A luminescent cell for rapid detection of drug allergy and / or allergic reaction and its construction method and application

By recombining the H_HEXA gene promoter in myeloid-related cells, a luminescent cell was developed, which solved the problems of cumbersome detection process and insufficient sensitivity in existing technologies. This enabled rapid and sensitive detection of allergies and allergy-like reactions, making it suitable for efficient diagnosis and scientific research in multiple scenarios.

CN121574936BActive Publication Date: 2026-07-03NAT INST FOR FOOD & DRUG CONTROL
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202511785326.4
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-12-01
Publication Date
2026-07-03
Estimated Expiration
2045-12-01

AI Technical Summary

Technical Problem

Existing in vitro detection technologies for allergies and allergy-like reactions suffer from problems such as cumbersome detection processes, poor real-time results, insufficient sensitivity, and low specificity, failing to meet the urgent clinical and research needs for efficient detection technologies.

Method used

By recombining the H_HEXA gene promoter with a marker gene and then transferring it into myeloid-related cells, a luminescent cell was developed that utilizes the specific activation characteristics of the H_HEXA gene in allergic/allergy-like reactions. This cell can visually reflect the occurrence of the reaction through the marker signal, enabling rapid detection.

Benefits of technology

These luminescent cells can quickly identify allergens/allergens by observing changes in fluorescence intensity within 0.5-2 hours, without requiring complex morphological observation or molecular extraction. They can qualitatively screen for unknown allergens/allergen-like substances and achieve semi-quantitative/quantitative assessment through standard curves, reducing detection costs and operational barriers.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121574936B_ABST
    Figure CN121574936B_ABST
Patent Text Reader

Abstract

The application discloses a luminescent cell for rapidly detecting drug allergy and / or allergic reaction, and a construction method and application thereof, and relates to the technical field of biotechnology.The construction method comprises the following steps: transforming a myeloid-related cell with a recombinant vector containing a marker gene and an H_HEXA gene promoter to obtain a recombinant cell; and the recombinant cell is the luminescent cell.The application is characterized in that the H_HEXA gene promoter is recombined with the marker gene, and then is transformed into the myeloid-related cell, and the specific activation characteristics of the H_HEXA gene in the allergic reaction / allergic reaction are utilized, so that the occurrence of the allergic reaction or the allergic reaction can be directly reflected through a marker signal.The luminescent cell has good stability, is suitable for drug allergy, allergic reaction risk assessment, environmental sample analysis and other scenes, and provides an efficient, sensitive and convenient technical tool for clinical rapid diagnosis, new drug research and development and scientific research exploration, and can significantly reduce detection cost and operation threshold.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of biotechnology, and in particular to a luminescent cell for rapid detection of drug allergies and / or allergy-like reactions, its construction method, and its application. Background Technology

[0002] Allergies and allergic-like reactions are common and serious health problems in clinical practice, and in vitro diagnostic technologies play a crucial role in both prevention and diagnosis. In prevention, accurate detection of allergens allows patients to take targeted avoidance measures, effectively reducing the risk of allergic reactions. In diagnosis, in vitro diagnostic technologies provide clinicians with objective and accurate diagnostic evidence, facilitating rapid and precise assessment of the condition and the development of personalized treatment plans. This not only improves treatment outcomes but also avoids delays in treatment due to misdiagnosis or missed diagnosis, reducing unnecessary medical expenses and patient suffering. Therefore, developing more efficient and accurate in vitro diagnostic technologies has always been a research hotspot and urgent need in the medical field.

[0003] In the field of in vitro detection of allergies and allergy-like reactions, the following technical approaches currently exist:

[0004] 1. Cell morphology observation method

[0005] The principle behind cell morphology observation is based on the fact that certain cells, such as mast cells and basophils, undergo significant morphological changes when exposed to specific stimuli. When mast cells and basophils are subjected to non-specific stimuli or bind to specific mediators, they undergo degranulation, where granules in the cytoplasm are released outside the cell, reducing the number of intracellular granules. Researchers can then visually observe these changes in cell morphology using a microscope, thereby determining whether an allergic or allergy-like reaction has occurred.

[0006] In practice, human or animal-derived (e.g., mouse) cell lines (such as LAD2 and RBL-2H3 cells) or primary cultured effector cells are typically selected. The microscope, as the primary observation device, provides researchers with a means to directly observe cell morphology. This method has the advantages of being intuitive and easy to understand; operators can directly observe changes in cell morphology without the need for complex instruments and reagents.

[0007] This method also has significant drawbacks. The entire detection process is relatively time-consuming, requiring operators to repeatedly observe and evaluate under a microscope, which is a significant drain on both time and effort. It demands skilled cell culture and microscopic observation techniques, and operators must possess extensive experience to accurately judge subtle changes in cell morphology. Quantitative analysis is also a major problem; changes in cell morphology are difficult to quantify with specific data, relying heavily on the operator's subjective judgment, making it highly subjective. This method can only reflect a portion of the cell state and cannot comprehensively and accurately assess allergic and anaphylactic reactions.

[0008] 2. Biochemical detection methods (based on cell releases)

[0009] The principle of biochemical detection is that effector cells release a variety of bioactive mediators after activation, such as histamine, leukotrienes, cytokines, and enzymes. By accurately detecting the concentration of these released substances, the degree of allergic and allergy-like reactions can be effectively assessed.

[0010] In histamine release assays, commonly used methods include enzyme-linked immunosorbent assay (ELISA) or radioimmunoassay (RIA). Specific antibodies are required to capture and quantify histamine. Other cytokines / mediators can also be detected using techniques such as ELISA, LumKine, or flow cytometry to detect substances like IL-4, IL-5, TNF-α, and β-hexosaminidase (β-HEX). β-HEX is a classic marker of effector cell activation, typically quantified via an enzyme-linked colorimetric reaction. This method offers the advantage of good quantification, accurately determining the concentration of bioactive mediators and providing quantitative data support for the assessment of allergies and anaphylactic-like reactions. Furthermore, it has standardized detection methods with clear guidelines for operational procedures and result interpretation, facilitating comparisons between different laboratories. However, it also has several drawbacks, such as: the detection process is time-consuming, with each step from sample collection and processing to reagent incubation requiring time, resulting in a lengthy overall process; and the operation is complex, involving the use of various reagents, operation of precision instruments, and numerous cumbersome experimental steps, demanding a high level of technical skill from the operators. The cost is high, as specific antibodies, enzyme substrates, and detection instruments all require significant investment, increasing the overall cost of testing. Its sensitivity also has limitations; for some low-level allergies and anaphylactic-like reactions, the release of bioactive mediators may be insufficient to detect them, leading to missed diagnoses.

[0011] 3. Gene expression detection method (indirect)

[0012] The principle of gene expression detection is that when allergy and allergy-like response pathways are activated, they induce the upregulation of the expression of specific genes. By using techniques such as RT-PCR (reverse transcription-polymerase chain reaction) or Western Blot, the mRNA or protein levels of these genes can be detected, thereby indirectly determining the occurrence of allergies and allergy-like responses.

[0013] Taking RT-PCR as an example, the cells are first lysed to extract RNA. Then, the RNA is reverse transcribed into cDNA using reverse transcriptase. Using the cDNA as a template, PCR amplification is performed using specific primers. The amplified products are then separated and detected by electrophoresis to determine the mRNA level of a specific gene. Western blotting, on the other hand, first extracts proteins from the cells, separates them according to molecular weight using SDS-PAGE electrophoresis, transfers the separated proteins to a membrane, and then uses specific antibodies to bind to the target protein. The expression level of the target protein is detected by colorimetric or luminescent reactions.

[0014] The advantage of this method lies in its ability to reveal deeper molecular mechanisms behind allergic and anaphylactic reactions, exploring the occurrence and development of the reaction at the gene and protein level. However, its disadvantages cannot be ignored. For example, it has high technical barriers, requiring operators to possess professional molecular biology knowledge and skills, and be familiar with the use of various instruments and the characteristics of experimental reagents. The detection process is time-consuming and complex, with the entire process from cell lysis to final result detection taking several hours or even days, resulting in low efficiency. It is expensive, as RNA extraction reagents, PCR reagents, primers, antibodies, electrophoresis equipment, etc., are all costly, increasing experimental costs. This method is not suitable for real-time observation and cannot monitor the dynamic changes of cells during allergic and anaphylactic reactions in real time; results can only be obtained after the experiment, limiting its ability to promptly understand the reaction process.

[0015] In summary, existing in vitro detection technologies for allergies and anaphylactic-like reactions suffer from numerous problems in areas such as cumbersome detection processes, poor real-time results, insufficient sensitivity, and room for improvement in specificity and quantification. These issues severely restrict the accurate and rapid diagnosis of allergies and anaphylactic-like reactions, failing to meet the urgent clinical and research needs for efficient detection technologies. In clinical practice, the cumbersome testing process, from sample collection to obtaining the final results, often takes a long time, which may delay treatment for patients and cause them to miss the optimal treatment window. Insufficient sensitivity and low specificity can easily lead to misdiagnosis and missed diagnosis, posing potential risks to patients' health. In the research field, these technological limitations also hinder in-depth research into the mechanisms of allergies and anaphylactic-like reactions, failing to provide strong support for new drug development and the optimization of treatment plans.

[0016] Therefore, developing a product that can overcome the above-mentioned shortcomings, is rapid, sensitive, specific, and can monitor drug allergies and allergy-like reactions in real time has become a key issue that urgently needs to be addressed in the medical field. Summary of the Invention

[0017] The purpose of this invention is to provide a rapidly detectable luminescent cell for drug allergies and / or anaphylactic-like reactions, its construction method, and its application, thereby addressing the problems existing in the prior art. This invention involves recombining the H_HEXA gene promoter with a marker gene and then transferring it into myeloid-related cells. Utilizing the specific activation characteristics of the H_HEXA gene in allergic / anaphylactic-like reactions, the occurrence of allergic and / or anaphylactic-like reactions can be directly reflected through the labeled signal.

[0018] To achieve the above objectives, the present invention provides the following solution:

[0019] This invention provides a method for constructing luminescent cells for rapid detection of drug allergies and / or allergy-like reactions, comprising the step of transforming a recombinant vector containing a marker gene and an H_HEXA gene promoter into myeloid-related cells to obtain recombinant cells; the recombinant cells are the luminescent cells.

[0020] The nucleotide sequence of the H_HEXA gene promoter is shown in SEQ ID NO.1.

[0021] Furthermore, the marker gene is the EGFP gene.

[0022] Furthermore, the myeloid-associated cells are basophilic leukemia cells.

[0023] Furthermore, the myeloid-associated cells are human mast cells.

[0024] Furthermore, the base vector of the recombinant vector is the pGL3-basic vector.

[0025] The present invention also provides a luminescent cell for rapid detection of drug allergies and / or allergy-like reactions, constructed according to the above-described construction method.

[0026] The present invention also provides the application of the above-described luminescent cells in the preparation of products for rapid detection of drug allergies and / or allergy-like reactions.

[0027] Furthermore, the product is a reagent kit.

[0028] The present invention also provides a product for rapid detection of drug allergies and / or allergy-like reactions, comprising the above-mentioned luminescent cells.

[0029] Furthermore, the product is a reagent kit.

[0030] The present invention discloses the following technical effects:

[0031] This invention develops a luminescent cell for rapid detection of drug allergies and / or allergy-like reactions. The core of this method involves recombining the H_HEXA gene promoter with a marker gene and then transferring the resulting substance into myeloid-related cells. Utilizing the specific activation characteristics of the H_HEXA gene in allergic / allergy-like reactions, the reaction is directly reflected through the labeled signal. Compared to traditional methods, this system significantly shortens the detection cycle, enabling rapid identification through fluorescence intensity changes within 0.5-2 hours, without requiring complex morphological observation or molecular extraction. The labeled signal is positively correlated with the reaction intensity, allowing for qualitative screening of unknown allergens / allergy-like substances and semi-quantitative / quantitative assessment through standard curves, overcoming the subjectivity and quantification difficulties of traditional methods. Furthermore, this luminescent cell exhibits good stability and is suitable for various scenarios such as drug allergy / allergy-like risk assessment and environmental sample analysis. It provides an efficient, sensitive, and convenient technical tool for rapid clinical diagnosis, new drug development, and scientific research, significantly reducing detection costs and operational barriers. Attached Figure Description

[0032] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0033] Figure 1 The spectrum of the pGL3-basic vector;

[0034] Figure 2 The spectrum of the recombinant plasmid pGL3-basic-H_HEXA promoter(-2000to+42)WT;

[0035] Figure 3 This is a bar chart showing the fluorescence intensity values ​​of different treatment groups at 0.5 h in Example 2; where Control represents the blank control group; DMSO represents the negative control; Vector represents the empty vector group; compared with the blank control group, P <0.001; compared with the empty vector group, ### P <0.001. Detailed Implementation

[0036] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as a limitation of the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0037] It should be understood that the terminology used in this invention is merely for describing particular embodiments and is not intended to limit the invention. Furthermore, with respect to numerical ranges in this invention, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Any stated value or intermediate value within a stated range, as well as each smaller range between any other stated value or intermediate value within said range, is also included in this invention. The upper and lower limits of these smaller ranges may be independently included or excluded from the range.

[0038] Unless otherwise stated, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. While only preferred methods and materials have been described herein, any methods and materials similar or equivalent to those described herein may be used in the implementation or testing of this invention. All references to this specification are incorporated by way of citation to disclose and describe methods and / or materials associated with those references. In the event of any conflict with any incorporated reference, the content of this specification shall prevail.

[0039] Various modifications and variations can be made to the specific embodiments described in this specification without departing from the scope or spirit of the invention, as will be apparent to those skilled in the art. Other embodiments derived from this specification will also be apparent to those skilled in the art. This specification and embodiments are merely exemplary.

[0040] The terms “include,” “including,” “have,” “contain,” etc., used in this article are all open-ended terms, meaning that they include but are not limited to.

[0041] The nucleotide sequences of the β-aminohexosidase (H_HEXA) gene promoter (from -2000 bp to +42 bp, WT being wild type) involved in the following examples are shown in SEQ ID NO.1; the nucleotide sequence of the EGFP gene is shown in SEQ ID NO.2.

[0042] pGL3-basic vector and E. coli stbl3 were purchased from Thermo Fisher Scientific.

[0043] SEQ ID NO.1:

[0044]

[0045] SEQ ID NO.2:

[0046] atggtgagcaagggcgaggagctgttcaccggggtggtgcccatcctggtcgagctggacggcgacgtaaacggccacaagttcagcgtgtccggcgagggcgagggcgatgccacctacggcaagctgaccctgaagttcatctgcaccaccggcaagctgcccgtgccctggcccaccctcgtgaccaccctgacctacggcgtgcagtgcttcagccgctaccccgaccacatgaagcagcacgacttcttcaagtccgccatgcccgaaggctacgtccaggagcgcaccatcttcttcaaggacgacggcaactacaagacccgcgccgaggtgaagttcgagggcgacaccctggtgaaccgcatcgagctgaagggcatcgacttcaaggaggacggcaacatcctggggcacaagctggagtacaactacaacagccacaacgtctatatcatggccgacaagcagaagaacggcatcaaggtgaacttcaagatccgccacaacatcgaggacggcagcgtgcagctcgccgaccactaccagcagaacacccccatcggcgacggccccgtgctgctgcccgacaaccactacctgagcacccagtccgccctgagcaaagaccccaacgagaagcgcgatcacatggtcctgctggagttcgtgaccgccgccgggatcactctcggcatggacgagctgtacaagtaa。

[0047] Example 1

[0048] 1. Construction of pGL3-basic-H_HEXA promoter (-2000 to +42) WT recombinant plasmid

[0049] (1) Synthesize the H_HEXA gene promoter sequence (SEQ ID NO.1) and the EGFP gene sequence (SEQ ID NO.2).

[0050] Primer design: PCR amplification primers were designed using primer design software, and homologous recombination sequences were added to the 5' end.

[0051] The designed primer sequences are sent to a primer synthesis company for synthesis.

[0052] The primer sequences for amplifying the H_HEXA gene promoter are as follows:

[0053] 115964FW-145240: TCGATAGGTACCGAGCTCTTACGCGTTAAAAATCTGGTTAAGTCTAAAAGAGCTCTTTC (SEQ ID NO.3);

[0054] 115964RW-145241:AAGCGGCCGGCCGCCCCGACTCTAGAATTACTTGTACAGTCGTCCATGC (SEQ ID NO. 4).

[0055] The primers for amplifying the EGFP gene are as follows:

[0056] EGFP-F:ATGGTGAGCAAGGGCGAGGA (SEQ ID NO.5);

[0057] EGFP-R:TTACTTGTACAGCTCGTCCATGC (SEQ ID NO. 6).

[0058] (2) Using the seamless cloning method, the pGL3-basic vector (as shown in the spectrum) was cloned with restriction endonucleases. Figure 1 (As shown) linearized, the linearized pGL3-basic vector, the amplified H_HEXA promoter and EGFP Gene fragments are mixed together and undergo a seamless cloning reaction.

[0059] 1) Vector enzyme digestion:

[0060] Take 1 µg of fresh plasmid and perform double digestion with the corresponding restriction endonuclease. The digestion system is shown in Table 1.

[0061] Table 1 Enzyme digestion system

[0062]

[0063] Enzyme digestion was performed at 37°C for approximately 3 hours.

[0064] The enzyme digestion products were subjected to agarose gel electrophoresis, and the gel was recovered after electrophoresis.

[0065] 2) Acquisition of the target fragment

[0066] The synthesized primers were diluted with ultrapure water to a final concentration of 10 µmol / L. PCR amplification was then performed using the diluted primers and template. The PCR amplification system is shown in Table 2.

[0067] Table 2 PCR amplification system

[0068]

[0069] After mixing the above materials in a thin-walled tube and spotting them, place the tube into a PCR instrument for PCR amplification.

[0070] After PCR, agarose gel electrophoresis was performed, and the target gene was recovered.

[0071] 3) Connection between the carrier and the target fragment

[0072] The target fragment and vector were ligated using a seamless cloning method. The ligation system is shown in Table 3, and ligation was performed at 50℃ for 20 min.

[0073] Table 3 Connection System

[0074]

[0075] (3) The ligation product was transferred into the prepared bacterial competent cells. The transformed cells were revived in an antibiotic-free culture medium for a period of time, and then cultured in a culture medium containing the corresponding ampicillin antibiotic to screen out colonies containing plasmids.

[0076] Transformation: After the competent cells were thawed naturally on ice (4°C), 10 µL of the ligation product was added to the competent cells and placed on ice (4°C) for 30 min.

[0077] 1) Then heat shock in a 42°C water bath for 90 seconds. Then quickly place on ice (4°C) for 2-3 minutes.

[0078] 2) Add 500 μL of antibiotic-free SOC culture medium and incubate at 37°C and 225 rpm for 45 min with shaking.

[0079] 3) Centrifuge at 3000 rpm for 2 min, discard 900 µL of supernatant, disperse the bacterial culture at the bottom of the tube by blowing, add it to a culture plate containing the corresponding resistance on the carrier, spread it evenly with a sterile spreader (the temperature of the spreader should not be too high to avoid killing the bacteria), and invert it in a 37℃ constant temperature incubator for overnight culture.

[0080] (4) Send the grown single-clone colonies to a sequencing company for sequencing: In a clean bench, aspirate 400 μL of bacterial culture from a 96-well deep-well plate into an EP tube, and aspirate 20 μL of sequencing primers into an EP tube. Select two single-clone colonies that are positive for bacterial P and send them to a sequencing company for sequencing identification. Use Chromas for alignment. The clone that aligns correctly is the successfully constructed recombinant plasmid pGL3-basic-H_HEXA promoter(-2000to+42)WT (spectrum as shown in the figure). Figure 2 (As shown).

[0081] (5) Extraction: Extraction was performed using an endotoxin-free plasmid large-scale extraction kit. The extracted plasmids were then subjected to purity and QC verification.

[0082] 2. Cell transfection

[0083] The recombinant plasmid pGL3-basic-H_HEXA promoter(-2000to+42)WT was transfected into RBL-2H3 and LAD2 cells, respectively.

[0084] (1) Culture of RBL-2H3 and LAD2 cells

[0085] Culture media: RBL-2H3 was grown in EMEM medium and LAD2 in IMDM medium, both supplemented with 10% fetal bovine serum (FBS) and 1% penicillin-streptomycin.

[0086] Culture conditions: 37℃, 5% CO2, saturated humidity.

[0087] Cell passage: Cells are periodically digested (using 0.25% trypsin-EDTA) and passaged into new culture vessels to maintain their growth viability.

[0088] Preparation requirements: Ensure that the cells are in the logarithmic growth phase, healthy and vigorous, and free from contamination such as mycoplasma.

[0089] (2) Chemical transfection

[0090] Preparation of plasmid-liposome mixture: In serum-free Opti-MEM or other medium, plasmid DNA was mixed with Lipofectamine 2000, gently shaken, and incubated at room temperature for 5 minutes to obtain plasmid-liposome mixture.

[0091] Cell preparation: In 6-well or 12-well plates, cells are introduced at a rate of 2 × 10⁶ cells / well. 5 Spread cells at a density of 1 cell / well, ensuring that the cells are at 80-90% confluence.

[0092] Add transfection solution: Add the plasmid-liposome mixture dropwise into the culture dish containing the cells.

[0093] Incubation: Incubate at 37°C and 5% CO2 for 6 hours.

[0094] Change the culture medium: Remove the culture medium containing the transfection solution and add complete culture medium containing 10% FBS.

[0095] Culture: Continue culturing for 24 hours. Transfection efficiency was initially assessed by fluorescence observation, and antibiotic screening was performed to select cells that stably integrated the recombinant plasmid. These were the RBL-2H3 and LAD2 cells transfected with the recombinant plasmid pGL3-basic-H_HEXA promoter(-2000to+42)WT, abbreviated as luminescent cells RBL-2H3 and luminescent cells LAD2.

[0096] Example 2

[0097] In this embodiment, the luminescent cells RBL-2H3 prepared in Example 1 were used to detect the allergen-like activity of C48 / 80 and Substance P, as well as to detect the allergic reaction induced by DNP-BSA after IgE sensitization.

[0098] 1. Experimental Materials

[0099] Cell line: RBL-2H3 luminescent cells prepared in Example 1; cells transfected with empty vector.

[0100] Positive drugs: C48 / 80 (a commonly used mast cell activator that induces allergy-like reactions); Substance P (a neuropeptide that activates mast cells and induces allergy-like reactions); DNP-IgE (binds to FcεRI receptors on the surface of mast cells, cross-links upon antigen stimulation, and is used for sensitization); DNP-BSA (an immunogenic multivalent antigen used to induce allergic reactions).

[0101] Solvent control group: DMSO.

[0102] Fluorescent microplate reader: It has fluorescence detection function and can detect the excitation and emission spectra of EGFP (excitation wavelength about 488 nm, emission wavelength about 507 nm).

[0103] 2. Experimental Methods

[0104] RBL-2H3 luminescent cells and cells transfected with the empty vector were seeded at a concentration of 30,000 cells per well into 96-well fluorescent microplates and incubated at 37°C with 5% CO2 to allow for full cell adhesion (for the DNP-BSA group, 400 ng / mL DNP-IgE was added and incubated for 24 h; the old solution was discarded). Then, C48 / 80, Substance P, DNP- / BSA, or blank solvent were added as shown in Table 1. A blank control containing only culture medium was also included. Detection was performed at different time points after drug addition (0.5, 1, 1.5, 2 h). The excitation wavelength (488 nm) and emission wavelength (507 nm) of EGFP were set. The fluorescence intensity value (relative fluorescence unit, RFU) of each well was read.

[0105] The test results are shown in Table 2 and Figure 3 The results showed that the positive control drugs (C48 / 80, Substance P, and DNP-BSA) significantly induced EGFP expression, resulting in a substantial increase in the green fluorescence signal, while the fluorescence intensity of the blank control and negative control groups remained essentially unchanged. This indicates that the detection method can distinguish between allergen-like and allergen-like stimuli. Significant fluorescence enhancement was detected at the set concentrations, indicating that the model has a certain sensitivity to detect allergen-like and allergen-like responses. The substantial increase in fluorescence signal (multiple times the background) is valid evidence for detection. Fluorescence intensity was positively correlated with the activity of the H_HEXA promoter. Semi-quantitative or quantitative assessment of allergen-like and allergen-like responses can be achieved by establishing standard curves (e.g., using known concentrations of stimulants). The fluorescence intensity of different drugs at the same time point can be used to compare their ability to induce allergen-like or allergic reactions. EGFP is a stable reporter protein with a relatively easy-to-detect fluorescence signal and accumulates intracellularly, making it suitable for detection over a long time window.

[0106] Table 1 Experimental Groups

[0107]

[0108] Table 2 Fluorescence intensity values ​​at different times

[0109]

[0110] The embodiments described above are merely preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Various modifications and improvements made by those skilled in the art to the technical solutions of the present invention without departing from the spirit of the present invention should fall within the protection scope defined by the claims of the present invention.

Claims

1. A method for constructing luminescent cells for rapid detection of drug allergies and / or allergy-like reactions, characterized in that, The method includes the step of transforming a recombinant vector containing a marker gene and an H_HEXA gene promoter into myeloid-related cells to obtain recombinant cells; the recombinant cells are the luminescent cells. The nucleotide sequence of the H_HEXA gene promoter is shown in SEQ ID NO.1; The myeloid-related cells are basophilic leukemia cells or human mast cells.

2. The construction method according to claim 1, characterized in that, The marker gene is the EGFP gene.

3. The construction method according to claim 1, characterized in that, The base vector for the recombinant vector is the pGL3-basic vector.

4. A luminescent cell for rapid detection of drug allergies and / or allergy-like reactions, constructed according to any one of claims 1-3.

5. The use of the luminescent cells as described in claim 4 in the preparation of a product for rapid detection of drug allergies and / or allergy-like reactions.

6. The application according to claim 5, characterized in that, The product in question is a reagent kit.

7. A product for rapid detection of drug allergies and / or allergy-like reactions, characterized in that, Includes the light-emitting cells as described in claim 4.

8. The product according to claim 7, characterized in that, The product in question is a reagent kit.

Citation Information

Patent Citations

  • In-vitro detection method of allergen in food

    CN103257237A

  • Stable transfection cell strain overexpressing MRGPRX2 as well as construction method and application of stable transfection cell strain

    CN116855503A