occurrence and development of diabetic nephropathy; metabolic disorders caused by high glucose stimulation increase apoptosis. The above experimental results indicate that the traditional Chinese medicine preparation of this invention can significantly inhibit high glucose-induced podocyte inflammatory damage and apoptosis, and its inhibitory effect is significantly superior to other traditional Chinese medicine preparations, providing a fundamental theoretical basis for its potential use as a treatment for diabetic nephropathy.
[0081] Experimental Example 2
[0082] Effects of the traditional Chinese medicine preparation of this invention on diabetic nephropathy rats
[0083] 1. Materials and Methods
[0084] 1.1 Laboratory Animals
[0085] Eight-week-old SPF-grade SD rats, weighing 220±20g, were selected and acclimatized for one week before the experiment.
[0086] 1.2 Experimental Drugs
[0087] The traditional Chinese medicine preparation of this invention is prepared by weighing the following raw materials according to the following weights: Angelica sinensis 10g, Eucommia ulmoides 12g, Astragalus complanatus 12g, Broussonetia papyrifera 10g, Mantis religiosa ootheca 8g, Curcuma longa 10g, Dendrobium nobile 15g, Polygonatum odoratum 12g, Adenophora stricta 12g, Ligustrum lucidum 12g, Campsis grandiflora 10g, Lagerstroemia indica 10g, Kochia scoparia 8g, Lygodium japonicum 10g, Pyrrosia lingua 10g, and Scutellaria barbata 12g. After washing, soak the raw materials in 4 times their weight of water for 30 minutes, then decoct them 3 times, each time for 40 minutes. After each decoction, filter to remove the dregs, collect the decoction liquid and combine them. Concentrate the decoction liquid under reduced pressure to 1g / mL (equivalent to 1g of raw herb per milliliter), refrigerate and store for later use.
[0088] Irbesartan tablets, 0.15g / tablet
[0089] 1.3 Model Preparation and Grouping Processing
[0090] Model preparation: After one week of acclimatization feeding, SD rats were fed a high-sugar, high-fat diet for four weeks. After four weeks, the model group was fasted but allowed free access to water. Then, the model group rats were intraperitoneally injected with 1% streptozotocin at a dose of 25 mg / kg, three times consecutively, with each injection 3 days apart. A fasting blood glucose level ≥16.7 mmol / L for three consecutive days after the streptozotocin injection was completed was considered a successful establishment of the diabetic rat model. The rats continued to be fed a high-sugar, high-fat diet for four weeks. 24-hour urine was collected in metabolic cages, and urinary protein was measured. A 24-hour urinary protein level ≥30 mg was considered a successful establishment of the diabetic nephropathy rat model.
[0091] During the modeling period, six healthy SD rats were fed a normal diet as a control group. Twenty-four successfully modeled rats were randomly divided into four groups: model group, positive control group, low-dose traditional Chinese medicine preparation group, and high-dose traditional Chinese medicine preparation group, with six rats in each group. The administration methods for each group are shown in Table 1. All groups were administered the medicine once daily for eight consecutive weeks.
[0092] Table 1. Administration methods for rats in each group
[0093]
[0094] 1.4 Detection Indicators and Methods
[0095] 1.4.1 Urine protein level detection
[0096] After the last administration, rats were placed in metabolic cages to collect 24-hour urine and detect 24-hour urinary total protein (UTP).
[0097] 1.4.2 Biochemical detection indicators
[0098] After the last administration, patients were fasted for 12 hours but allowed free access to water. Fasting blood glucose (FBG) was measured by blood collection from the tail vein. Subsequently, blood was collected from the abdominal aorta, centrifuged, and serum was separated to measure the serum creatinine (Scr) and blood urea nitrogen (BUN) levels.
[0099] 1.4.3 Detection of Renal Hypertrophy Factor
[0100] After the last administration, patients were kept on a fasting schedule but allowed free access to water for 12 hours. They were then anesthetized with an intraperitoneal injection of 2% sodium pentobarbital. Bilateral kidney tissue was harvested, the surface blood was blotted dry with filter paper, and the tissue was weighed to calculate the renal hypertrophy coefficient. The tissue was then stored at -80°C for later use.
[0101] Renal hypertrophy coefficient = (Total weight of both kidneys / Body weight) × 100%
[0102] 1.4.4 Levels of inflammatory factors TNF-α and IL-6 in renal tissue
[0103] The levels of TNF-α and IL-6 in the supernatant of homogenate from the left kidney tissue of rats were detected by ELISA.
[0104] 1.4.5 Detection of Nephrin and Podocin Expression Levels
[0105] Kidneys stored at -80 ℃ were retrieved, and 20 mg of tissue was weighed from each kidney. Total RNA was extracted and reverse transcribed into cDNA using a reverse transcription kit. The cDNA was then used as a template for quantitative real-time PCR amplification. GAPDH was used as an internal control. -ΔΔCT The mNRA expression levels of Nephrin and Podocin were calculated using this method.
[0106] The primer sequences are as follows:
[0107] GAPDH: Upstream primer: GCAAGGT CACTATATCCGCAT
[0108] Downstream primer: CAAGGAGTAACATAGCGAATCA
[0109] Nephrin: Upstream primer: TGTTGGCGGTCCACCTTTGC
[0110] Downstream primer: AGTCGACTGGTTGGAGTTAC
[0111] Podocin: Upstream primer: GGTCGGTGT GACGTCCTCCAC
[0112] Downstream primer: GGCTAGGGTTACATGCAGTGCC
[0113] 1.4.6 Kidney pathological examination
[0114] Right renal cortex tissue was collected from rats in each group, fixed in formaldehyde, dehydrated, cleared, embedded in paraffin, sectioned, and stained with PAS, Mosson, and immunohistochemically. The pathological changes in the renal tissue and the expression of the podocyte marker protein Podocin were observed under a microscope.
[0115] 1.5 Statistical Analysis
[0116] Data were analyzed using Prism 8.0.2 statistical software, expressed as mean ± standard deviation. The results indicate that a t-test was performed, and one-way ANOVA was used for comparisons among multiple groups. P < 0.05 indicates that the difference is statistically significant.
[0117] 2 Results
[0118] 2.1 Effects of the herbal preparation of this invention on 24hUTP, FBG, serum Scr, and BUN in DN rats
[0119] Compared with the normal control group, the model group rats showed significantly increased 24hUTP, FBG, serum Scr, and BUN (P<0.05); compared with the model group, the positive control group, and the low- and high-dose traditional Chinese medicine preparation groups showed significantly decreased 24hUTP, FBG, serum Scr, and BUN (P<0.05); the low-dose traditional Chinese medicine preparation group showed lower levels of 24hUTP, FBG, serum Scr, and BUN than the positive control group, but the difference was not statistically significant (P>0.05); the high-dose traditional Chinese medicine preparation group showed significantly lower levels of 24hUTP, FBG, serum Scr, and BUN than the positive control group (P<0.05). Results are as follows. Figure 2 As shown.
[0120] 2.2 Effects of the herbal preparation of this invention on the renal hypertrophy coefficient and the expression levels of inflammatory factors TNF-α, IL-6, Nephrin, and Podocin mRNA in DN rats.
[0121] Compared with the normal control group, the renal hypertrophy index of rats in the model group was significantly increased (P<0.05); compared with the model group, the renal hypertrophy index of rats in the positive control group, the low-dose group, and the high-dose group of the traditional Chinese medicine preparation was significantly decreased (P<0.05); the renal hypertrophy index of rats in the low-dose group of the traditional Chinese medicine preparation was lower than that of the positive control group, but the difference was not statistically significant (P>0.05), while the renal hypertrophy index of rats in the high-dose group of the traditional Chinese medicine preparation was significantly lower than that of the positive control group (P<0.05). Results are as follows. Figure 3 As shown in Figure A.
[0122] Compared with the normal control group, the levels of inflammatory factors TNF-α and IL-6 in the kidney tissue of rats in the model group were significantly increased (P<0.05); compared with the model group, the levels of inflammatory factors TNF-α and IL-6 in the kidney tissue of rats in the positive control group, and the low- and high-dose groups of the traditional Chinese medicine preparation were significantly decreased (P<0.05); the levels of inflammatory factors TNF-α and IL-6 in the kidney tissue of rats in the high-dose group of the traditional Chinese medicine preparation were significantly lower than those in the positive control group (P<0.05). Results are as follows. Figure 3 As shown in BC.
[0123] Compared with the normal control group, the expression levels of Nephrin and Podocin mRNA in the kidney tissue of rats in the model group were significantly decreased (P<0.05). Compared with the model group, the expression levels of Nephrin and Podocin mRNA in the kidney tissue of rats in the positive control group, the low-dose group, and the high-dose group of the traditional Chinese medicine preparation were significantly increased (P<0.05). The expression levels of Podocin and Nephrin mRNA in the kidney tissue of rats in the low-dose group of the traditional Chinese medicine preparation were higher than those in the positive control group, but the difference was not statistically significant (P>0.05). The expression levels of Podocin and Nephrin mRNA in the kidney tissue of rats in the high-dose group of the traditional Chinese medicine preparation were significantly higher than those in the positive control group (P<0.05). The results are shown in 3D-E.
[0124] 2.3 Histopathological effects of the traditional Chinese medicine preparation of this invention on the kidney tissue of DN rats
[0125] like Figure 4 As shown, the normal control group rats showed no obvious kidney lesions, while the model group rats exhibited pathological damage such as glomerular hypertrophy, mesangial matrix proliferation, tissue fibrosis, and decreased expression of the podocyte marker protein Podocin. Compared with the model group, the degree of kidney tissue lesions in all treatment groups was significantly improved. Among them, the high-dose group of traditional Chinese medicine preparation significantly alleviated glomerular hypertrophy and mesangial matrix proliferation, reduced fibrosis, and increased the expression of the podocyte marker protein Podocin in DN rats compared with the positive control group.
[0126] 3 Discussion
[0127] Modern research indicates that diabetic nephropathy (DN) occurs due to long-term diabetes, leading to damage to the glomerular capillary endothelial cells in the kidney tissue, decreased glomerular filtration function, and excessive leakage of blood proteins into the urine, resulting in hyperproteinuria and impaired renal function. Serum creatinine (Scr) and blood urea nitrogen (BUN) are two important indicators reflecting renal function. The above experimental results demonstrate that the traditional Chinese medicine preparation of this invention can significantly reduce 24-hour urinary protein in DN rats, lower blood glucose levels, reduce serum Scr and BUN, and improve renal function in DN rats.
[0128] In the pathogenesis of diabetic nephropathy (DN), inflammatory factors participate in the transduction of multiple signaling pathways. TNF-α is a central inflammatory signaling pathway, typically activated by various stressors, including diabetes, obesity, and oxidative stress. Macrophage activation also plays a crucial role in DN inflammatory damage. M1 macrophages produce large amounts of pro-inflammatory cytokines iNOS, TNF-α, MCP-1, and other pro-inflammatory mediators, thereby amplifying inflammation and leading to further damage during DN pathogenesis. Currently, chronic inflammation is widely recognized as an accelerator of DN progression to end-stage renal disease, and studies have shown that inhibiting the inflammatory response can improve kidney damage in diabetic nephropathy. Podocytes, as a special type of epithelial cell, are an important component of the glomerular filtration barrier. Podocyte damage leads to glomerular filtration barrier dysfunction, resulting in proteinuria. Podocin and nephrin are considered hallmark proteins of podocyte damage, and their expression levels are negatively correlated with the degree of podocyte damage. The above experimental results indicate that the traditional Chinese medicine preparation of this invention can effectively reduce inflammatory factor levels, inhibit the inflammatory response, and significantly upregulate the expression levels of podocin and nephrin, thereby alleviating podocyte damage. In addition, the traditional Chinese medicine preparation of this invention can alleviate glomerular hypertrophy in DN rats and improve renal pathological damage such as mesangial matrix proliferation and tissue fibrosis.
[0129] In summary, the traditional Chinese medicine preparation of this invention can improve blood glucose, urinary protein, renal function and renal pathological damage in diabetic nephropathy rats by upregulating the expression levels of podocin and nephrin and inhibiting inflammatory mediators. This provides a new approach for the treatment of diabetic nephropathy and has good prospects for development and application.
[0130] The above embodiments are only used to illustrate the technical solutions of the present invention, and are not intended to limit it. Although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art should understand that modifications can still be made to the technical solutions described in the foregoing embodiments, or equivalent substitutions can be made to some of the technical features. Such modifications or substitutions do not cause the essence of the corresponding technical solutions to deviate from the spirit and scope of the technical solutions of the embodiments of the present invention.
Claims
1. A traditional Chinese medicine preparation for treating diabetic nephropathy, characterized in that, The traditional Chinese medicine preparation is made from the following parts by weight of Chinese medicinal materials: Angelica sinensis 10 parts, Eucommia ulmoides 12 parts, Astragalus complanatus 12 parts, Broussonetia papyrifera 10 parts, Mantis egg case 8 parts, Curcuma longa 10 parts, Dendrobium nobile 15 parts, Polygonatum odoratum 12 parts, Adenophora stricta 12 parts, Ligustrum lucidum 12 parts, Campsis grandiflora 10 parts, Lagerstroemia indica 10 parts, Kochia scoparia 8 parts, Lygodium japonicum 10 parts, Pyrrosia lingua 10 parts, and Scutellaria barbata 12 parts.
2. A traditional Chinese medicine preparation for treating diabetic nephropathy as described in claim 1, characterized in that, The traditional Chinese medicine preparation is made by adding medically acceptable excipients to the above-mentioned proportions of traditional Chinese medicinal materials to form an oral dosage form, which is any one of decoction, powder, granules, oral liquid, pill, capsule, or tablet.
3. The method for preparing a traditional Chinese medicine preparation for treating diabetic nephropathy as described in claim 1, characterized in that, The traditional Chinese medicine preparation is prepared into honey pills according to the following steps: (1) Weigh the Chinese medicinal materials according to the above weight proportions, wash them, dry them at below 60℃ with a moisture content of less than 10%, then pulverize them, pass them through a 100-120 mesh sieve, and mix them evenly to obtain medicinal powder; (2) Refine honey at 110-120℃ until it turns yellowish-brown. When picked up, the honey thread can be stretched without breaking. This is refined honey. (3) While it is still hot, mix the refined honey and the medicinal powder in a weight ratio of 1.1-1.4:
1. Add the medicinal powder to the refined honey in small amounts several times, and stir and mix thoroughly to obtain a medicinal ball; (4) Roll the medicine ball into a long strip with uniform thickness and smooth surface, then cut it into short sections of medicine particles with the same length and diameter. Place the medicine particles in a pill-making machine to make round and smooth spheres. Dry them at 60°C or below until the moisture content is less than 5%. Each pill weighs 0.3±0.05g, and the traditional Chinese medicine preparation in the form of honey pills is obtained.