Application of lactic acid modified histone H3 in preparation of medicine and / or diagnostic kit for preventing and / or treating pancreatic ductal adenocarcinoma

By utilizing lactated histone H3K23la as a target, diagnostic kits and therapeutic drugs were developed, addressing the shortcomings in the diagnosis and treatment of pancreatic ductal adenocarcinoma. This resulted in the effective inhibition of the proliferation, invasion, and migration of pancreatic ductal adenocarcinoma cells, thereby improving treatment outcomes.

CN121595874AActive Publication Date: 2026-03-03AFFILIATED HOSPITAL OF NANTONG UNIV

Patent Information

Application Number
CN202511935626.6
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-12-19
Publication Date
2026-03-03
Estimated Expiration
2045-12-19

AI Technical Summary

Technical Problem

The existing technology lacks sufficient research on lactation modification of histone H3, especially H3K23la in pancreatic ductal adenocarcinoma, resulting in a lack of effective diagnostic and treatment methods, which affects the treatment effect of PDAC.

Method used

By using lactated histone H3, especially H3K23la, as targets, diagnostic kits and therapeutic drugs can be developed by detecting and inhibiting its expression. H3K23la expression can be regulated using antibody, mass spectrometry detection, knockout or knockdown techniques to simulate inactivation and inhibit the proliferation, invasion and migration of pancreatic ductal adenocarcinoma cells.

Benefits of technology

It significantly inhibited the proliferation, invasion, and migration of pancreatic ductal adenocarcinoma cells, providing precise diagnostic and treatment methods and improving the treatment effect of PDAC.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121595874A_ABST
    Figure CN121595874A_ABST
Patent Text Reader

Abstract

The invention provides application of lactic acid modified histone H3 in preparation of drugs and / or diagnostic kits for preventing and / or treating pancreatic ductal adenocarcinoma, and belongs to the technical field of disease diagnosis and / or treatment. The invention provides application of a lactic acid modified histone H3 as a target spot in preparation of a pancreatic ductal adenocarcinoma diagnostic kit or a medicine for preventing and / or treating pancreatic ductal adenocarcinoma. The site of lactic acid modification is 23-site lysine. The expression of H3K23la detected in clinical sample tissues in pancreatic ductal adenocarcinoma tumor tissues is obviously higher than that in para-carcinoma normal tissues, overexpression and non-expression of H3K23la in cells are regulated and controlled through in-vitro experiments in combination with overexpression and knock-down technologies, and results show that proliferation, invasion and migration capacities of pancreatic ductal adenocarcinoma cells are remarkably inhibited, so that the pancreatic ductal adenocarcinoma cells are remarkably inhibited. Therefore, the H3K23la can be used as a target spot for diagnosis and treatment of the pancreatic duct adenocarcinoma, and has wide application in diagnosis or treatment of the pancreatic duct adenocarcinoma.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This application belongs to the technical field of disease diagnosis and / or treatment, specifically relating to the use of lactated histone H3 in the preparation of drugs and / or diagnostic kits for the prevention and / or treatment of pancreatic ductal adenocarcinoma. Background Technology

[0002] Pancreatic cancer accounts for over 80% of all cancers, specifically pancreatic ductal adenocarcinoma (PDAC), a highly aggressive tumor of the digestive system and one of the deadliest human malignancies. Despite efforts to improve treatment over the past decade, the mortality rate of PDAC has not decreased significantly. Therefore, a clearer understanding of the growth and metastasis mechanisms of PDAC and the search for potential diagnostic and therapeutic targets are essential to providing new avenues for its diagnosis and treatment.

[0003] Histones participate in the regulation of various physiological functions, and their post-translational modifications (such as acetylation, succinylation, and lactation) play an important role in the development and progression of diseases. For example, histone lactation mediates the development and progression of atherosclerosis, lactated histone H3 plays a role in the treatment of pulmonary microvascular endothelial cell dysfunction, and histone lactation mediates the malignant progression of various tumors. However, research on histone lactation still focuses on lysine 18 of histone H3 (H3K18la), and there are currently no reports on the effects of lactation modification of lysine 23 of histone H3 (H3K23la) on the progression of pancreatic ductal adenocarcinoma. Summary of the Invention

[0004] The purpose of this invention is to provide the use of lactated histone H3 in the preparation of drugs and / or diagnostic kits for the prevention and / or treatment of pancreatic ductal adenocarcinoma.

[0005] This invention provides the application of lactated histone H3 as a target in the preparation of a diagnostic kit for pancreatic ductal adenocarcinoma, wherein the lactation modification site of the lactated histone H3 is lysine 23.

[0006] This invention provides the application of a reagent for detecting lactated histone H3 in the preparation of a diagnostic kit for pancreatic ductal adenocarcinoma, wherein the lactation modification site in the lactated histone H3 is lysine 23.

[0007] Preferably, the pancreatic ductal adenocarcinoma includes carcinoma in situ and / or metastatic tumors.

[0008] Preferably, the cell line type of the pancreatic ductal adenocarcinoma includes at least one of the following: PANC-1, BxPC-3, and CFPAC-1.

[0009] Preferably, the reagent for detecting lactated histone H3 includes an antibody against lactated histone H3 and / or a mass spectrometry detection reagent.

[0010] This invention provides the use of a reagent that inhibits histone H3 lactation in the preparation of drugs for the prevention and / or treatment of pancreatic ductal adenocarcinoma.

[0011] Preferably, the reagent for inhibiting histone H3 lactation includes at least one of the following: an antibody against lactated histone H3, a reagent for knocking out or knocking down lactated histone H3, a histone H3 mutant with a mutation at the lactation modification site, a lactation-modifying enzyme inhibitor, a lactate inhibitor, and a histone delactase agonist.

[0012] Preferably, the histone H3 mutant with the lactation modification site mutation is a protein mutant formed by mutating lysine at position 23 of histone H3 to another amino acid.

[0013] Preferably, the histone H3 mutant with the lactation modification site mutation is a histone H3 mutant with lysine at position 23 mutated to arginine.

[0014] Preferably, the prevention and / or treatment of pancreatic ductal adenocarcinoma includes inhibiting the growth and / or migration of pancreatic ductal adenocarcinoma.

[0015] This invention provides the application of lactated histone H3 as a target in the preparation of diagnostic kits for pancreatic ductal adenocarcinoma or drugs for the prevention and / or treatment of pancreatic ductal adenocarcinoma, wherein the lactation modification site of the lactated histone H3 is lysine 23. This invention utilizes 4D label-free quantitative proteomics analysis of clinical tissue samples to determine the lactation modification status. The results indicate that the expression of H3K23la in pancreatic ductal adenocarcinoma tumor tissue is significantly higher than that in adjacent normal tissue. Immunohistochemical analysis of pancreatic ductal adenocarcinoma tissue microarrays further confirms that the expression of H3K23la in pancreatic ductal adenocarcinoma tumor tissue is significantly higher than that in adjacent normal tissue. In addition, through in vitro experiments including Western blot, Transwell assay, CCK8 assay, and scratch assay, we combined overexpression and knockdown techniques to regulate H3K23la expression and investigate its impact on the biological behavior of pancreatic ductal adenocarcinoma cells. First, we inhibited endogenous H3 expression in PANC-1 cells using sh-RNA to eliminate the influence of endogenous H3 on the experiments. Then, we selected the cell line with the highest knockdown efficiency (PANC-1 #1) for overexpression of exogenous H3 wild-type and its mutant (a lysine mutation at position 24 to arginine, mimicking H3K23la lactation inactivation). We found that after transfection, the H3K23la level decreased in the PANC-1 sh-H3+ OE-H3K23R group, and it significantly affected cell proliferation, invasion, and migration. Therefore, H3K23la can serve as a target for the diagnosis and treatment of pancreatic ductal adenocarcinoma, with broad applications in the development of precision medicine diagnostic kits and the treatment of pancreatic ductal adenocarcinoma with high H3K23la expression. Attached Figure Description

[0016] Figure 1 Statistical results of histone lactation in pancreatic ductal adenocarcinoma and adjacent normal tissues were obtained using 4D label-free quantitative proteomics analysis of lactation modifications; A represents the number of lactation sites; B represents the expression level of H3K23la. Figure 2 Image showing the expression of H3K23la in pancreatic ductal adenocarcinoma and adjacent normal tissues detected by IHC; Figure 3 A comparative figure showing the expression of H3K23la in four different pancreatic ductal adenocarcinoma cell lines; Figure 4 Results of constructing an endogenous histone H3 knockdown cell line based on PANC-1 cells; Figure 5 Figure for CCK-8 assay to study the effect of knockdown of endogenous histone H3 expression on cell proliferation; Figure 6 Figure for Edu experimental study on the effect of knockdown of endogenous histone H3 expression on cell proliferation; Figure 7 Figure for Transwell assay to study the effect of knockdown of endogenous histone H3 expression on cell migration; Figure 8 The figure shows the effect of knocking down the expression of endogenous histone H3 on cell migration using a scratch assay; where A represents the scratch assay results and B represents the statistical results of the scratch assay. Figure 9 Results of constructing exogenous H3 (WT) and H3 (K23R) overexpressing cell lines based on PANC-1 sh-H3 #1 cells; Figure 10 Figure for CCK-8 assay to study the effect of inhibiting H3K23la expression on cell proliferation; Figure 11 Figure for Edu experiment to study the effect of inhibiting H3K23la expression on cell proliferation; Figure 12 Figure showing the effect of inhibiting H3K23la expression on cell invasion in a Transwell invasion assay; Figure 13 The figure shows the effect of inhibiting H3K23la expression on cell metastasis using a scratch assay; where A represents the scratch assay results and B represents the statistical results of the scratch assay. Detailed Implementation

[0017] This invention provides the application of lactated histone H3 as a target in the preparation of a diagnostic kit for pancreatic ductal adenocarcinoma, wherein the lactation modification site of the lactated histone H3 is lysine 23.

[0018] In this invention, the lactation modification site of the lactated histone H3 is lysine 23, and the lactated histone H3 is denoted as H3K23la. 4D label-free quantitative proteomics analysis of lactation modification in clinical samples demonstrated that the expression of H3K23la in pancreatic ductal adenocarcinoma tumor tissue was significantly higher than that in adjacent normal tissue, and the same results were obtained by immunohistochemistry (IHC). Simultaneously, biological experiments were used to verify the effect of lactation modification on the proliferation and migration of pancreatic ductal adenocarcinoma-related cells. First, pancreatic ductal adenocarcinoma cells with endogenous H3K23la knockdown were constructed. Then, exogenous H3 wild-type and its mutant (lysine 24 mutated to arginine, simulating H3K23la lactation inactivation) were overexpressed in the cells. The results showed that compared with tumor cells expressing exogenous H3 wild-type, the H3K23la level in the H3K23R group was significantly decreased, and the proliferation, invasion, and migration abilities of cells were significantly inhibited. Therefore, H3K23la can serve as a target for the diagnosis and treatment of pancreatic ductal adenocarcinoma, and has wide applications in the preparation of diagnostic kits for precision medicine and in the treatment of pancreatic ductal adenocarcinoma with high expression of H3K23la.

[0019] This invention provides the application of a reagent for detecting lactated histone H3 in the preparation of a diagnostic kit for pancreatic ductal adenocarcinoma, wherein the lactation modification site in the lactated histone H3 is lysine 23.

[0020] In this invention, given that the expression level of lactated histone H3 not only affects the proliferation of tumor cells but also their migration and invasion, the pancreatic ductal adenocarcinoma preferably includes carcinoma in situ and / or metastatic tumors.

[0021] In this invention, the preferred cell line types for pancreatic ductal adenocarcinoma include at least one of the following: PANC-1, BxPC-3, and CFPAC-1. In the embodiments of this invention, detection experiments were conducted using four different pancreatic ductal adenocarcinoma cell lines and pancreatic ductal epithelial cells. The results showed that H3K23la was highly expressed in PANC-1, BxPC-3, and CFPAC-1, while HPAC did not show the same results. This indicates that H3K23la can be used as a diagnostic marker for pancreatic ductal adenocarcinoma.

[0022] In this invention, the reagents for detecting lactated histone H3 include antibodies against lactated histone H3 and / or mass spectrometry detection reagents. When using antibodies against lactated histone H3 for detection, Western blotting is preferred.

[0023] This invention provides the use of a reagent that inhibits histone H3 lactation in the preparation of drugs for the prevention and / or treatment of pancreatic ductal adenocarcinoma.

[0024] In this invention, the reagent for inhibiting histone H3 lactation preferably includes at least one of the following: an antibody against lactated histone H3, a reagent for knocking out or knocking down lactated histone H3, a histone H3 mutant with a mutation at the lactation modification site, a lactation-modifying enzyme inhibitor, and a histone delactase agonist. The antibody against lactated histone H3 preferably includes monoclonal antibodies, polyclonal antibodies, nanobodies, etc. The monoclonal antibodies, polyclonal antibodies, and nanobodies are prepared by immunizing animals with H3K23la or a truncated form of H3K23la as an antigen. The reagent for knocking out or knocking down lactated histone H3 preferably includes shRNA, siRNA, and sgRNA targeting the gene encoding lactated histone H3. The shRNA includes shRNA1, shRNA2, and shRNA3, with nucleotide sequences as shown in SEQ ID NO:1~SEQ ID NO:3. The present invention does not impose any particular limitation on the lactation-modifying enzyme inhibitor and histone delactase agonist, and any lactation-modifying enzyme inhibitor and histone delactase agonist well known in the art can be used.

[0025] In this embodiment of the invention, the histone H3 mutant with the lactation modification site mutation is preferably a protein mutant formed by mutating lysine at position 23 of histone H3 to another amino acid, such as arginine. The amino acid sequence of the mutant is shown in SEQ ID NO:5.

[0026] In this invention, the prevention and / or treatment of pancreatic ductal adenocarcinoma preferably includes inhibiting the growth and / or migration of pancreatic ductal adenocarcinoma.

[0027] In this invention, the drug preferably comprises at least one of the following dosage forms: oral dosage form, injection, spray, suppository, etc. This invention does not impose any particular limitation on the preparation method of the drug; any dosage form well-known in the art can be used.

[0028] The following examples illustrate the application of lactated histone H3 provided by the present invention in the preparation of drugs and / or diagnostic kits for the prevention and / or treatment of pancreatic ductal adenocarcinoma, but these should not be construed as limiting the scope of protection of the present invention.

[0029] The main reagents used in the following examples are: DAB staining solution (enhanced polymer method) kit (Fuzhou Maixin Biotechnology Development Co., Ltd.); rabbit anti-human H3K23la polyclonal antibody (Jingjie Biotechnology); enzyme-labeled anti-mouse / rabbit IgG polymer (Fuzhou Maixin Biotechnology Development Co., Ltd.); primary antibody dilution solution for immunostaining (Shanghai Beyotimes Biotechnology Co., Ltd.); citric acid tissue antigen retrieval solution (100X) (Fuzhou Maixin Biotechnology Development Co., Ltd.); endogenous peroxidase inhibitor (Fuzhou Maixin Biotechnology Development Co., Ltd.); reaction enhancement solution (Fuzhou Maixin Biotechnology Development Co., Ltd.); xylene (Changshu Hongsheng Fine Chemical Co., Ltd.); neutral resin (Sinopharm Chemical Reagent Co., Ltd.); human pancreatic ductal adenocarcinoma cell lines hTERT-HPNE, PANC-1, BxPC-3, FPAC-1, HPAC (All purchased from BNCC Biotechnology); DMEM, RPMI, IMDM culture media (purchased from Hyclone), fetal bovine serum (Jiangsu Kaiji Biotechnology Co., Ltd.); BCA protein assay kit (Shanghai Beyotime Biotechnology Co., Ltd.); serum-free cell cryopreservation solution (Suzhou Xinsaimei Co., Ltd.); PBS (Sewell Biotechnology Co., Ltd.); PVDF membrane (MERCK Biotechnology Co., Ltd.); mouse anti-human H3 monoclonal antibody, mouse anti-DYKDDDDK tag monoclonal antibody (Proteintech Co., Ltd.); horseradish peroxidase-labeled goat anti-rabbit IgG, horseradish peroxidase-labeled goat anti-mouse IgG (Jackson ImmunoResearch Co., Ltd.); ECL luminescence kit (Suzhou Xinsaimei Co., Ltd.); Tris-glycine SDS-PAGE SWE high-resolution rapid electrophoresis buffer, ice-free rapid transfer buffer, TBS buffer (Sewell Biotechnology Co., Ltd.); skim milk powder (Shanghai Beyotime Biotechnology Co., Ltd.).

[0030] The main instruments used in the following embodiments are as follows: Protein electrophoresis apparatus (Bio-Rad, USA); CO2 incubator (Thermo Fisher Scientific, USA); Biosafety cabinet (Thermo Fisher Scientific, USA); Clean bench (Shanghai Biotech, China); The ChemiDoc XRS+ imaging system (Bio-Rad, USA); Multifunctional microplate reader (BioTek, USA); Inverted fluorescence phase contrast microscope (Olympus, Japan); Upright microscope (Leica, USA); -80℃ ultra-low temperature freezer (Thermo Fisher Scientific, USA); Multifunctional shaker (Kirin, China); Himac micro-ultracentrifuge (Hitachi, Japan).

[0031] Example 1 4D Label-Free Lactation Modification Quantitative Proteomics Detection of Paired Pancreatic Cancer Samples 1. Sample collection Five pancreatic ductal adenocarcinoma tissues and corresponding adjacent normal tissue samples were collected from the Affiliated Hospital of Nantong University and sent to Jingjie Biotechnology Co., Ltd. for 4D label-free lactation-modified quantitative proteomics sequencing. All patients gave informed consent, and the acquisition of all the above specimens was approved by the ethics committee of the cooperating hospital.

[0032] 2. Protein extraction The sample was ground into cell powder using liquid nitrogen and then transferred to 5 ml centrifuge tubes. Four volumes of lysis buffer (8 M urea, 1% protease inhibitor mixture) were then added to the cell powder, followed by sonication three times on ice using a high-intensity sonicator (Scientz). (Note: For PTM experiments, inhibitors were also added to the lysis buffer; for example, 3 μM TSA and 50 mM NAM were used for acetylation, and 1% phosphatase inhibitor was used for phosphorylation). Residual debris was removed by centrifugation at 12,000 g for 10 min at 4 °C. Finally, the supernatant was collected, and protein concentration was determined using a BCA kit according to the manufacturer's instructions.

[0033] 3. Trypsin digestion The protein solution was reduced with 5 mM dithiothreitol at 56 °C for 30 min, and then alkylated with 11 mM iodoacetamide for 15 min in the dark at room temperature. The protein sample was then diluted to a urea concentration of less than 2 μL by adding 100 mM TEAB. Finally, a first digestion was performed overnight with trypsin at a 1:50 trypsin-to-protein mass ratio, followed by a second digestion at a 1:100 trypsin-to-protein mass ratio for 4 h. The final solution was desalted using a C18 SPE column.

[0034] 4. TMT tag First, trypsin was dissolved in 0.5 M TEAB. Each peptide channel was labeled using its respective TMT reagent (based on the manufacturer's operating procedure, ThermoFisher Scientific) and incubated at room temperature for 2 hours. Each sample was pooled into 5 μl volumes, desalted, and the labeling efficiency was detected by MS. After labeling efficiency detection, 5% hydroxylamine was added to quench the sample. The mixed samples were desalted using a Strata X C18 SPE column (Phenomenex) and dried by vacuum centrifugation.

[0035] 5. HPLC fractionation Samples were separated using high-pH reversed-phase high-performance liquid chromatography (HPLC) with an Agilent 300 Extend C18 column (5 μm particles, ID 4.6 mm, length 250 mm). In short, peptides were separated into 80 fractions over 80 minutes in 10 mM ammonium bicarbonate at pH 10 using a gradient of 2% to 60% acetonitrile. The peptides were then combined into 9 fractions and dried by vacuum centrifugation.

[0036] 6. Affinity enrichment To enrich the modified peptides, trypsin peptides dissolved in NETN buffer (100 mM NaCl, 1 mM EDTA, 50 mM Tris-HCl, and 0.5% NP-40, pH 8.0) were gently agitated overnight at 4°C with pre-washed antibody beads (lot number xxx, PTM Bio). The beads were then washed four times with NETN buffer and twice with H2O. The bound peptides were eluted from the microspheres with 0.1% trifluoroacetic acid. Finally, the eluents were combined and vacuum dried. For LC-MS / MS analysis, the resulting peptides were desalted using C18 ZipTips (Millipore) according to the manufacturer's instructions.

[0037] 7. LC-MS / MS Analysis The pancreatic peptide was dissolved in solvent A (0.1% formic acid, 2% acetonitrile / water solution) and directly loaded onto a domestically produced reversed-phase analytical column (25 cm long, 75 / 100 μm inner diameter). In a Bruker Daltonics nanoElute UHPLC system, the peptide was separated at a constant flow rate (450 nL / min) using a gradient of 6%–24% solvent B (0.1% formic acid and acetonitrile). The separation time was 70 min for 24%–35% of the solution, 14 min for 24%–35%, and then increased to 80% and held at 80% for 3 min.

[0038] Peptides were analyzed using capillary source analysis followed by timsTOF Pro (Bruker Daltonics) mass spectrometry. The electrospray voltage was 1.60 kV. Precursors and fragments were analyzed on a TOF detector, with MS / MS scans ranging from 100 to 1700 m / z. timsTOF Pro was operated in Parallel Accumulation Tandem Fragmentation (PASEF) mode. Precursors with charge states of 0–5 were selected for fragmentation, with 10 PASEF-MS / MS scans acquired per cycle. The dynamic exclusion time was set to 30 s.

[0039] 8. Database Search The acquired mass spectrometry data were processed using the MaxQuant search engine (v.1.6.15.0). Tandem mass spectrometry was performed to search the human SwissProt database (20,422 entries) and the reverse decoy database. Trypsin / P was specified as the lyase allowing a maximum of two deletion cleavages. The mass tolerance for precursor ions was set to 20 ppm for the initial search, 5 ppm for the main search, and 0.02 Da for fragment ions. Aminomethylation on Cys was a fixed modification, while n-terminal acetylation of the protein and oxidation on Met were variable modifications. FDR was adjusted to <1%.

[0040] Analysis of 4D label-free lactation-modified quantitative proteomic sequencing data revealed a significant upregulation of lysine lactation at histone H3 position 23 (H3K23al) in tumor tissues. Figure 1 ).

[0041] Example 2 Immunohistochemical detection of H3K23la in tissue sections 1. Sample collection Twenty formalin-fixed paraffin-embedded (FFPE) tissue samples were obtained from the Clinical Biobank of the Affiliated Hospital of Nantong University, including 10 cases with normal surgical margins and 10 paired pancreatic ductal adenocarcinoma tissues. The cancer patients had not received any preoperative treatment, including radiotherapy, chemotherapy, or immunotherapy, and their clinical case data were detailed and complete. The research protocol has been approved by the Human Research Ethics Committee of the Affiliated Hospital of Nantong University, China.

[0042] 2. Immunohistochemical experiment Use a microtome to section the paraffin-embedded tissue. Float the continuous sections in cool water to allow them to unfold naturally. Then transfer the sections to warm water at 45°C for about 2 minutes to unfold them. After unfolding, attach them to glass slides that have been treated to prevent slide detachment and let them dry. First, place the tissue sections in a 60°C oven and bake for about 40 minutes until the paraffin melts. Then immediately immerse the chips in xylene I, xylene II, 100% ethanol I and 100% ethanol II for 5 minutes each. Next, immerse them in 95% ethanol, 90% ethanol, 80% ethanol and 70% ethanol for 2 minutes each, and then rinse with water. Antigen retrieval solution was placed in the immunohistochemistry box in advance and preheated to 95°C. The slides were then placed in the container and treated at 95°C for 20 minutes for antigen retrieval. After that, the slides were allowed to cool naturally to room temperature and then rinsed three times with PBS for 5 minutes each time. Then, use an immunohistochemistry pen to draw a boundary line around the tissue on the chip, then drop 3% H2O2 into the inside of the circle, incubate for 10 min, and then wash 3 times with PBS for 5 min each time. Add primary antibody (rabbit anti-human anti-H3K23la polyclonal antibody) and incubate overnight at 4°C; The next day, the cells were warmed to room temperature for 1 hour to remove the primary antibody, washed three times with PBS for 5 minutes each time, polymer enhancer was added, and the cells were incubated at room temperature for 20 minutes. Then, the cells were washed three times with PBS for 5 minutes each time. Add secondary antibody (enzyme-labeled anti-mouse / rabbit IgG polymer), incubate at room temperature for 30 min, then wash 3 times with PBS, 5 min each time; Add freshly prepared DAB reagent, and after color development, rinse the slide under tap water for 5 minutes to stop the color development. Stain the sections with hematoxylin for 2 minutes, rinse them slowly with running water immediately, then soak them in 0.5% HCl-ethanol solution for 2 minutes, and finally rinse them with running water for 15 minutes. Soak the sections in 80% ethanol, 90% ethanol, 95% ethanol, 100% ethanol I, 100% ethanol II, and xylene for 1 minute in sequence, and air dry in a fume hood; mount with neutral resin.

[0043] 3. Results Observation All slide atlases were analyzed by pathologists, and the results are shown below. Figure 2 Observations revealed that the H3K23la staining intensity was significantly deeper in tumor tissue compared to normal pancreatic duct tissue, suggesting that H3K23la expression is upregulated in pancreatic ductal adenocarcinoma.

[0044] Example 3 Western blotting was used to detect the expression of H3K23la in different pancreatic cell lines. 1. Cell Culture Normal pancreatic ductal epithelial cells (hTERT-HPNE) and four different pancreatic ductal adenocarcinoma cell lines (PANC-1, BxPC-3, CFPAC-1, and HPAC) were purchased from BNCC. hTERT-HPNE, PANC-1, and HPAC were cultured in DMEM medium containing 10% fetal bovine serum, 1% penicillin, and streptomycin; CFPAC-1 was cultured in IMEM medium containing 10% fetal bovine serum, 1% penicillin, and streptomycin; and BxPC-3 was cultured in RPMI medium containing 10% fetal bovine serum, 1% penicillin, and streptomycin. All cell lines were routinely cultured in a 5% CO2, 37°C cell culture incubator, with medium changes every 2–3 days. Cells were passaged when confluence reached 90%, and cells in the logarithmic growth phase were used for subsequent experiments.

[0045] 2. Cell protein extraction Remove cells from the incubator. To prevent protein degradation, place the culture dishes on ice, wash with PBS, and add strong lysis buffer to each dish. After incubating on ice for 5 minutes, scrape off the lysed cell fluid using a cell scraper. Then, incubate the cells on ice again for 20 minutes, and collect the cell lysis buffer. Centrifuge the lysis products at 12,000 rpm at 4°C for 10 minutes. Add loading buffer, mix well, boil in an induction cooker for 20 minutes, and finally store in a -80°C ultra-low temperature freezer.

[0046] 3. SDS-PAGE gel preparation Fix two glass plates on the gel preparation rack, select an appropriate separating gel concentration, and prepare the lower separating gel according to the ratio. After stirring evenly, pour the gel solution evenly, adding 7 ml to each plate. Immediately mix in 1 ml of isopropanol and press the gel, allowing it to stand at room temperature for 20-30 minutes until solidified, then discard the isopropanol. Prepare the upper 5% gel solution according to the ratio, insert it into the sample loading tank, avoiding the formation of air bubbles. Allow it to stand at room temperature for 30 minutes until solidified.

[0047] 4. Gel electrophoresis Install the prepared gel glass plate into the electrophoresis tank and remove the sample comb. Boil the protein sample and centrifuge at an appropriate speed to precipitate impurities. Load an appropriate amount of sample and add marker. Adjust the electrophoresis buffer to the appropriate volume and maintain basic electrophoresis stability until the sample protein migrates to the specified orientation.

[0048] 5. Transfer and sealing After gel electrophoresis, remove the glass plate and wash it thoroughly, then immerse it in transfer buffer. Simultaneously, polarize the pre-cut PVDF membrane in methanol, then wash it in deionized water until no air bubbles remain. Next, carefully peel the gel off the glass plate using a gel cutter. Then, immerse the PVDF membrane in transfer buffer for preparation. Next, place the cathode carbon plate (black), gel, PVDF membrane, and anode carbon plate in the transfer tank in sequence, ensuring black side to black side and white side to red side. Perform the transfer in ice water at a constant current of 300 mA for 1–2 hours. After transfer, transfer the membrane to blocking buffer, ensuring the membrane surface is completely covered. Shake on a shaker at room temperature for 1 hour.

[0049] 6. Antibody incubation and development After discarding the blocking solution, add diluted antibody to 1×TBST and mix thoroughly in an incubator. Cover the front surface of the membrane with the antibody and incubate overnight at 4°C. Rinse the membrane three times with shaking in 1×TBST, 10 minutes each time. Select an appropriate secondary antibody and incubate at room temperature for 2 hours, followed by three rinses, 10 minutes each time. Mix the developing solution at a 1:1 ratio, spread it evenly on the membrane, and develop it on an imager.

[0050] Experimental results are as follows Figure 3 As shown, compared with the normal pancreatic ductal cell line hTERT-HPNE, the expression level of H3K23la in pancreatic ductal adenocarcinoma cell lines (PANC-1, BxPC-3, CFPAC-1) was significantly upregulated.

[0051] Example 4 Cell transfection 1. sh-RNA design The shRNA designed based on the sequence of the human histone H3 (Gene ID: 333932) gene was designed and completed by Wuhan Miaoling Biotechnology Co., Ltd., and the DNA sequence is as follows: shRNA#1: 5′-GGCTGTTCGAAGACACGAA-3′ (SEQ ID NO:1); shRNA#2: 5′-GCGTGACCATTATGCCCAA-3′ (SEQ ID NO: 2); shRNA#3: 5′-CGGAGCTGCTGATCCGCAA-3′ (SEQ ID NO:3); 2. Lentiviral preparation Lentiviral cells were prepared using HEK-293T cells and a three-plasmid system. HEK-293T cells were cultured in 10cm cell culture dishes. When the cell density reached 80%, the culture medium was replaced with antibiotic-free DMEM complete medium. Taking one 10cm cell culture dish as an example, a transfection reagent solution was prepared using 60μl of transfection reagent and 840μl of DMEM basal medium. A plasmid solution was then prepared using 10μg of lentiviral plasmid, 7.5μg of psPAX2 plasmid, and 2.5μg of pMD2.G plasmid (in a 4:3:1 ratio) and 840μl of DMEM basal medium. The transfection reagent solution was added to the plasmid solution. After gently mixing and standing for 15 min, the mixture was added to the HEK-293T cell culture dish for further culture. After co-culturing for 12 hours, the culture medium was changed to DMEM complete medium and cultured for another 72 hours. The supernatant was collected and filtered through a 0.45 μm disposable needle filter to obtain a lentivirus solution, which was then aliquoted and stored at -80°C.

[0052] 3. Transfection Human pancreatic ductal adenocarcinoma cell line PANC-1 was seeded at a density of 200,000 cells / well in six-well plates. When the cells adhered and confluent to approximately 30%, transfection was performed. The negative control group (sh-H3 Vec) and the experimental groups (sh-H3 #1, sh-H3 #2, sh-H3 #3) were transfected simultaneously.

[0053] Western blotting was used to detect the expression level of histone H3 gene, and the results were as follows: Figure 4 The results showed that all experimental groups were able to reduce the expression level of endogenous histone H3.

[0054] The effect of knockdown of endogenous histone H3 expression on cell proliferation was investigated using the CCK8 assay. Results Figure 5 This indicates that, compared with the blank control group, knockdown of endogenous histone H3 inhibits cell proliferation.

[0055] The Edu assay was used to investigate the effect of knockdown of endogenous histone H3 expression on cell proliferation. Results Figure 6 This indicates that, compared with the blank control group, knockdown of endogenous histone H3 inhibited cell proliferation, consistent with the results of the CCK8 experiment.

[0056] Transwell assays investigated the effect of knocking down endogenous histone H3 expression on cell migration. Results Figure 7 This indicates that, compared with the blank control group, knockdown of endogenous histone H3 inhibits cell migration.

[0057] The scratch assay investigated the effect of knocking down endogenous histone H3 expression on cell migration. Results Figure 8 This indicates that, compared with the blank control group, knockdown of endogenous histone H3 inhibited cell migration, consistent with the results of the Transwell experiment.

[0058] 4. Construction of exogenous H3-WT and exogenous H3-K23R overexpression plasmids Overexpression plasmids were designed based on the sequence of the human histone H3 (Gene ID: 333932). The H3-WT plasmid, after codon modification, avoids recognition by the aforementioned sh-RNA and can be normally transcribed and translated into wild-type H3. H3-K23R is based on H3-WT, with the codon corresponding to lysine at position 23 replaced by the codon corresponding to arginine, simulating lactation inactivation at the H3K23 site. These plasmids were designed and completed by Wuhan Miaoling Biotechnology Co., Ltd., and their sequences are as follows: H3-WT: 5′-ATGGCCCGTACTAAGCAGACTGCTCGCAAGTCGACCGGCGGCAAGGCCCCGAGGAAGCAGCTGGCCACCAAGGCGGCCCGCAAGAGCGCGCCGGCCACGGGCGGGGTGAAGAAGCCGCACCGCTACCGGCCCGGCACCGTAGCCCTGCGGGAGATCCGGCGCTACCAGAAGTCCACCGAGCTGCTCATCCGGAAGCTGCCCTTCCAGCGGCTGGTACGCGAGATCGCGCAGGACTTTAAGACGGACCTGCGCTTCCAGAGCTCGGCCGTGATGGCGCTGCAGGAGGCCAGCGAGGCCTACCTGGTGGGCCTCTTCGAGGACACCAATCTGTGCGCCATCCACGCCAAGAGGGTCACCATCATGCCTAAGGACATCCAGCTGGCCCGCCGCATCCGTGGAGAGCGGGCT -3′ (SEQ ID NO:4); H3-K23R: 5′-ATGGCCCGTACTAAGCAGACTGCTCGCAAGTCGACCGGCGGCAAGGCCCCGAGGAAGCAGCTGGCCACCCGTGCGGCCCGCAAGAGCGCGCCGGCCACGGGCGGGGTGAAGAAGCCGCACCGCTACCGGCCCGGCACCGTAGCCCTGCGGGAGATCCGGCGCTACCAGAAGTCCACCGAGCTGCTCATCCGGAAGCTGCCCTTCCAGCGGCTGGTACGCGAGATCGCGCAGGACTTTAAGACGGACCTGCGCTTCCAGAGCTCGGCCGTGATGGCGCTGCAGGAGGCCAGCGAGGCCTACCTGGTGGGCCTCTTCGAGGACACCAATCTGTGCGCCATCCACGCCAAGAGGGTCACCATCATGCCTAAGGACATCCAGCTGGCCCGCCGCATCCGTGGAGAGCGGGCT -3′ (SEQ ID NO:5).

[0059] Overexpress exogenous H3-WT or H3-K23R in PANC-1 sh-H3 #1 transfected cells. The lentivirus packaging and transfection processes are the same as above.

[0060] The transfection effect was verified by Western blotting experiments, such as... Figure 9 As shown, the overexpression effect was good, and the H3K23la level in the H3-WT group was significantly higher than that in the H3-K23R group.

[0061] Example 5 In vitro experiments to verify the effect of H3K23la expression level on the proliferation and migration of pancreatic ductal adenocarcinoma cells. 1. CCK-8 assay for cell proliferation capacity After digestion and collection of transfected cells from each group, the cell density was adjusted to be consistent across groups and seeded into 96-well plates with 5000 cells per well, in triplicate. The plates were gently tapped to ensure even cell distribution. At 0h, 24h, 48h, and 72h after complete cell adhesion, basal medium containing 10% CCK-8 reagent was added to each well. The plates were gently tapped, and the plates were incubated for 2 hours. The absorbance at 450nm was then measured using a microplate reader. The data were analyzed and a line graph was plotted.

[0062] like Figure 10 As shown, cells transfected with sh-H3 #1+OE-H3K23R showed significantly reduced growth and proliferation compared to the group transfected with sh-H3 #1+OE-H3-WT, suggesting that inhibiting H3K23la expression is beneficial in suppressing the proliferation of pancreatic cancer cells.

[0063] 2. Edu method for detecting cell proliferation capacity After digestion and collection of transfected cells, the cell density was adjusted to a uniform concentration and seeded into 6-well plates. Cells were cultured overnight and allowed to recover to normal conditions. EdU working solution was added, and the cells were cultured for another 1.5 hours. After EdU labeling, the culture medium was removed, and 1 ml of fixative was added, incubating at room temperature for 15 minutes. The fixative was removed, and each well was washed three times with 1 ml of washing buffer for 3-5 minutes each time. The washing buffer was removed, and each well was incubated with 1 ml of permeabilization buffer for 10-15 minutes at room temperature. The permeabilization buffer was removed, and each well was washed 1-2 times with 1 ml of washing buffer for 3-5 minutes each time. The washing buffer was removed, and the prepared Click reaction solution was added, incubating at room temperature in the dark for 30 minutes. After removing the Click reaction solution, the cells were washed three times with washing buffer for 3-5 minutes each time. After removing the washing buffer, an appropriate amount of 1× Hoechst 33342 solution was added to each well, incubating at room temperature in the dark for 10 minutes. Remove the Hoechst 33342 solution, wash each well with 1 ml of washing buffer 1-2 times, 3-5 minutes each time, then discard the washing buffer and proceed with fluorescence detection.

[0064] like Figure 11As shown, cells transfected with sh-H3 #1+OE-H3K23R showed significantly reduced growth and proliferation compared to the group transfected with sh-H3 #1+OE-H3-WT, suggesting that inhibiting H3K23la expression is beneficial in suppressing the proliferation of pancreatic cancer cells.

[0065] 3. Transwell assay for cell migration ability Once the cell density reached 90%, the cells were digested and centrifuged. The cell pellet was collected, and the cell concentration was calculated using a cell counting chamber. Transwell chambers were then placed into 24-well plates containing 600 μl of complete culture medium. Two × 10⁶ cells were seeded per well in each upper chamber. 4 Cells were cultured for 48 hours, then the chambers were removed and washed with PBS. The cells were fixed with 4% paraformaldehyde for 30 minutes, followed by crystal violet staining for 30 minutes. After gentle shaking, the migration of stained cells was observed.

[0066] like Figure 12 As shown, cells transfected with sh-H3 #1+OE-H3K23R showed significantly reduced invasiveness compared to the group transfected with sh-H3 #1+OE-H3-WT, suggesting that inhibiting H3K23la expression suppresses the migration ability of pancreatic cancer cells.

[0067] 4. Scratch assay to detect cell migration ability Once the cell density reached 90%, the cells were digested and centrifuged. The cell pellet was collected, and the cell concentration was calculated using a cell counting chamber. Two milliliters of incubation medium containing 2 million cells were added to each well of a 6-well plate. When the cell density reached 70%–80%, three straight lines were drawn on the bottom of the vertical plate using the tip of a 100 μl pipette. The scratches were photographed under a microscope at time 0 hours, and then again at 24 hours, 48 ​​hours, and 72 hours to observe the healing process.

[0068] like Figure 13 As shown, cells transfected with sh-H3 #1+OE-H3K23R showed significantly reduced invasiveness compared to the group transfected with sh-H3 #1+OE-H3-WT, suggesting that inhibiting H3K23la expression suppresses the migration ability of pancreatic cancer cells.

[0069] The above description is only a preferred embodiment of the present invention. It should be noted that for those skilled in the art, several improvements and modifications can be made without departing from the principle of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.

Claims

1. The application of lactated histone H3 as a target in the preparation of a diagnostic kit for pancreatic ductal adenocarcinoma, wherein the lactation modification site of the lactated histone H3 is lysine 23.

2. The application of a reagent for detecting lactated histone H3 in the preparation of a diagnostic kit for pancreatic ductal adenocarcinoma, wherein the lactation modification site of the lactated histone H3 is lysine 23.

3. The application according to claim 1 or 2, characterized in that, The pancreatic ductal adenocarcinoma includes carcinoma in situ and / or metastatic tumors.

4. The application according to claim 1 or 2, characterized in that, The cell line types of pancreatic ductal adenocarcinoma include at least one of the following: PANC-1, BxPC-3, and CFPAC-1.

5. The application according to claim 2, characterized in that, The reagents for detecting lactated histone H3 include antibodies against lactated histone H3 and / or reagents for mass spectrometry detection.

6. The use of an agent that inhibits histone H3 lactation in the preparation of drugs for the prevention and / or treatment of pancreatic ductal adenocarcinoma.

7. The application according to claim 6, characterized in that, The reagents for inhibiting histone H3 lactation include at least one of the following: antibodies against lactated histone H3, reagents for knocking out or knocking down lactated histone H3, histone H3 mutants with lactation modification sites mutated, lactation-modifying enzyme inhibitors, lactate inhibitors, and histone delactase agonists.

8. The application according to claim 7, characterized in that, The lactation modification site mutation of histone H3 is a protein mutant formed by mutating lysine at position 23 of histone H3 to another amino acid.

9. The application according to claim 8, characterized in that, The histone H3 mutant with the lactation modification site mutation is a histone H3 mutant with 23 lysine replaced by arginine.

10. The application according to any one of claims 6 to 9, characterized in that, The prevention and / or treatment of pancreatic ductal adenocarcinoma includes inhibiting the growth and / or migration of pancreatic ductal adenocarcinoma.

Citation Information

Patent Citations

  • Product for diagnosis, treatment and prognosis prediction of pancreatic ductal adenocarcinoma and application thereof

    CN117838867A

  • Application of lactyltransferase inhibitor in pancreatic cancer and immunotherapy thereof

    CN119679939A

  • Application of histone lactylation modification as target spot in preparation of medicine for preventing or treating chronic obstructive pulmonary disease

    CN119746079A

  • Nucleic Acid-Derivatized Therapeutics

    US20240000949A1

Cited By

  • Application of K224 lactic acid modification of HNRNPF as target spot in preparation of products for diagnosing and / or treating pancreatic cancer

    CN121856553A

  • Application of K224 lactation modification of HNRNPF as a target in the preparation of products for the diagnosis and / or treatment of pancreatic cancer.

    CN121856553B