Milk cow early embryo sex identification method

By culturing single embryos in single microdroplets and collecting blastocyst fluid, the bull Y chromosome-specific repetitive sequence ChrY was amplified, solving the problems of large sample requirements and high risk of damage in existing embryo sex identification technologies, and achieving efficient and accurate early embryo sex identification in dairy cows.

CN121826129APending Publication Date: 2026-04-10JIANGSU ACAD OF AGRI SCI +1
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202610303075.X
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2026-03-13
Publication Date
2026-04-10

AI Technical Summary

Technical Problem

Existing methods for early sex determination of dairy cow embryos require a large number of samples, are complex to operate, and may damage the embryos, affecting their developmental potential. They also have high technical requirements.

Method used

Single embryo culture with a single microdroplet was used. The blastocyst fluid was collected and amplified to obtain the bull Y chromosome-specific repetitive sequence ChrY. The blastocyst fluid was released by puncturing the blastocyst using a laser membrane rupture instrument. A high copy number of ChrY fragment was used as a template for PCR identification, avoiding direct damage to the embryo.

Benefits of technology

It enables non-invasive and simple embryo sex determination, improving the accuracy and sensitivity of the identification. It can be performed by ordinary technicians, reducing the complexity of the operation and the risk to the embryo.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121826129A_ABST
    Figure CN121826129A_ABST
Patent Text Reader

Abstract

The invention discloses a dairy cow early embryo sex identification method, and belongs to the technical field of dairy cow breeding and breeding. The identification method comprises the following steps: (1) culturing a dairy cow embryo to an early blastocyst stage, starting to perform single-embryo single-droplet culture, and after culturing until a blastocyst cavity is formed, punching a blastocyst zona pellucida to promote the blastocyst to shrink and release blastocyst cavity liquid; (2) collecting blastocyst cavity liquid, and extracting embryo free DNA in the blastocyst cavity liquid; (3) by taking the free DNA as a template, designing a primer to amplify a specific repetitive sequence ChrY fragment of the bull Y chromosome; if the amplification product exists, the embryo is identified as a bull, and if the amplification product does not exist, the embryo is identified as a cow. The method can ensure that the embryo free DNA in the obtained blastocyst cavity fluid is only derived from the embryo, and can effectively avoid embryo injury. According to the method disclosed by the invention, the copy number of the amplified target area in the bull Y chromosome is more than 2000 times, a detection signal can be amplified, and the detection accuracy is improved.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of dairy cattle breeding technology, specifically to a method for sex determination in early dairy cattle embryos. Background Technology

[0002] Modern dairy cattle breeding relies on embryo transfer technology. Early embryo sex determination and planned embryo transfer according to sex help farms plan herd structure, feeding resources, and sales strategies in advance. Transferring embryos from genetically superior cows (donors) into ordinary recipient cows for early embryo sex determination efficiently propagates superior breeding cows, reduces the number of male calves, lowers dairy farm breeding costs, and avoids resource waste.

[0003] PCR-based early embryo sex determination is currently a relatively mature method for sex determination. It generally utilizes a specific DNA fragment from the male animal's Y chromosome or a sex-determining gene fragment on the Y chromosome for sex detection. Embryos that show a detectable target band via PCR are male, while those that do not show a band are female. Commonly used Y chromosome-specific genes include sex-determining gene fragments such as SRY. These fragments are single-copy and require a large amount of genomic DNA as a template for PCR detection.

[0004] Traditional embryo sex biopsy involves microsurgically dissecting several trophoblast cells, lysing them, and obtaining the embryo's genomic DNA. While this method is effective in identifying embryo sex, it damages the embryo, affecting its developmental potential and posing a certain risk to subsequent implantation. Furthermore, microsurgical dissection requires highly experienced and skilled technicians, making it a complex and technically demanding procedure. Summary of the Invention

[0005] The purpose of this invention is to address the aforementioned problems in the early sex determination of dairy cow embryos in the existing technology, and to provide a new method for early sex determination of dairy cow embryos that does not require a large number of samples, does not damage the embryo, is simple to operate, and can be completed by ordinary technicians.

[0006] The technical solution of this invention is as follows: This invention provides a method for sex determination in early bovine embryos, comprising the following steps: (1) When the bovine embryos are cultured to the early blastocyst stage, single embryo single droplet culture is started. After the blastocyst cavity is formed, a hole is punched in the zona pellucida of the blastocyst to induce the blastocyst to shrink and release the blastocyst cavity fluid. Conventional bovine embryo culture medium and bovine embryo culture conditions can be used for culture.

[0007] (2) Collect the blastocyst cavity fluid and extract the cell-free embryo DNA from the blastocyst cavity fluid; the blastocyst cavity fluid is released into the culture medium and collected together with the culture medium.

[0008] (3) Using cell-free DNA as a template, primers were designed to amplify the bull Y chromosome-specific repetitive sequence ChrY (GenBank: CP128563.1). If an amplification product was found, the embryo was identified as a bull; if no amplification product was found, the embryo was identified as a cow.

[0009] Optional or preferred, step (1) involves washing away the cumulus cells surrounding the fertilized egg and repeatedly washing to remove the sperm attached to the embryo. The early blastocyst stage refers to the fertilized egg being cultured until day 5. Generally, fresh embryos (i.e., fertilized eggs) can be cultured until day 5. A single embryo cultured in a single microdroplet will form a blastocoel on day 6-7.

[0010] Optionally or preferably, the microdroplets described in step (1) are prepared by using less than 10 μL of embryo culture medium on a petri dish to prepare a single embryo culture droplet, covering the surface with paraffin oil, and then equilibrating it in an incubator. Covering with paraffin oil can effectively prevent the culture medium from evaporating.

[0011] Optionally or preferably, step (1) involves transferring a single embryo into a microdroplet for culture, with each microdroplet cultured for 24-48 hours.

[0012] Optionally or preferably, the perforation in step (1) is performed using a laser film-breaking device.

[0013] Optionally or preferably, the blastocyst fluid collected in step (2) should be stored at -80°C if it is not used in time.

[0014] Optionally or preferably, the nucleotide sequence of the bull Y chromosome-specific repeat sequence ChY fragment in step (3) is shown in SEQ ID NO:1 or SEQ ID NO:2.

[0015] Optionally or preferably, step (3) uses primers for amplifying the bull Y chromosome-specific repetitive sequence ChrY, the nucleotide sequence of which is shown below: Upstream primer ChrY1-F: 5'-CGTGAACCGAAATGTGACGA-3' (SEQ ID NO:3) Downstream primer ChrY1-R: 5'-TGTCTGCATCTTGCTTGCTC-3' (SEQ ID NO:4).

[0016] Amplified fragment nucleotide sequence: 5'-cgtgaaccgaaatgtgacgagttaaccagtagcaagttgaagtcaaacagggagggccattctactctttaggctagctttgttcttcca gcacttttacctctagcatctagaggctccttgacctaaagcagtttatgaaccacccccaaatgtcagttttgatgagcaagcaagatgcagaca-3' (seq IDNO:1).

[0017] Optional or preferred, it also includes a probe, the nucleotide sequence of which is shown below: The probe ChrY1-T: 5'-TGGCCCTCCCTGTTTGACTTCAACT-3' (SEQ ID NO: 5) has a fluorescent reporter group attached to the 5' end and a fluorescent quencher group attached to the 3' end.

[0018] Optionally or preferably, step (3) uses primers for amplifying the bull Y chromosome-specific repetitive sequence ChrY, the nucleotide sequence of which is shown below: Upstream primer ChrY2-F: 5'-CGAGCACTGGCATAAGTGTT-3' (SEQ ID NO:6). Downstream primer ChrY2-R: 5'-TCTACCCTTGCTGTCCCTTG-3' (SEQ ID NO:7).

[0019] Amplified fragment nucleotide sequence: 5'-cgagcactggcataagtgttgtcaaaaacttgggtcatttattccacttgtgaagacagtgagactccgtggagtacagagtgacaccagggcatgagggaatcagcaagggacagcaagggtaga-3' (SEQ ID NO:2).

[0020] Optional or preferred, it also includes a probe, the nucleotide sequence of which is shown below: The probe ChrY2-T: 5'-CCCTCATGCCCTGGTGTCACTCT-3' (SEQ ID NO:8) has a fluorescent reporter group attached to the 5' end and a fluorescent quencher group attached to the 3' end.

[0021] Compared with the prior art, the present invention has the following beneficial effects: 1. Embryos are cultured individually, drop by drop. After the blastocoel forms, a hole is punched in the zona pellucida of the blastocyst to induce it to shrink and release blastocoel fluid. This method ensures that the cell-free embryonic DNA in the resulting blastocoel fluid originates solely from that particular embryo. During early embryonic development (especially during the transition from morula to blastocyst), a small number of cells undergo apoptosis or release DNA mixed in with the blastocoel fluid into the surrounding culture medium. These embryonic DNA fragments present in the embryo culture medium are called "cell-free embryonic DNA." Using cell-free embryonic DNA for embryo sex determination can effectively avoid embryonic damage.

[0022] 2. The method of this invention utilizes cell-free embryonic DNA as a template to amplify a specific repetitive sequence fragment of the bull Y chromosome (GenBank: CP128563.1). This repetitive region has more than 2000 copies in the bull Y chromosome, while the commonly used sex determination gene SRY has only one copy on the bull Y chromosome. Therefore, using the above-mentioned ChrY as the target gene for amplification can amplify the detection signal and improve detection accuracy.

[0023] 3. The amount of cell-free DNA released directly from the embryo into the culture medium is relatively small, while the concentration of cell-free DNA in the blastocoel fluid is relatively high. Therefore, we use a laser perforator to create pores to release the blastocoel fluid, thereby improving detection accuracy. In in vitro production of bovine embryos, we choose to collect the blastocoel fluid by perforating on days 5-7, after the blastocoel has formed, without affecting embryo development. Therefore, embryos developed to day 5 are cultured in single drops, and blastocoel-forming embryos developed to day 6-7 are perforated to release the blastocoel fluid. The embryos are then cryopreserved. This method obtains a high content of cell-free DNA without affecting embryo development. Attached Figure Description

[0024] Figure 1 This is a comparison of the results of micro-amplification of cell-free DNA from embryos using embryo culture medium and embryo culture medium containing blastocyst fluid as samples. In the figure, A represents the amplification results of 14 samples of embryo culture medium B1-B14, and B represents the amplification results of 9 samples of embryo culture medium containing blastocyst fluid W1-W9.

[0025] Figure 2 Electrophoresis diagrams of PCR amplification products using different primers and bull and cow genomes as templates are shown. Lane 1: 50 ng cow DNA; lanes 2-7 represent 50 ng, 1 ng, 100 pg, 10 pg, 5 pg, and 1 pg bull DNA, respectively; lane 8 is water. BLG, SRY, β-actin1, β-actin2, ChrY1, and ChrY2 represent amplifications performed using the corresponding primer sequences listed in Table 1.

[0026] Figure 3 The image shows the TaqMan amplification curves after TaqMan real-time quantitative PCR using different amounts of bull DNA and cow DNA as templates, based on primer and probe combinations of ChrY-1F, ChrY-1R, and ChrY-1T.

[0027] Figure 4 The image shows the TaqMan amplification curves after TaqMan real-time quantitative PCR using ChrY-2F, ChrY-2R, ChrY-2T primer-probe combinations, different amounts of bull DNA input, and cow DNA as templates.

[0028] Figure 5 Electrophoresis results of PCR to identify sex of embryo samples using different primer pairs. Detailed Implementation

[0029] To enable those skilled in the art to better understand the present application, the present application will be clearly and completely described below with reference to embodiments and accompanying drawings. Obviously, the described embodiments are only some embodiments of the present application, and not all embodiments. Based on the embodiments of the present application, all other embodiments obtained by those of ordinary skill in the art without creative effort should fall within the scope of protection of the present application. Unless otherwise specified, the instruments and reagents used in the embodiments are all from commercial channels.

[0030] Example 1: Sex determination of early bovine embryos using cell-free embryonic DNA 1. Collection of cell-free embryonic DNA samples After fertilization and culture, the cumulus cells around the embryo are washed away, and the sperm attached to the embryo are repeatedly washed away. On the 5th day of embryo culture, which is the early blastocyst stage, single embryo single droplet culture begins.

[0031] Preparation of single microdroplets: Prepare single embryo culture droplets on a petri dish with <10 μL of embryo culture medium, cover the surface with paraffin oil, and transfer the droplets into the incubator after equilibration.

[0032] Embryo culture: Embryos are transferred into microdroplets, each approximately 10 μL, and cultured for 24-48 hours. Once the embryo has developed to the blastocoel stage, a laser perforator is used to make a hole in the zona pellucida of the blastocyst. After the blastocyst shrinks and releases the blastocoel fluid, it is removed. The blastocyst can be used for further culture and development for transplantation into a cow recipient.

[0033] Droplet recovery: Embryo culture droplets containing blastocoel fluid were recovered using an enzyme-free, sterile pipette tip and stored in PCR tubes at -80°C.

[0034] Micro-amplification of cell-free embryonic DNA: Embryo culture medium collected from unpunctured zona pellucida of blastocysts and embryo culture medium containing blastocoel fluid collected after zona pellucida puncture were used as samples. Micro-amplification of cell-free embryonic DNA was performed using the Discover-scSingle Cell WGA Kit (Novizan N603) according to the manufacturer's instructions. The amplified genome was analyzed by electrophoresis on a 1% agarose gel. Results are as follows: Figure 1 The amplification effect of cell-free DNA from embryos containing blastocoel fluid ( Figure 1 (B) was significantly superior to cell-free DNA in embryo culture medium. Figure 1 The amplified bands (A) were clearer and more significant, indicating that using a laser perforator to create holes in the zona pellucida of the blastocyst, and then collecting the culture medium after the blastocyst cavity fluid is released into the culture medium as a sample, can increase the amount of DNA in the system.

[0035] 2. Primer design for bull sex determination Two primer pairs, ChrY-1 and ChrY-2, were designed targeting the bull Y chromosome-specific repetitive sequence ChrY (GenBank: CP128563.1). This repetitive region has more than 2000 copies in the bull Y chromosome, while the commonly used sex-identifying gene SRY has only one copy in the bull Y chromosome. Following TaqMan primer design principles, detection primers were designed with a Fam fluorescent reporter group added to the 5' end and a TAMRA fluorescent quencher group added to the 3' end. The specific sequences of the primers and probes are shown in Table 1 below.

[0036] Table 1 Primer and probe sequences In Table 1, ChrY-1F, ChrY-1R, ChrY-1T and ChrY-2F, ChrY-2R, ChrY-2T are the upstream, downstream, and probe primer sequences of the self-designed bovine Y chromosome-specific sex determination primers, respectively; SRY-F, SRY-R, and SRY-T are derived from publicly available primer and probe sequences; BLG-F and BLG-R are the self-designed control upstream and downstream primer sequences, respectively.

[0037] 2.1 Primer Specificity Verification 1: Conventional PCR Amplification Electrophoresis Using bull genomic DNA as a template, PCR was performed at template input amounts of 50 ng, 1 ng, 100 pg, 10 pg, 5 pg and 1 pg, with 50 ng of cow genomic DNA and water as controls.

[0038] Amplification was performed using the following mixture: 10 μL of 2 × Taq Plus Master Mix (Dye Plus), 1 μL each of upstream and downstream primers, 1 μL of DNA template, and water to a final volume of 20 μL.

[0039] The PCR amplification program was as follows: 95℃ for 3 min pre-denaturation, 95℃ for 20 s, 60℃ for 30 s, 72℃ for 30 s, 35 cycles, 72℃ for 5-10 min extension, and storage at 16℃.

[0040] Take 5 μL of the amplified sample and perform detection by 1.5% agarose gel electrophoresis.

[0041] Electrophoresis results as follows Figure 2 The results showed that the sex-specific primers ChrY1 and ChrY2 effectively amplified bull genome-related sequences, while no bands were observed using cow genome samples, indicating the specificity of the primer amplification. Furthermore, the amplification results showed that the two primer pairs designed in this invention could amplify 100 pg of bull genome, while the SRY primers could only effectively amplify and identify samples with a DNA input of 1 ng or more. This demonstrates the high specificity and high sensitivity of the two primer pairs of this invention.

[0042] 2.2 Primer Specificity Verification II: TaqMan Real-Time Quantitative PCR PCR was performed on bull genomic DNA at template input amounts of 50ng, 1ng, 100pg, 10pg, 5pg and 1pg, with 50ng of cow genomic DNA and water as controls. Detection comparison experiments were conducted using primer and probe combinations ChrY1, ChrY2 and SRY.

[0043] Sample mixing was performed according to the recommended system of Animal Detection U+ Probe qPCR Super PreMix: 10 μL of 2× Animal Detection U+ Probe qPCR Super PreMix, 0.4 μL each of forward and reverse primers (10 μM), 0.4 μL of probe primers, and template volume according to the DNA gradient described above. Water was added to bring the volume to 20 μL.

[0044] The Taqman-PCR amplification program is shown in Table 2 below: Table 2 Taqman-PCR Amplification Program Following the procedure in Table 2 above, TaqMan amplification signal detection was performed. The SRY primer-probe combination detected a signal at a DNA input of 10 pg, but the Ct value was already relatively high. In contrast, the ChrY1 and ChrY2 primer-probe combinations of this invention showed a stronger signal at a 1 pg bull DNA input, demonstrating better sensitivity. A Ct value <37 indicates male; no detection indicates female.

[0045] Figure 3 and Figure 4 The TaqMan amplification curves for the ChrY1 and ChrY2 primer-probe combinations are shown in Table 3. Table 3 presents the detection results for different DNA input amounts for each primer-probe combination.

[0046] Depend on Figure 3 , Figure 4 As shown in Table 3, for different DNA input amounts, the limits of detection for the ChrY1-F, ChrY1-R, and ChrY1-T primer-probe combinations and the ChrY2-F, ChrY2-R, and ChrY2-T primer-probe combinations all reached the 1 pg level, while no signal was detected in the corresponding bovine DNA and blank control. This indicates that the detection sensitivity of the present invention is high.

[0047] Table 3. Detection results of different primer-probe combinations for different DNA input amounts. 3. Sex determination of dairy cow embryos 3.1 Sex determination of embryo samples using conventional PCR Genomic DNA was extracted from embryo samples (fertilized eggs cultured to day 5-7) obtained directly using the method described in "1. Collection of cell-free embryonic DNA samples" of this invention, and the embryos were sexed. Bull DNA and cow DNA were used as positive and negative controls, respectively.

[0048] The results are as follows Figure 5 As shown, the SRY primer detected only one embryo, while the ChrY1 primer identified five bull embryos, demonstrating a significantly better identification result than the SRY primer.

[0049] 3.2 TaqMan real-time quantitative PCR for sex determination using cell-free embryonic DNA as a sample Using the ChrY1 primer-probe combination and the SRY primer-probe combination, embryo culture drops containing blastocyst fluid corresponding to the embryos identified in 3.1 (3 males and 3 females) were selected as samples for sex determination. The TaqMan real-time quantitative PCR system and procedure were as described in "2.2 Primer Specificity Verification II: TaqMan Real-Time Quantitative PCR" in Example 1, and the results are shown in Table 4.

[0050] Table 4. Statistical analysis of sex determination results using cell-free embryonic DNA The results showed that the ChrY1 probe primer could effectively detect male bull embryos, while SRY could not be detected.

[0051] This article uses specific examples to illustrate the inventive concept in detail. The description of the above embodiments is only for the purpose of helping to understand the core idea of ​​the present invention. It should be noted that any obvious modifications, equivalent substitutions or other improvements made by those skilled in the art without departing from the inventive concept should be included within the protection scope of the present invention.

Claims

1. A method for early embryonic sexing of dairy cattle, characterized by, Includes the following steps: (1) When the dairy cow embryos are cultured to the early blastocyst stage, single embryo single droplet culture is started. After the blastocyst cavity is formed, a hole is punched in the zona pellucida of the blastocyst to cause the blastocyst to shrink and release the blastocyst cavity fluid. (2) Collect blastocyst fluid and extract cell-free embryonic DNA from the blastocyst fluid; (3) Using cell-free DNA as a template, primers were designed to amplify the bull Y chromosome-specific repeat sequence ChrY fragment; if an amplification product was found, the embryo was identified as a bull, and if no amplification product was found, the embryo was identified as a cow.

2. The method of claim 1, wherein, Step (1) The cow embryo is obtained by washing away the cumulus cells around the fertilized egg and repeatedly washing to remove the sperm attached to the embryo. The early blastocyst stage refers to the fertilized egg cultured to day 5.

3. The method of claim 1, wherein, The microdroplets mentioned in step (1) are prepared by preparing a single embryo culture droplet on a petri dish with less than 10 μL of embryo culture medium, covering the surface with paraffin oil, and then equilibrating in an incubator.

4. The method of claim 3, wherein, The process involves transferring individual embryos into microdroplets for culture, with each microdroplet cultured for 24-48 hours.

5. The method of claim 1, wherein, The drilling in step (1) is performed using a laser film-breaking instrument.

6. The method of claim 1, wherein, Step (3) The nucleotide sequence of the bull Y chromosome-specific repeat sequence ChrY fragment is shown in SEQ ID NO:1 or SEQ ID NO:

2.

7. The method of claim 1, wherein, Step (3) uses primers to amplify the bull Y chromosome-specific repetitive sequence ChrY, the nucleotide sequence of which is shown below: Upstream primer ChrY1-F: 5'-CGTGAACCGAAATGTGACGA-3', Downstream primer ChrY1-R: 5'-TGTCTGCATCTTGCTTGCTC-3'.

8. The method of claim 7, wherein, It also includes probes, the nucleotide sequences of which are shown below: The probe ChrY1-T is 5'-TGGCCCTCCCTGTTTGACTTCAACT-3', with a fluorescent reporter group attached to the 5' end and a fluorescent quencher group attached to the 3' end.

9. The method of claim 1, wherein, Step (3) uses primers to amplify the bull Y chromosome-specific repetitive sequence ChrY, the nucleotide sequence of which is shown below: Upstream primer ChrY2-F: 5'-CGAGCACTGGCATAAGTGTT-3', Downstream primer ChrY2-R: 5'-TCTACCCTTGCTGTCCCTTG-3'.

10. The method of claim 9, wherein, It also includes probes, the nucleotide sequences of which are shown below: The probe ChrY2-T is 5'-CCCTCATGCCCTGGTGTCACTCT-3', with a fluorescent reporter group attached to the 5' end and a fluorescent quencher group attached to the 3' end.

Citation Information

Patent Citations

  • Bull sex determining gene specific primer, molecular marker, kit and application

    CN118086482A

  • Idiosyncratic primer of repetitive sequence in gamma chromosome of oxen, and PRC method for identifying sex in early embryos of oxen

    CN1696310A