Escherichia coli recombinant bacterium capable of producing hydroxytyrosol at high yield as well as construction method and application of escherichia coli recombinant bacterium
By constructing a recombinant Escherichia coli strain that produces high levels of hydroxytyrosol, and by optimizing fermentation conditions through gene knockout and the introduction of mutants, the problem of limited hydroxytyrosol synthesis capacity in Escherichia coli strains was solved, thus achieving efficient hydroxytyrosol production.
Patent Information
- Application Number
- CN202610021633.3
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Priority Date
- 2025-12-26
- Filing Date
- 2026-01-08
- Publication Date
- 2026-04-14
AI Technical Summary
Existing E. coli strains have limited hydroxytyrosol synthesis capacity during fermentation, which cannot be further increased, and there is also the problem of hydroxytyrosol toxicity to cells, affecting yield.
A high-yielding recombinant Escherichia coli strain was constructed by knocking out key genes ptsG, crr, pheA, and tyrB, introducing aroGfbr and tyrAfbr mutants, enhancing ARO10 gene expression, and overexpressing HpaBC, ADH6, and ARO10 enzymes to optimize fermentation conditions and improve hydroxytyrosol synthesis.
The accumulation of 9.2 g/L hydroxytyrosol within 48 hours enabled low-cost and efficient industrial production, laying the foundation for the industrial production of hydroxytyrosol.
Smart Images

Figure CN121852302A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of synthetic biology, specifically relating to a recombinant Escherichia coli strain that produces high levels of hydroxytyrosol, its construction method, and its applications. Background Technology
[0002] Hydroxytyrosol is a simple amphiphilic phenol with the molecular formula C8H. 10 O3, density 1.3 g / cm³ 3 Hydroxytyrosol has a relative molecular weight of 154.14. It exhibits specific solubility in water and polar organic solvents, and is composed of catechol groups and ethanol side chains, primarily found in olives. Hydroxytyrosol is not only found in olive plants but also in olive oil, olive pomace, olive mill wastewater, and wine. Among these sources, edible olives stand out as the primary source of hydroxytyrosol.
[0003] Hydroxytyrosol is a natural phenolic compound abundant in olives, possessing a variety of important functions. Its antioxidant capacity is extremely strong, capable of scavenging free radicals, delaying cell aging, inhibiting inflammatory factors, and alleviating chronic inflammation. In cardiovascular protection, it can reduce the oxidation of bad cholesterol, decrease atherosclerosis, improve vascular function, and lower the risk of thrombosis and hypertension. It can also cross the blood-brain barrier, protecting nerve cells and potentially offering benefits for neurodegenerative diseases. Furthermore, it can inhibit various bacteria and viruses; when added to skincare products, it can combat photoaging and improve skin texture. It may also help protect the liver and regulate metabolism, making it widely used in health supplements, pharmaceuticals, and the food industry.
[0004] Currently, most reported pathways in *E. coli* involve a four-step reaction using tyrosine as a substrate to produce hydroxytyrosol. The intermediate metabolite 4-hydroxyphenylpyruvic acid in the shikimic acid pathway theoretically produces hydroxytyrosol in three steps, representing the shortest route for hydroxytyrosol production in *E. coli*. However, while existing *E. coli* strains (e.g., strain CN118685381A) can achieve high yields, the synthesis capacity is limited as the fermentation cycle lengthens due to the toxicity of hydroxytyrosol to cells and its accumulation in the later stages. Therefore, further improving the production intensity of hydroxytyrosol and addressing bacterial tolerance issues are hot topics in the development of industrial hydroxytyrosol fermentation technology and fermentation engineering research, and are of great significance for promoting the industrial production of hydroxytyrosol. Summary of the Invention
[0005] Purpose of the invention: The purpose of this invention is to provide a recombinant Escherichia coli strain that produces high levels of hydroxytyrosol.
[0006] The second objective of this invention is to provide a method for constructing a recombinant Escherichia coli strain that produces high levels of hydroxytyrosol.
[0007] A third objective of this invention is to provide the application of recombinant Escherichia coli that produces high levels of hydroxytyrosol.
[0008] The fourth objective of this invention is to provide a method for producing hydroxytyrosol.
[0009] Technical solution: The present invention provides a recombinant Escherichia coli strain that produces high levels of hydroxytyrosol. The recombinant strain includes an HpaBC gene fragment, an ADH6 gene fragment, and an ARO10 gene fragment. The sequence of the HpaBC gene fragment is shown in SEQ ID NO.1, the sequence of the ADH6 gene fragment is shown in SEQ ID NO.2, and the sequence of the ARO10 gene fragment is shown in SEQ ID NO.3.
[0010] The recombinant bacteria also include aroG fbr Gene fragments and tyrA fbr Gene fragment, namely aroG fbr The sequence of the gene fragment is shown in SEQ ID NO.4, wherein tyrA fbr The sequence of the gene fragment is shown in SEQ ID NO.5.
[0011] The recombinant bacteria also include those obtained by knocking out one or more of the genes pheA, ptsG, crr, tyrB, and feaB in the recombinant bacteria.
[0012] In one implementation, knocking out the key genes ptsG and crr of the phosphotransferase system reduces glucose uptake rate, decreases acetic acid accumulation, and promotes cell growth. To enhance the consumption of the precursor 4-hydroxyphenylpyruvate, the cladose mutase pheA is knocked out to block phenylalanine synthesis, and the tyrosine aminotransferase tyrB is knocked out. The mutant aroG of 3-deoxy-D-arabinohepeptulose 7-phosphate (DAHP) synthase is introduced. fbr and cladoid mutase tyrA fbr And knocking out the key gene for the competing pathway, phenylacetaldehyde dehydrogenase feaB.
[0013] A recombinant *Escherichia coli* strain that produces high levels of hydroxytyrosol, comprising either ligating an ARO10 gene fragment to a plasmid and then introducing it into a host bacterium, or integrating the ARO10 gene fragment into the genome of the host bacterium; preferably, the host bacterium's genome also includes aroG... fbr Gene fragment, tyrA fbr Gene fragments.
[0014] In one embodiment, the recombinant bacteria further includes tandem overexpression of genes encoding 3-dehydroquinic acid synthase aroB, 3-dehydroquinic acid dehydratase aroD, and dehydroshikimate reductase aroE at a neutral genomic site using the strong promoter Pj23119. Specifically, at the neutral site rph, the expression encoding transketolase tktA is enhanced using the strong promoter Pj23119, thereby enhancing E4P synthesis.
[0015] In one embodiment, the recombinant bacteria further includes enhanced expression of phosphoenolpyruvate synthase (ppsA) at the neutral site cbrB of the host bacteria using the strong promoter Pj23119. Specifically, the expression of phosphoenolpyruvate synthase (ppsA) is enhanced at the neutral site cbrB using the strong promoter Pj23119, thereby increasing the supply of PEP.
[0016] The 4-hydroxyphenylpyruvate to hydroxytyrosol synthesis pathway comprises two-component hydroxylases HpaB and HpaC, phenylpyruvate decarboxylase, and alcohol dehydrogenase. The encoding genes for the hydroxylase HpaBC are the Rhodococcus Rrh_HpaB gene and the Escherichia coli Eco_HpaC gene, respectively. The phenylpyruvate decarboxylase and alcohol dehydrogenase are derived from the ARO10 and ADH6 genes of Saccharomyces cerevisiae.
[0017] Among them, the aroG mutant aroG fbr The tyrA mutant is a mutant in which aspartic acid at position 146 is replaced with asparagine. fbr A mutant in which isoleucine is replaced at position 53 and alanine is replaced at position 354.
[0018] This invention provides a method for constructing the recombinant Escherichia coli strain with high hydroxytyrosol production, comprising the following steps:
[0019] (a) The recombinant bacteria are obtained by recombining the HpaBC gene fragment, the ADH6 gene fragment and the ARO10 gene fragment, introducing them into a vector and expressing them in a host bacterium;
[0020] and / or (b) will aroG fbr Gene fragments and tyrA fbr The gene fragment was recombinated and then introduced into a vector, which was then introduced into the recombinant bacteria obtained in (a).
[0021] And / or (c) the recombinant bacteria obtained in (b) are obtained by knocking out one or more of the genes pheA, ptsG, crr, and tyrB;
[0022] and / or (d) will aroG fbr Gene fragment, tyrA fbrThe gene fragment and the ARO10 gene fragment are recombined, introduced into a vector, and then introduced into a host bacterium to obtain the product; preferably, the host bacterium is a strain in which one or more of the genes pheA, ptsG, crr, and tyrB have been knocked out.
[0023] And / or (e) use the strong promoter Pj23119 on the aroB-DE gene cluster of the recombinant bacteria described in (a) or (b) or (c) or (d).
[0024] The carrier includes pACYCDuet-1, pETDuet-1, pRSFDuet-1, or pCDFDuet-1.
[0025] This invention provides the application of the aforementioned recombinant Escherichia coli in the fermentation preparation of hydroxytyrosol or products containing hydroxytyrosol.
[0026] This invention provides a method for producing hydroxytyrosol. The method includes: fermenting the recombinant bacteria in a fermentation medium at 30-37°C, controlling the glucose concentration at 2-5 g / L and the pH at 6.70-6.75 during fermentation. Preferably, the fermentation medium consists of 25 g / L glucose, 7.5 g / L (NH4)2SO4, 3 g / L K2HPO4·3H2O, 2 g / L KH2PO4, 2.0 g / L MgSO4·7H2O, 1.0 g / L citric acid, 1.0 g / L tyrosine, 1 g / L thiamine hydrochloride, 7 g / L yeast extract, and 1 mL / L trace element nutrient solution. Pure ammonia is used to maintain the pH of the fermentation broth at approximately 6.75. The trace element nutrient solution contains: 5 g / L ZnSO4·7H2O, 1.2 g / L MnCl2·4H2O, and 0.5 g / L anhydrous CuSO4. g / L, CoCl2·6H2O 1.5g / L, Na2MoO4·2H2O 0.48 g / L, CaCl2·2H2O 3.0 g / L, FeSO4·7H2O 3.5 g / L, Al2(SO4)3·18H2O 12 g / L, H3BO3 0.125 g / L.
[0027] In one embodiment, the method involves fermenting the *Escherichia coli* in a fermentation medium at 30–37°C for at least 48 hours.
[0028] In one embodiment, the carbon source of the fermentation medium includes, but is not limited to, glucose.
[0029] In one implementation, the fermentation time is 48 hours.
[0030] In one embodiment, glucose is added during fermentation to maintain a glucose concentration of 2-5 g / L and a pH value of 6.70 in the fermentation broth.
[0031] In one implementation, a 50% ammonia solution is used to adjust the pH.
[0032] In one embodiment, the fermentation temperature is 37°C during the initial fermentation stage. The fermentation process is first controlled at a rotation speed of 200-600 rpm, and 3 vvm of air is introduced. After about 10 hours of fermentation, the temperature is changed to 30°C until the end of fermentation. After cooling and stabilizing for half an hour, the inducing agent IPTG is added, and then the rotation speed is reduced to 300-400 r / min.
[0033] This invention uses phenylalanine-producing *Escherichia coli* as the starting strain to construct a three-step synthetic pathway from 4-hydroxyphenylpyruvate to hydroxytyrosol, and enhances the expression of phenylpyruvate decarboxylase in this pathway. Simultaneously, the phosphotransferase system genes ptsG and crr, the clade acid mutase gene pheA, and the phenylacetaldehyde dehydrogenase gene feaB are knocked out. Shikimate pathway-related genes and the phosphoenolpyruvate synthase gene ppsA are overexpressed, and the feedback-resistant 3-deoxy-7-phosphohepenoate synthase mutant aroG is enhanced. fbr and the cladoid mutase mutant tyrA fbr And the expression of phenylpyruvate decarboxylase ARO10.
[0034] Beneficial effects: Compared with the prior art, the present invention has the following significant advantages: The present invention provides a high-yielding Escherichia coli strain, its construction method and application; the present invention verifies that a new hydroxylase combination can be used to produce hydroxytyrosol, and determines the key role of phenylpyruvate decarboxylase in the conversion process from 4-hydroxyphenylpyruvate to hydroxytyrosol; the Escherichia coli strain constructed by the present invention can accumulate 9.2 g / L hydroxytyrosol in 48 h, laying the foundation for low-cost and efficient industrial production of hydroxytyrosol, and has broad application prospects. Attached Figure Description
[0035] Figure 1 This is a metabolic flowchart of hydroxytyrosol synthesis in Escherichia coli.
[0036] Figure 2 The image shows the purification results of Rrh_hpaB protein. Lane M: Protein Marker, Lane 1: Rrh_HpaB supernatant, Lane 2: Rrh_HpaB precipitate, Lanes 3, 4, 5, and 6: Rrh_HpaB target protein.
[0037] Figure 3The graph shows the fermentation process of recombinant Escherichia coli HT16 in a 5L fermenter over 48 hours. Detailed Implementation
[0038] The technical solution of the present invention will be further described below with reference to the accompanying drawings. It should be noted that, for those skilled in the art, several modifications and improvements can be made without departing from the principle of the present invention, and these should also be considered to fall within the protection scope of the present invention.
[0039] (I) As used in this invention, the term "vector" refers to a DNA or RNA molecule containing gene expression units and used as a medium for transferring recombinant genetic material into a host cell. The main types of vectors include plasmids, bacteriophages, viruses, sticky plasmids, and artificial chromosomes. The vector itself typically consists of an insert (a heterologous nucleic acid sequence, a transgene) and a larger sequence serving as the vector's "backbone"; optionally, the vector backbone is derived from the pRSFDuet plasmid or the pETDuet-1 plasmid; optionally, the gene-editing vector also contains nucleic acids for recognizing the integration site of the expression unit, including but not limited to upstream and downstream homologous arm sequences at the integration site. In this invention, the aroG mutant replaces aspartic acid at position 146 with asparagine. In this invention, the tyrA mutant replaces methionine at position 53 with isoleucine and alanine at position 354 with valine.
[0040] (ii) Culture medium
[0041] Seed culture medium (LB): 10 g / L peptone, 5 g / L yeast extract, 5 g / L sodium chloride; solid culture medium with 2% (w / w) agar powder added.
[0042] Fermentation medium: glucose 25 g / L, (NH4)2SO4 2.5 g / L, K2HPO4·3H2O 3 g / L, KH2PO4 2 g / L, MgSO4·7H2O 2.5 g / L, sodium citrate 1.0 g / L, thiamine hydrochloride 0.1 g / L, yeast extract 7 g / L, vitamin C 0.45 g / L, and trace element nutrient solution 1 mL / L. Use pure ammonia to maintain the pH of the fermentation broth at approximately 6.75, and add appropriate amounts of antibiotics as needed. Unless otherwise specified, adjust the initial pH of the fermentation medium to 6.75 using ammonia. Micronutrient solution: ZnSO4·7H2O 5g / L, MnCl2·4H2O 1.2 g / L, anhydrous CuSO4 0.5 g / L, CoCl2·6H2O 1.5 g / L, Na2MoO4·2H2O 0.48 g / L, CaCl2·2H2O 3.0 g / L, FeSO4·7H2O 3.5 g / L, Al2(SO4)3·18H2O 12 g / L, H3BO3 0.125 g / L. Dissolve the solution in ammonia and adjust the pH to 7.0.
[0043] (III) Detection Methods
[0044] Detection of hydroxytyrosol: After the microbial fermentation was completed, the mixture was centrifuged at 12000 r / min for 10 min. The supernatant was then filtered through a 0.22 μm organic phase filter membrane and the product was detected using a Shimadzu LC-2030 high performance liquid chromatograph.
[0045] HPLC determination of hydroxytyrosol: Chromatographic separation was performed using a C18 column (4.6 mm × 250 mm, 5 μm); the column oven temperature was set to 28 °C; the injection volume was 10 μL; the mobile phases were: phase A was ultrapure water (with 1% formic acid added) and phase B was methanol; the total flow rate was 1 mL / min, the ratio of mobile phase A to B was 80%:20%, and the detector wavelength was 280 nm.
[0046] (iv) Strain information
[0047] Table 1. Strain Information
[0048]
[0049] Example 1: Construction of Synthetic Hydroxytyrosol-Containing Escherichia coli HT01
[0050] The ARO10 decarboxylase and ADH6 alcohol dehydrogenase used in this invention were both based on the genome of *Saccharomyces cerevisiae* S288C (ATCC204508) as a template, and the 4-hydroxyphenylacetic acid 3-hydroxylase reducing fraction (HpaC) was based on the genome of *Escherichia coli* BL21(DE3). The ARO10 fragment, ADH6 fragment, and HpaC fragment were amplified using primers ARO10-f / ARO10-r, ADH6-f / ADH6-r, and HpaC-f / HpaC-r, respectively. The primer sequences are shown in Table 2.
[0051] Table 2 Primers and Sequences Primer Sequence (5’→3’) ARO10-f tataagaaggagatatacatatggcacctgttacaattgaaaagttcgt ARO10-r ggtatatctccttctattttttatttcttttaagtgccgctgcttcaa ADH6-f acttaaaagaaataaaaaatagaaggagatataccatgtcttatcctgagaaatttgaaggtatcg ADH6-r tattgctcagcggtggcagcagcctaggttaactagtctgaaaattctttgtcgtagccga HpaBC-f tttgtttaactttaataaggagatataccatgggcatgaccaccaccgaaccgc HpaBC-r gaatttaccatcacgcatggtatatctccttttaaatcgcagcttccatttccagcatca hpaC-f cgcagcaggaggttaagatg hpaC-R cgcagcaggaggttaagatg <![CDATA[aroG fbr -f]]> aaggagatataccatgggcatgaattatcagaacgacgatttacgcatc <![CDATA[aroG fbr -r]]> gtatatctccttttacccgcgacgcgcttttactgcattcgcca tyrA-f taaaaggagatataccatggttgctgaattgaccg tyrA-r cggccgcaagcttttattactggcgattgtcattcg 53MtyrAI-f cggagcgcgaggcatctattttggc 53MtyrAI-r aaatagatgcctcgcgctccggaacataa 354AtyrAV-f tggttcggcgattacgttcagcg 354AtyrAV-r tgaacgtaatcgccgaaccagtgctccac pET-f ggtatatctccttcttaaagttaaacaaaattacgttctgataattcatgcccat pET-r aaaccgatcacgatatccacccgtaaaagcttgcggccgcataatgctta ptsG-up-f atcccgcgtcggtaactgtgctgatca ptsG-up-r gttcatagcaattccttacagggcggcttcacggtgatg ptsG-down-f ccgccctgtaaggaattgctatgaacgaagccgttagcccaggtgcg ptsG-down-r gctcttcagcgtgctgcccgcaa ptsG-sgRNA-f tttgcgatcggtgtcgccctgttttagagctagaaatagcaagttaaa ptsG-sgRNA-r agggcgacaccgatcgcaaaactagtattatacctactacgacta crr-up-f ctgacctattgatcatgtggtcgatccg crr-up-r gcccatcggcgccatttttat gcttccgccagcggc crr-down-f ctggcggaagcataaaaaaatggcgccgatgggcgcc crr-down-r aacaattgcacgtcatttagccaaaga crr-sgRNA-f tctggttccgacgacaagagttttagagctagaaatagcaagttaaaa crr-sgRNA-r tcttgtcgtcggaaaccagaactagtattatacctaggactgagctag pheA-up-f acggcagtctggcaacagcaattaa pheA-up-r agcaaccataataaaccttaagccacgcgagccgtcagc pheA-down-f ggcttaagaggtttatggttgctgaattgaccgcattac pheA- down -r tcatccggcactggattattactggcggttgtcattcgcc pheA-sgRNA-f tttgagcaattcattgaaaggttttagagctagaaatagcaagttaaaa pheA-sgRNA-r cttcaatgaattgctcaaaactagtattatacctaggactgagctagc cbrB-up-f ttcaaggttggcaaattcatcgagg cbrB-up-r TCTCCTCTTTCAGCTGTCGCGAGCTAGCATTATACCTAGGACTGAGCTAGCTGTCAAagttaagcgggatactttactctttgggc ppsA-cbrB-f TGCTAGCTCGCGACAGCTGAAAGAGGAAAatgtccaacaatggctcgtcaccgctg ppsA-cbrB-r gtttgatatgtctgtttcttatttcttcagttcagcttaacca cbrB-down-f actgaagaaataagaaacagacatatcaaacccttaacttacctt cbrB-down-r agtcgctcggctgttcgattcaga ylbe-sgRNA-f CACCGGCTTCTCGCAGGAGCgttttagagctagaaatagcaagttaaaat ylbe-sgRNA-r GCTCCTGCGAGAAGCCGGTGactagtattatacctaggactgagctagctg ylbe-up-f gtccttacccagccagtgccgcca ylbe-up-r TTTCTCCTCTTTCAGCTGTCGCGAGCTAGCATTATACCTAGGACTGAGCTAGCTGTCAAattggttgaggaacgcgcaatga aroB-yblE-f GCTAGCTCGCGACAGCTGAAAGAGGAGAAACTGCAGatggagaggattgtcgttactctcgggaac aroB-ylbE-R TCTCCTCTTTGTCCTCGATGACttacgctgattgacaatcggcaatggcgttaagaa aroD-f taaGTCATCGAGGACAAAGAGGAGAAATACTAGttatgcctgatgtaaaatagttaatactgtgc aroD-r TATTTCTCCTCTTTGTCCTCGATGACatgaaaaccgtaactgtaaaagatctcgtcattgg aroE-f CATCGAGGACAAAGAGGAGAAATACTAGatggaaacctatgctgtttttggtaatc aroE-r ggggttcccatgtttacatcagtggcgtcacgcgacaattcctcctgcaa ylbe-down-f ggaattgtccgcgtgacgccactgatgtaaacatgggaaccctta ylbe-down-r cagttaattgccgatctcggcgctaaac cbrB-sgRNA-f tgatgtattacccgacgtgagttttagagctagaaatagcaagtt cbrB-sgRNA-r tcacgtcgggtaatacatcaactagtattatacctaggactgagctag feaB-up-f aataatggagcaggatgagcgtc feaB-up-r tgaaatcacactgggtaaataataaggaaaagtgtcttgttcgctcataa feaB-down-f gccgttttttacttatgagcgaacaagacacttttccttattattt feaB-down-r caacagacgaatcgtgcccggat feaB-sgRNA-f gactgcttcatcccaccaaagttttagagctagaaatagcaagttaa feaB-sgRNA-r tttggtgggatgaagcagtcactagtattatacctaggactgagcta
[0052] The Rhodococcus HpaB gene fragment (Rrh_HpaB, SEQ ID NO.1) was synthesized by the company and cloned into the expression vector pET-28a via the EcoRI and HindIII restriction sites. After induction of expression and purification, it was obtained from... Figure 2 It can be seen that the protein can be expressed in a soluble manner, and the purified protein is about 60 kDa in size. Rrh_HpaB and HpaC are ligated by homologous recombination with the linker sequence cgcagcaggaggttaag, and the ligation product is used as a template to amplify the HpaBC gene fragment (its sequence is shown in SEQ ID NO.1) using primers HpaBC-f / HpaBC-r.
[0053] The double-promoter vectors pACYCDuet-1, pETDuet-1, pRSFDuet-1, and pCDFDuet-1 preserved in the laboratory (the above vectors are from the doctoral dissertation "Study on the Multi-Enzyme Cascade Conversion of L-Tyrosine to Tyrosol" by Ruan Xiaobo, Jiangnan University) were used. The ADH6 gene fragment (whose sequence is shown in SEQ ID NO.2) and the ARO10 gene fragment (whose sequence is shown in SEQ ID NO.3) were directly linked by the sequence tttgtttaactttaataaggaga to obtain the ADH6-ARO10 gene fragment. After double digestion of the above double-promoter vectors with NdeI and PacI, homologous recombination ligation was carried out. This ADH6-ARO10 gene fragment was placed behind one of the T7 promoters of the double-promoter vector to obtain plasmids pACYCDuet-ADH6-ARO10, pETDuet-ADH6-ARO10, pRSFDuet-ADH6-ARO10, and pCDFDuet-ADH6-ARO10. After double digestion of the vectors constructed above with NcoI and NotI, homologous recombination ligation was carried out with the HpaBC gene fragment, so that the HpaBC gene fragment was placed behind the other T7 promoter of the vector. The ligation method of the above fragments and vectors all used homologous recombination ligation. The homologous recombination system (6 μL) included 3 μL of 2× Hieff Clone® Universal Enzyme Premix (Yeasen Biotech), 1 μL of digested vector, and 2 μL of target gene. After mixing, it was ice-bathed for 30 min for sufficient ligation. Through the above assembly, pACYCDuet-HpaBC-ADH6-ARO10, pETDuet-HpaBC-ADH6-ARO10, pRSFDuet-HpaBC-ADH6-ARO10, and pCDFDuet-HpaBC-ADH6-ARO10 were obtained respectively. Single colonies growing on the LB resistant plate were picked and verified by colony PCR. After correct verification, they were sent for sequencing. The transformation expression hosts with correct sequences were transferred into the starting strain, the phenylalanine-producing strain Escherichia coli JNYPQ GDMCC No.62245 (from the Chinese patent application CN116656581A, a high-yield L-phenylalanine Escherichia coli and its construction method and application) to obtain strains HT1 to HT4 respectively.The activated single-colony strain was inoculated into LB medium and cultured at 220 rpm and 37℃ for 12 h to obtain seed culture. The seed culture was then transferred to fermentation medium at an inoculation rate of 2.5% for shake-flask fermentation at 220 rpm and 37℃ for about 2 h. IPTG was then added to a final concentration of 0.1 mM, and the temperature was adjusted to 30℃ for induction culture. The fermentation lasted for 48 h. The highest hydroxytyrosol yield was found in strain HT3 (pRSFDuet-HpaBC-ADH6-ARO10) at 125 mg / L, while the hydroxytyrosol yields of other strains HT1, HT2, and HT4 were 24 mg / L, 35 mg / L, and 38 mg / L, respectively.
[0054] Example 2: Relieving feedback inhibition to increase HT production
[0055] To direct more carbon flux to hydroxytyrosol production, eliminate feedback inhibition, and block competitive pathways, feedback inhibition-resistant mutants of aroG and tyrA were introduced into the HT3 strain. Using plasmid pJ01-BGA as a template (this plasmid originated from a dissertation, Gao Cong, "Regulation Methods of Carbon Metabolic Flux in Escherichia coli and Its Application in Organic Acids," Jiangnan University), primers aroG were used... fbr -F / aroG fbr -R amplification yields aroG fbr Fragment. aroG fbr The PCR system for the gene was as follows: PrimeSTAR MAX Premix (2×) 25 µL, forward and reverse primers 1.5 µL each, template 2 µL, ddH2O 20 µL. Subsequent gene PCR systems will be the same as those for aroG unless otherwise specified. fbr The system was identical. Pre-denaturation at 94℃ for 2 min, denaturation at 98℃ for 10 s, annealing at 59℃ for 5 s, extension at 72℃ for 60 s, 29 cycles, followed by a final extension at 72℃ for 2 min, yielded aroG. fbr Gene fragment. Using the *E. coli* K12 genome as a template, the tyrA fragment was amplified using primers tyrA-F / tyrA-R. aroG fbr The fragment, the tyrA fragment, and the pETDuet-1 plasmid digested with NcoI and NotI were homologously ligated to obtain pETDuet-aroG. fbr-tyrA. Referring to published literature (Tao Wei, Bi-YanCheng, Jian-Zhong Liu. Genome engineering Escherichia coli for L-DOPA overproduction from glucose. 2016, 6:30080), the anti-feedback inhibition mutant of tyrA was determined to be the replacement of isoleucine with amino acid methionine at position 53. pETDuet-aroG fbr Using the -tyrA plasmid as a template, the complete plasmid fragment was amplified using primers 53MtyrAI-f / 53MtyrAI-r. After gel recovery, the fragment was digested with Dpn I enzyme to obtain pETDuet-aroG. fbr -tyrA M53I Using this as a template, the complete plasmid fragment was amplified using primers 354AtyrAV-f / 354AtyrAV-r, and then digested to obtain pETDuet-aroG. fbr -tyrA M53IA354V That is, the plasmid pETDuet-aroG fbr -tyrA fbr The PCR process consisted of 29 cycles: 94℃ pre-denaturation for 2 min, 98℃ denaturation for 10 s, 66℃ annealing for 5 s, and 72℃ extension for 7 min. This plasmid was then transformed into the starting strain HT3 to obtain strain HT04. Shake-flask fermentation was performed under the same conditions as in Example 1. Recombinant *E. coli* HT04 accumulated 187 mg / L of hydroxytyrosol after 48 h of fermentation. This indicates that aroG fbr and tyrA fbr The introduction of this substance can significantly increase the metabolic flux of the shikimic acid pathway, thereby increasing the production of tyrosol.
[0056] Example 3: Improving HT Production by Knockout Branch Pathways
[0057] The competing pathway from 4-hydroxyphenylpyruvate was gradually deleted using CRISPR / Cas9 editing tools, and pheA was knocked out to obtain strain HT05. The specific process is as follows: Using the E. coli K12 genome as a template, the upstream and downstream fragments of the target gene were amplified using primers pheA-up-f / r and pheA-down-f / r, respectively. The reaction was pre-denatured at 94℃ for 2 min, denatured at 98℃ for 10 s, annealed at 55℃ for 5 s, extended at 72℃ for 30 s, for 29 cycles, followed by a final extension at 72℃ for 2 min. The pheA upstream and downstream fragment fusion PCR system was performed in two steps. The first step consisted of: 0.5 µL of Hieff Canace® Gold High-Fidelity DNA Polymerase (2 U / μL), 5 µL of each fragment to be fused, 25 µL of 2×Canace® Gold PCR buffer, and 14.5 µL of ddH2O. The PCR product from the first step was denatured at 94℃ for 2 min, followed by denaturation at 98℃ for 10 s, annealing at 55℃ for 30 s, and extension at 72℃ for 1 min, for 9 cycles, with a final extension at 72℃ for 5 min. Using the product as a template, a second round of PCR was performed using primer pairs pheA-up-f and pheA-down-r. The product was denatured at 94℃ for 2 min, followed by denaturation at 98℃ for 10 s, annealing at 55℃ for 5 s, and extension at 72℃ for 60 s, for 29 cycles, with a final extension at 72℃ for 2 min to obtain the upstream and downstream homologous arms of pheA. The sgRNA recognition site for the target gene was selected based on the NGG sequence score of the coding region calculated using ChopChop. Using pTargetF plasmid as a template and pheA-sgRNA-r / f as primers, reverse PCR was used to generate the targeting plasmid pTargetFΔpheA. The amplification system was the same as the gene amplification system in Example 2, with a pTargetF plasmid concentration of 2 ng / μL. amplification process of pTargetFΔpheA plasmid: 94℃ pre-denaturation for 2 min, 98℃ denaturation for 10 s, 55℃ annealing for 30 s, 72℃ extension for 210 s, 29 cycles, 72℃ extension for 2 min.
[0058] 500 ng of the knockout frame (the upstream and downstream homologous arms of pheA) and 1200 ng of pTargetFΔpheA were electroporated into the JNYPQ competent cells of the recombinant E. coli strain containing plasmid pCas9 to obtain E. coli JNPYQ ΔpheA. The cells were plated on plates containing ampicillin, zithromycin, and kanamycin resistance, and incubated overnight at 30°C. The colonies were then verified by PCR. Colonies of the correct fragment size were inoculated into LB broth and IPTG induced to eliminate plasmid pTargetFΔpheA. After eliminating the pCas9 plasmid by incubation at 42°C, pRSFDuet-HpaBC-ADH6-ARO10 and pETDuet-aroG were subsequently introduced. fbr -tyrA fbrThe plasmid was sequentially transformed into strain E. coli JNPYQ△pheA to obtain strain HT05. Strain HT05 achieved a hydroxytyrosol yield of 432 mg / L after 48 hours in a shake flask. Following the same method, the key genes ptsG and crr of the phosphotransferase system were sequentially knocked out in strain E. coli JNPYQ△pheA to obtain recombinant strains E. coli JNPYQ△pheA△ptsG and E. coli JNPYQ△pheA△ptsG, respectively. The knockout process was the same as for pheA. Specifically, the upstream and downstream homologous arms of ptsG were amplified using ptsG-up-f / r and ptsG-down-f / r, respectively; using the first-step PCR product as a template, a second round of PCR amplification was performed using primer pairs ptsG-up-f and ptsG-down-r. The targeting plasmid pTargetFΔptsG was obtained by using pTargetF plasmid as a template and ptsG-sgRNA-r / f as primers, through reverse PCR substitution. 500 ng of the knockout frame (ptsG upstream and downstream homologous arms) and 1200 ng of pTargetFΔptsG were electroporated into E. coli JNYPQΔpheA competent cells containing plasmid pCas9 to obtain E. coli JNPYQΔpheAΔptsG. The crr upstream and downstream homologous arms were amplified using crr-up-f / r and crr-down-f / r, respectively, to amplify the upstream and downstream fragments of crr. Using the first-step PCR product as a template, a second round of PCR amplification was performed using primer pairs crr-up-f and crr-down-r. The targeting plasmid pTargetFΔcrr was obtained by using pTargetF plasmid as a template and ptsG-sgRNA-r / f as primers, through reverse PCR substitution. 500 ng of the knockout frame (upstream and downstream homologous arms of the crr) and 1200 ng of pTargetFΔcrr were electroporated into competent cells of E. coli JNYPQΔpheAΔptsG containing plasmid pCas9 to obtain E. coli JNPYQΔpheAΔptsGΔcrr. Subsequently, pRSFDuet-HpaBC-ADH6-ARO10 and pETDuet-aroG were... fbr -tyrA fbr Plasmids were successively transformed into strains *E. coli* JNPYQ△pheA△ptsG and *E. coli* JNPYQ△pheA△ptsGΔcrr to obtain strains HT06 and HT07, respectively. Strains HT06 and HT07 produced 872 mg / L and 908 mg / L of hydroxytyrosol, respectively, after 48 hours in shake flasks. Strain HT08, obtained by knocking out the tyrB gene, achieved a hydroxytyrosol production of 923 mg / L after 48 hours in shake flasks.
[0059] Example 4: Enhancing the expression of the synthetic pathway gene ARO10 to increase HT production
[0060] The genes encoding the three enzymes that synthesize hydroxytyrosol from 4-hydroxyphenylpyruvate were ligated into the vector tyrA. fbr Following the gene, the effect of enhanced synthetic pathway gene expression on hydroxytyrosol was investigated. Using plasmid pRSFDuet-HpaBC-ADH6-ARO10 as a template, the ARO10 fragment, ADH6 fragment, HpaBC fragment, and pETduet vector backbone were amplified using primers ARO10-F / ARO10-R, ADH6-f / ADH6-r, HpaBC-f / HpaBC-r, and pET-f / pET-r, respectively. pETDuet-aroG was obtained through homologous recombination ligation using a method similar to that in Example 1. fbr -tyrA fbr -ARO10, pETDuet-aroG fbr -tyrA fbr -ADH6 and pETDuet-aroG fbr -tyrA fbr -HpaBC plasmid was transformed into the starting strain HT07. The same shake-flask experiment as in Example 3 was performed; after 48 h, testing revealed that only the introduction of pETDuet-aroG... fbr -tyrA fbr - The strain HT09, which overexpressed ARO10, increased the production of hydroxytyrosol to 1131 mg / L, while the strain HT09-2, which overexpressed HpaBC, produced 88 mg / L of hydroxytyrosol. The strain HT09-3, which overexpressed ADH6, produced only 762 mg / L of hydroxytyrosol, which was actually lower than the production of the HT07 strain after 48 hours.
[0061] Example 5: Enhancing the shikimic acid pathway to increase hydroxytyrosol production
[0062] Shikimic acid is an important precursor in the hydroxytyrosol biosynthesis pathway, and its supply was enhanced by overexpression at the genomic level. Using a CRISPR / Cas9 editing tool, copy number stacking of the aroB-DE gene cluster was performed at the genomic level in strain HT09 using the strong promoter Pj23119 to obtain strain HT10. Using the *E. coli* K12 genome as a template, the aroB, aroD, and aroE gene fragments were amplified using primer pairs aroB-yblE-f / r, aroD-f / r, and aroE-f / r, respectively, and the fragments were purified by gel extraction. The first step of the three-fragment fusion was performed using the following system: 0.5 µL of Hieff Canace® Gold High-Fidelity DNA Polymerase (2 U / μL), 5 µL of each of the three fragments, 25 µL of 2×Canace® Gold PCR buffer, and 9.5 µL of ddH2O. Subsequent three-fragment fusion systems were performed using the same system. The PCR product from the first step was used as a template. A second round of PCR was performed using aroB-yblE-f and aroE-r primers. The product underwent 94℃ pre-denaturation for 2 min, followed by 98℃ denaturation for 10 s, 55℃ annealing for 30 s, and 72℃ extension for 150 s, for 29 cycles, with a final extension at 72℃ for 2 min, to obtain the gene cluster aroB-DE.
[0063] Using the *E. coli* K12 genome as a template, the upstream and downstream fragments of the ylbE gene were amplified using primers ylbE-up-f / r and ylbE-down-f / r, respectively. The upstream and downstream fragments of the ylbE gene and the gene cluster aroB-DE were then subjected to a three-fragment fusion PCR: 94℃ pre-denaturation for 2 min, 98℃ denaturation for 10 s, 55℃ annealing for 30 s, 72℃ extension for 210 s, 9 cycles, followed by a 5 min extension at 72℃. Using the product from the first PCR step as a template, a second round of PCR was performed using primers ylbE-up-f and ylbE-down-r: 94℃ pre-denaturation for 2 min, 98℃ denaturation for 10 s, 55℃ annealing for 30 s, 72℃ extension for 150 s, 29 cycles, followed by a 2 min extension at 72℃, to obtain the knock-in frame of the gene cluster aroB-DE. Using ylbe-sgRNA-f / r as a primer, the target plasmid pTargetFΔylbe was generated by inverse PCR. The knock-in frame of the gene cluster aroB-DE and pTargetFΔylbe were electroporated into competent cells of the recombinant *E. coli* JNYPQΔpheAΔptsGΔcrr containing plasmid pCas9. After resistance selection and plasmid elimination, strain HT10 was obtained. Strain HT10 produced 1230 mg / L of hydroxytyrosol through shake-flask fermentation for 48 h.
[0064] In the HT10 strain, the expression of phosphoenolpyruvate synthase ppsA was enhanced by using the strong promoter Pj23119 to strengthen the cbrB gene at the neutral site, thus increasing PEP supply and obtaining strain HT11. The construction process of this ppsA gene knock-in strain is similar to that of the aroB-DE gene cluster integrated strain. The specific steps are as follows: using the *E. coli* K12 genome as a template, the upstream and downstream fragments of the cbrB gene and the ppsA gene were amplified using primer pairs cbrB-up-f / r, cbrB-down-f / r, and ppsA-cbrB-f / r, respectively. These three fragments were then fused using PCR to obtain the ppsA gene knock-in frame. Using cbrB-sgRNA-f / r as a primer, reverse PCR was used to replace the primers, generating the targeting plasmid pTargetFΔcbrB. The ppsA knock-in box and pTargetFΔcbr were electroporated into competent cells of the recombinant E. coli JNYPQ cbrB::Pj23119-aroB-DE △pheA△ptsG△crr containing plasmid pCas9. After resistance selection and plasmid elimination, strain HT11 was obtained. After shake-flask fermentation for 48 h, hydroxytyrosol was produced at 1370 mg / L.
[0065] Example 6: Fermentation of recombinant strain HT11 in a 5L fermenter
[0066] The recombinant strain HT11 was fermented in a 5L fermenter according to the following steps: frozen glycerol tube → slant activation → primary shake flask seed → secondary shake flask seed → fermenter.
[0067] (1) Slant activation: The bacterial cells in the glycerol tube were streaked onto the slant culture medium and incubated at 37 ℃ for 12h~14h.
[0068] (2) Primary shake-flask seed culture: Wash the bacterial growth off the slant culture medium with sterile water, and inoculate it at a 1% inoculum rate into a 500 mL Erlenmeyer flask containing 50 mL of LB medium. Incubate at 120 r / min and 37 ℃ for 10-12 h. OD 600 Between 4.0 and 5.0.
[0069] (3) Secondary shake flask seed culture: 1% of the primary shake flask seed was inoculated into a 500 mL Erlenmeyer flask containing 50 mL of secondary seed culture medium. The culture was carried out at 120 r / min and 37 ℃ for 6-7 h. The OD of the secondary seed culture was... 600 It was put into the tank around 4.20.
[0070] Secondary seed culture medium: 3 g / L (NH4)2SO4, 1 g / L KH2PO4, 1 g / L K2HPO4, 0.25 g / L MgSO4·7H2O, 2.5 g / L Angel FM802 yeast extract, 1 g / L citric acid, 1 mL / L metal ion solution, 100 mg / L ampicillin, 50 mg / L kanamycin, 10 g / L glucose.
[0071] (4) 5 L Dubear parallel reactor fermentation: The initial liquid volume of the fermenter was 3.0 L. The secondary seed liquid was inoculated into the fermentation medium at a rate of 3% (volume ratio) of the total volume. The temperature was 37℃, and the initial aeration rate was 3 vvm. During fermentation, ammonia water was added to control the pH at around 6.75 and the dissolved oxygen was controlled to be no less than 30%. After 12 h of fermentation, the temperature was changed to 30℃. After stabilizing for half an hour, IPTG with a final concentration of 0.1 mM was added. A batch sugar addition method was used to control the residual sugar at 2~5 g / L. Samples were taken every 6 h, and the pH, OD value, glucose content and fermentation product content of each sample were tested. The results showed that the yield of hydroxytyrosol could reach 9.2 g / L after 48 h of fermentation, and the conversion rate and production intensity reached 8.5% and 0.19 g / L / h, respectively.
[0072] SEQ ID NO.1: HpaBC gene fragment
[0073] ATGACCACCACCGAACCGCGTCCGACCGAAACCGTTGACCGTTCTAAAGT
[0074] TAACGTTGCTGCTGACCACCCGGCTAACCAGCAGAAAAACTTCGCTTCTC
[0075] GTCCGATGACCGGTGACGAATACATCGCTTCTATCGACGACGGTCGTGAA
[0076] ATCTACCTGCACGGTGAACGTGTTAAAGACTTCACCAACCACCCGGCTTT
[0077] CCGTAACTCTATCCGTATGACCGCTCGTCTGTACGACGCTCTGCACACCG
[0078] GTGAACACGTTAACACCCTGACCACCCCGACCGACACCGGTAACGGTGGT
[0079] GTTACCATGCCGTTCTTCCGTACCCCGAAATCTGCTGACGACCTGCGTGC
[0080] TGACCGTGACGCTATCGCTGCTTGGGCTCGTATGACCTACGGTTGGATGG
[0081] GTCGTTCTCCGGACTACAAAGCTTCTTTCCTGGGTACCCTGGGTGCTAAC
[0082] GACGAATTCTACTCTCCGTTCCAGGACAACGCTAAACGTTGGTACCGTGA
[0083] ATCTCAGGAAAAAGTTCTGTACTGGAACCACGCTATCATCAACCCGCCGG
[0084] TTGACCGTTCTCTGCCGCCGGACCAGGTTGGTGACGTTTTCATGAAAGTT
[0085] GAAAAAGAAACCGACGCTGGTCTGATCGTTTCTGGTGCTAAAGTTGTTGC
[0086] TACCGGTTCTGCTATCACCAACTACAACTTCATCGCTCACTACGGTCTGC
[0087] CGATCAAAAAAAAAGAATTCGCTCTGATCTGCACCGTTCCGATGGACGCT
[0088] CCGGGTATCAAACTGATCTCTCGTGCTTCTTACTCTCAGAACGCTAACGT
[0089] TGCTGGTTCTCCGTTCGACTACCCGCTGTCTTCTCGTCTGGACGAAAACG
[0090] ACGCTATCTTCATCTTCGACAAAGTTCTGGTTCCGTGGGAAAACGTTTTC
[0091] ATGTACGGTGACGTTGACAAAATCAACAACTTCCTGGGTGGTTCTGGTTT
[0092] CCTGCAGCGTTTCACCCTGCAGGGTTGCACCCGTCTGGCTGTTAAACTGG
[0093] ACTTCATCGCTGGTCTGCTGATGAAAGCTCTGGACGCTACCGGTGCTGGT
[0094] GGTTTCCGTGGTGTTCAGACCCGTGTTGGTGAAGTTATCGGTTGGCGTAA
[0095] CCTGTTCTGGTCTCTGTCTGACGCTATGGTTAACAACCCGGAACAGTGGA
[0096] TCGACGGTACCGTTATCCCGAAACTGGAATACGGTCTGACCTACCGTATG
[0097] TTCGCTATGCAGGGTTACCCGCGTATCAAAGAAATCATCGAACAGGACGT
[0098] TGCTTCTGGTCTGATCTACCTGCCGTCTTCTGCTGCTGACTTCAAAAACC
[0099] CGGACGTTCGTCCGTACCTGGACAAATACGTTCGTGGTTCTGACGGTATC
[0100] CAGGCTGTTGACCGTGTTAAAGTTATGAAAGCTCTGTGGGACTCTATCGG
[0101] TTCTGAATTCGGTGGTCGTCACGAACTGTACGAACGTAACTACGCTGGTA
[0102] ACCACGAAAACGTTAAAGCTGAACTGCTGTTCGCTGCTGAAGGTCGTGGT
[0103] GACGTTGCTTCTATGAAAGGTTTCGCTGAACAGTTCATGTCTGAATACGA
[0104] CCTGGACGGTTGGACCGTTCCGGACATGATCGGTAACTCTGACGTTTCTG
[0105] CTTTCTACAAGTAAcgcagcaggaggttaagatgcaattagatgaacaacgcctgcgctttcgtgacgcgatggccagcctgtcggcagcggtaaatattatcaccaccgagggcgacgccggacaatgcgggattacggcaacggccgtctgctcggtcacggatacaccaccgtcgctgatggtgtgcattaacgccaacagtgcgatgaacccggtttttcagggcaacggcaagttgtgcgtcaacgtcctcaaccatgagcaggaactgatggcacgccacttcgcgggcatgacaggcatggcgatggaagagcgttttagcctctcatgctggcaaaaaggtccgctggcgcagccggtgctaaaaggttcgctggccagtcttgaaggtgagatccgcgatgtgcaggcaattggcacacatctggtgtatctggtggagattaaaaacatcatcctcagtgcagaaggtcatggacttatctactttaaacgccgtttccatccggtgatgctggaaatggaagctgcgatttaa
[0106] As shown in SEQ ID NO.2: ADH6
[0107]
[0108] SEQ ID NO.3:ARO10
[0109]
[0110] SEQ ID NO.4:aroG fbr
[0111]
[0112] SEQ ID NO.5:tyrA fbr
[0113]
Claims
1. A recombinant *Escherichia coli* strain that produces high levels of hydroxytyrosol, characterized in that... The recombinant bacteria includes an HpaBC gene fragment, an ADH6 gene fragment, and an ARO10 gene fragment. The sequence of the HpaBC gene fragment is shown in SEQ ID NO.1, the sequence of the ADH6 gene fragment is shown in SEQ ID NO.2, and the sequence of the ARO10 gene fragment is shown in SEQ ID NO.
3.
2. The recombinant Escherichia coli with high hydroxytyrosol production according to claim 1, characterized in that, The recombinant bacteria also include aroG fbr Gene fragments and tyrA fbr Gene fragment, namely aroG fbr The sequence of the gene fragment is shown in SEQ ID NO.4, wherein tyrA fbr The sequence of the gene fragment is shown in SEQ ID NO.
5.
3. The recombinant Escherichia coli with high hydroxytyrosol production according to claim 1 or 2, characterized in that, The recombinant bacteria also include those obtained by knocking out one or more of the pheA, ptsG, crr, and tyrB genes in the recombinant bacteria.
4. A recombinant *Escherichia coli* strain that produces high levels of hydroxytyrosol, characterized in that... The recombinant bacteria include either ligating the ARO10 gene fragment to a plasmid and then introducing it into the host bacteria, or integrating the ARO10 gene fragment into the genome of the host bacteria; preferably, the host bacteria genome also includes aroG. fbr Gene fragment, tyrA fbr Gene fragments.
5. The recombinant Escherichia coli with high hydroxytyrosol production according to any one of claims 1 to 4, characterized in that, The recombinant bacteria also include genes for tandem overexpression of 3-dehydroquinic acid synthase aroB, 3-dehydroquinic acid dehydratase aroD, and dehydroshikimate reductase aroE at a neutral site in the genome using the strong promoter Pj23119.
6. The recombinant Escherichia coli with high hydroxytyrosol production according to any one of claims 1 to 5, characterized in that, The recombinant bacteria also include the expression of phosphoenolpyruvate synthase ppsA enhanced by the strong promoter Pj23119 at the neutral site cbrB of the host bacteria.
7. The method for constructing the recombinant Escherichia coli with high hydroxytyrosol production according to any one of claims 1 to 6, characterized in that, Includes the following steps: (a) The recombinant bacteria are obtained by recombining the HpaBC gene fragment, the ADH6 gene fragment and the ARO10 gene fragment, introducing them into a vector and expressing them in a host bacterium; and / or (b) will aroG fbr Gene fragments and tyrA fbr The gene fragment was recombinated and then introduced into a vector, which was then introduced into the recombinant bacteria obtained in (a). And / or (c) the recombinant bacteria obtained in (b) are obtained by knocking out one or more of the genes pheA, ptsG, crr, and tyrB; and / or (d) will aroG fbr Gene fragment, tyrA fbr The gene fragment and the ARO10 gene fragment are recombined, introduced into a vector, and then introduced into a host bacterium to obtain the product; preferably, the host bacterium is a strain in which one or more of the genes pheA, ptsG, crr, and tyrB have been knocked out. And / or (e) use the strong promoter Pj23119 on the aroB-DE gene cluster of the recombinant bacteria described in (a) or (b) or (c) or (d).
8. The method for constructing a recombinant Escherichia coli strain with high hydroxytyrosol production according to claim 7, characterized in that, The carrier includes pACYCDuet-1, pETDuet-1, pRSFDuet-1, or pCDFDuet-1.
9. The use of the recombinant Escherichia coli according to any one of claims 1 to 6 in the fermentation preparation of hydroxytyrosol or products containing hydroxytyrosol.
10. A method for producing hydroxytyrosol, characterized in that, The method comprises: fermenting the recombinant bacteria according to any one of claims 1 to 6 in a fermentation medium at 30-37°C, and controlling the glucose concentration at 2-5 g / L and the pH at 6.70-6.75 during fermentation. Preferably, the fermentation medium consists of: glucose 25 g / L, (NH4)2SO4 2.5 g / L, K2HPO4·3H2O 3 g / L, KH2PO4 2 g / L, MgSO4·7H2O 2.5 g / L, sodium citrate 1.0 g / L, and thiamine hydrochloride. 0.1 g / L, yeast powder 7 g / L, vitamin C 0.45 g / L, trace element nutrient solution 1 mL / L, wherein the trace element nutrient solution is: ZnSO4·7H2O 5 g / L, MnCl2·4H2O 1.2 g / L, anhydrous CuSO4 0.5 g / L, CoCl2·6H2O 1.5 g / L, Na2MoO4·2H2O 0.48 g / L, CaCl2·2H2O 3.0 g / L, FeSO4·7H2O 3.5 g / L, Al2(SO4)3·18H2O 12 g / L, H3BO3 0.125 g / L.
Citation Information
Patent Citations
Escherichia coli with high yield of L-phenylalanine as well as construction method and application of escherichia coli
CN116656581A
Recombinant escherichia coli for producing salidroside and application
CN118685381A