Brevundimonas strain and application thereof in degrading dinotefuran and improving resistance

By using the D-1 strain of shortwave monocytogenes isolated from the intestines of the fruit fly gall wasp *Gallus spp.*, the problem of fipronil pesticide residues was solved, achieving efficient degradation of fipronil and enhancing the parasitic wasp's resistance, thus providing a green and safe biological control solution.

CN122012308APending Publication Date: 2026-05-12ZHEJIANG UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202610024959.1
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Priority Date
2026-01-08
Filing Date
2026-01-09
Publication Date
2026-05-12

Smart Images

  • Figure CN122012308A_ABST
    Figure CN122012308A_ABST
Patent Text Reader

Abstract

The invention relates to an agricultural biological control technology, and aims to provide a brevundimonas strain and application thereof in degradation of dinotefuran and improvement of resistance. The brevundimonas sp. Strain is preserved in the China Center for Type Culture Collection, the preservation name is brevundimonas sp. D-1, the Latin name is Brevundimonas huaxiensis, and the preservation number is CCTCC NO: M 20252463. The brevundimonas sp. Strain has the advantages that the brevundimonas sp. Strain can be used for preparing the brevundimonas sp. The 16S rRNA gene sequence of the strain is as shown in SEQ ID NO: 1. The strain disclosed by the invention is novel in source, has functional specificity and pertinence, and shows remarkable degradation capacity on dinotefuran; the intrinsic resistance of the parasitic wasps to dinotefuran can be improved through back-supplementing the strains; microorganisms are used for degradation and biological enhancement, so that secondary pollution is avoided, and the method conforms to the development direction of modern agriculture.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the interdisciplinary field of environmental microbiology and agricultural biological control, specifically involving a novel shortwave monocytogenes strain with pesticide degradation function, and the application of this strain in the degradation of neonicotinoid insecticide fipronil. Background Technology

[0002] Neonicotinoid insecticides are among the most widely used insecticides globally. However, their high water solubility and persistence also pose a serious threat to the ecological environment and non-target organisms (especially pollinating insects and natural enemies). The first two generations of insecticides, such as imidacloprid and thiamethoxam, were banned by the EU and several other countries and organizations in 2020. Dinotefuran, as a new generation of neonicotinoid insecticides, has a different chemical structure and is safer for mammals, hence its increasingly widespread application. However, precisely because of its different chemical structure, dinotefuran exhibits significant differences in its degradation behavior and ecotoxicity in the environment.

[0003] Currently, microbial remediation technology for pesticide residues is considered a green and sustainable solution. Studies have reported that certain microorganisms can degrade other neonicotinoid insecticides; for example, patent CN112779194B discloses a strain of *Gordonella alkali-eating* for degrading imidacloprid, and patent CN116376764A discloses a strain of *Pseudomonas* capable of degrading acetamiprid. However, microbial resources with highly efficient and specific degradation capabilities for dinotefuran, especially functional strains derived from the gut of natural enemy insects, are currently rarely reported.

[0004] Fruit flies are widely distributed in nature, numerous, and diverse, causing significant damage and substantial economic losses to agricultural production, especially berry cultivation. Statistics show that approximately 90% of fruit flies in nature are parasitized by parasitic wasps. Currently, 16 genera belonging to 4 families of fruit fly parasitic wasps have been discovered and reported. Among them, the genera *Leptopilina* and *Ganaspis* of the subfamily Eucoilinae (family Figitidae) and the genus *Asobara* of the family Braconidae (family Braconidae) account for more than 20% of the total species. Parasitic wasps of the genera *L. drosophilae* and *A. japonica* are dominant parasitic natural enemies of fruit fly pests, demonstrating excellent biological control efficacy in orchards and other ecosystems: *L. drosophilae* can accurately locate and parasitize the early larvae of various fruit flies, effectively curbing their population size; while *A. japonica* excels at parasitizing mid-to-late-stage larvae, with a high parasitism rate and significant pest control effect.

[0005] However, the application of pesticides in the field severely impacts the survival of parasitic wasps and their pest control efficacy. The wasps themselves often die in large numbers due to exposure to pesticides, leading to control failure. Recent studies have shown that symbiotic bacteria in the insect gut may participate in the host's detoxification and metabolism of pesticides. Therefore, finding microbial resources that can specifically degrade specific pesticides and protect beneficial insects is crucial for achieving sustainable agricultural development. Summary of the Invention

[0006] The technical problem to be solved by the present invention is to overcome the shortcomings of the prior art and provide a shortwave monoclonal strain and its application in the degradation of fipronil.

[0007] To achieve the above objectives, the solution of the present invention is:

[0008] A strain of Brevundimonas huaxiensis is provided. This strain is deposited at the China Center for Type Culture Collection (CCTCC) under the name Brevundimonas D-1 and the Latin taxonomic name Brevundimonas huaxiensis, with accession number CCTCC NO: M20252463.

[0009] As a preferred embodiment of the present invention, the shortwave monoclonal bacteria strain was isolated from the intestinal contents of adult fruit fly gall wasps.

[0010] As a preferred embodiment of the present invention, the 16S rRNA gene sequence of the *Shortwave Monoclonal* strain is shown in SEQ ID NO: 1.

[0011] The present invention also provides a method for culturing the aforementioned shortwave monoclonal strain, which involves transferring the strain to a liquid culture medium and culturing it at 28–32°C with shaking; the liquid culture medium is LB medium or an inorganic salt medium with fipronil as the sole carbon source.

[0012] The present invention also provides the application of the aforementioned shortwave monoclonal strain in degrading fipronil or enhancing the resistance of parasitic wasps to fipronil.

[0013] The present invention further provides a microbial agent with the function of degrading fipronil, the microbial agent comprising a shortwave monocytogenes strain as the active ingredient, and an agriculturally acceptable carrier.

[0014] This invention also provides a method for using the aforementioned microbial agent. When using, the microbial agent is added to water at a dosage ratio of 1% to 5%, mixed thoroughly, and then applied by spraying to fields or forests contaminated with fipronil. The application rate is controlled at 450–750 L / hm². 2 Scope; the carrier in the microbial agent is sterile phosphate buffer, and the viable bacteria concentration is 2×10⁻⁶. 9 cfu / mL.

[0015] The present invention further provides a microbial agent that enhances parasitic wasps’ resistance to dinotefuran, the microbial agent comprising a shortwave monocytogenes strain as an active ingredient and an acceptable carrier in the parasitic wasp feed.

[0016] This invention also provides a method for using the aforementioned microbial agent. Before use, the parasitic wasps are fed a sucrose solution containing antibiotics to clear the intestinal flora for one day; then, they are fed the microbial agent for two days. The carrier in the microbial agent is sucrose solution, and the viable bacteria concentration is 2 × 10⁻⁶. 9 cfu / mL.

[0017] As a preferred embodiment of the present invention, the parasitic wasp is a parasitic wasp belonging to the genus *Gallus spp.* or *Braconidae*.

[0018] Compared with the prior art, the present invention has the following significant advantages:

[0019] 1. Novel strain source: This invention is the first to isolate a novel short-wave monoclonal bacterium D-1 from the intestine of the fruit fly *Gallus spp.*, a specific parasitic wasp, adding a new member to the microbial germplasm resource bank.

[0020] 2. Functional Specificity and Targeting: This strain exhibits significant degradation ability against fipronil. Compared with existing technologies that mainly target the first two generations of neonicotinoid insecticides (such as imidacloprid and thiamethoxam), the strain provided by this invention has outstanding degradation activity against the new generation neonicotinoid insecticide fipronil, providing a highly targeted and precise tool for solving the pesticide residue problem of fipronil.

[0021] 3. Application novelty: This invention innovatively reintroduces strains derived from specific parasitic wasps into themselves and closely related wasp species, successfully enhancing the intrinsic resistance of parasitic wasps to fipronil, and providing a brand-new "protecting wasps with bacteria" technical approach for protecting natural enemy insects, maintaining the ecological balance of farmland, and ensuring the stability of biological control.

[0022] 4. Environmental friendliness: This invention utilizes microorganisms for degradation and biofortification, which is a green, safe, and sustainable technology that avoids secondary pollution and is in line with the development direction of modern agriculture.

[0023] 5. The strain of this invention was isolated from the intestinal contents of the fruit fly *Drosophila melanogaster*. Its significant characteristic is its ability to use fipronil as a carbon source for growth, exhibiting high degradation activity and substrate specificity for this pesticide. It can not only be used to degrade fipronil but also serve as a probiotic to enhance the survival ability of parasitic wasps under pesticide stress. Therefore, this invention possesses dual application attributes compared to traditional microbial agents, which is impossible with traditional products.

[0024] 6. The discovery of the strain in this invention provides a novel approach and material basis for developing specific remediation technologies for fipronil pollution and for enhancing the drug resistance of parasitic wasps through microbial means, which has important theoretical value and application prospects. Attached Figure Description

[0025] Figure 1 This is the phylogenetic tree of shortwave monocytogenes D-1 in this invention.

[0026] Figure 2 This is a photograph of a colony of *Shortwave Monoclonalella* D-1.

[0027] Figure 3 The degradation efficiency of dinotefuran by shortwave monocytogenes D-1 in MSM medium is shown.

[0028] Figure 4 To investigate the changes in resistance of shortwave monocytogenes D-1 to the fruit fly gall midge (Ld) under dinotefuran stress.

[0029] Figure 5 To investigate the changes in resistance of shortwave monocytogenes D-1 to Japanese open-mandible brachiopod wasp (Aj) under dinotefuran stress. Detailed Implementation

[0030] The present invention will now be described in detail with reference to the accompanying drawings and embodiments, but the scope of protection of the present invention is not limited thereto.

[0031] Example 1: Isolation, Screening and Identification of Strains

[0032] 1. Strain isolation: Male and female fruit fly gall wasps were collected from a field in Taizhou City, Zhejiang Province, where neonicotinoid insecticides had been used, and were cultured and stably propagated under laboratory conditions.

[0033] Adult female Drosophila gall midges were collected, and their intestinal contents were extracted, serially diluted, and spread onto inorganic salt agar plates using 5 mg / L fipronil as the sole carbon source. The inorganic salt agar composition was: Na₂HPO₄ 1.5 g / L, KH₂PO₄ 0.5 g / L, NH₄NO₃ 1.0 g / L, MgSO₄·7H₂O 0.2 g / L, NaCl 1.0 g / L, agar 15 g / L, pH 7.0. The plates were incubated upside down at 30°C for 5-7 days.

[0034] 2. Functional Screening: Single colonies grown on the plates were picked, further purified, and inoculated into MSM liquid medium containing 5 mg / L fipronil. The culture was carried out at 30 °C and 180 rpm for 5 days with shaking. The pesticide residue was detected by high-performance liquid chromatography (HPLC), and a pesticide-degrading bacterium, named D-1, was selected.

[0035] 3. Strain Identification and Preservation: Using the genomic DNA of strain D-1 as a template, PCR amplification was performed using universal primers 27F and 1522R (as shown in SEQ ID NO: 2 and SEQ ID NO: 3, respectively) to obtain a gene sequence of approximately 1360 bp (as shown in SEQ ID NO: 1). The sequencing results were compared with the NCBI database using BLAST. The results showed that strain D-1 was most homologous to strains of the genus *Brevundimonas*, and most closely related to the type strain *Brevundimonas huaxiensis* 090558, with a gene similarity of 99.85%. A phylogenetic tree was constructed using MEGA software. Figure 1 Combining morphological characteristics ( Figure 2 The strain D-1 was initially identified as Brevundimonashuaxiensis.

[0036] SEQ ID NO: 1:

[0037] SEQ ID NO: 2: agtttgatcmtggctcag 20

[0038] SEQ ID NO: 3: aaggaggtgatccagccgca 20

[0039] The applicant deposited this strain with the China Center for Type Culture Collection (CCTCC) on November 6, 2025, in a viable state. The deposit name is *Brevundimonas huaxiensis* D-1, with the Latin taxonomic name *Brevundimonas huaxiensis*, and the accession number is CCTCC NO: M 20252463. The deposit address is the Collection Center of Wuhan University, Wuhan, Hubei Province, 430072, China; the contact number is 027-68754052.

[0040] Example 2: Determination of the in vitro degradation ability of shortwave monocytogenes D-1

[0041] To quantitatively assess the degradation ability of the strain, parallel degradation experiments were designed.

[0042] Activated shortwave monocytogenes D-1 was inoculated into LB liquid medium and cultured at 30 °C and 180 rpm until the logarithmic growth phase. The cells were collected by centrifugation, washed twice with sterile phosphate-buffered saline (PBS, pH 7.0), and then resuspended in PBS to form a D-1 bacterial suspension (OD). 600 (≈ 1.0), determined according to a proprietary standard curve, the viable bacterial concentration is approximately 2 × 10⁻⁶. 9 cfu / mL. Then, 5% (v / v) of the D-1 bacterial suspension was added to MSM liquid medium containing fipronil. The initial concentration of the agent was 5 mg / L. A control group (without inoculation, containing an equal volume of PBS buffer) was used. All treatments were incubated at 30 °C and 180 rpm in a shaker, and samples were taken at 0, 12, 24, 36, and 48 hours. Finally, the fipronil residue content in the MSM liquid medium was detected by high-performance liquid chromatography (HPLC), and the degradation rate of *Synthia spp.* D-1 was calculated by comparing the results with the control group.

[0043] Insecticide degradation rate = (Insecticide content in control group - Insecticide content in experimental group) / Insecticide content in control group × 100%.

[0044] Result: As Figure 3As shown, *Bacillus shortwave diflubenzuron* D-1 exhibits a clear degradation effect on dinotefuran. In the figure, CK represents the blank control group without inoculation with strain D-1, and D-1 represents the experimental group inoculated with *Bacillus shortwave diflubenzuron* D-1. At an initial concentration of 5 mg / L, after 48 hours of cultivation, the degradation rate of dinotefuran by *Bacillus shortwave diflubenzuron* D-1 reached approximately 35%. This result is significantly higher than the uninoculated control group (<5%), confirming that *Bacillus shortwave diflubenzuron* D-1 possesses the ability to grow and metabolize dinotefuran using it as a carbon source.

[0045] Based on the above experimental data, microbial agents (containing sterile phosphate buffer and live bacteria) can be used in field or forest agricultural operations to degrade residual fipronil on plant surfaces or in the soil. The recommended application method is as follows: mix the above-mentioned agent with water at a ratio of 1%–5%, then apply it as a spray to fields or forests contaminated with fipronil, controlling the application rate at 450–750 L / hm². 2 scope.

[0046] Example 3: Experiment on enhancing parasitic wasp resistance with shortwave monocytogenes D-1

[0047] 1. Aseptic treatment of parasitic wasps: Healthy and active adult fruit fly gall wasps (Ld) and Japanese open-mandible brachiopod wasps (Aj) were selected and fed a 10% sucrose aqueous solution containing mixed antibiotics for one day. The final concentrations of the antibiotics were: tetracycline 500 μg / mL; rifampin 500 μg / mL; ampicillin 200 μg / mL; and penicillin-streptomycin 200 μg / mL. This was to eliminate their intestinal endophytic flora.

[0048] 2. Strain replenishment: Activated shortwave monocytogenes D-1 was inoculated into LB broth and cultured at 30 °C and 180 rpm until the logarithmic growth phase. After centrifugation and washing, the cells were resuspended in 10% sucrose solution to prepare the D-1 replenishment culture (OD). 600 (≈1.0), and the viable bacterial concentration was approximately 2×10⁻⁶ according to the specific standard curve. 9 cfu / mL. The parasitic wasps treated with the above antibiotics were fed this replenished bacterial solution for 2 days.

[0049] 3. Biological resistance determination: Three treatment groups were set up: (A) Control group: parasitic wasps fed sterile 10% sucrose solution for 3 days; (B) Sterile group: parasitic wasps treated with antibiotics for 1 day and then fed sterile 10% sucrose solution for 2 days; (C) Replacement group: parasitic wasps treated with antibiotics for 1 day and then fed bacterial solution for 2 days. Parasitic wasps from each treatment group were transferred into transparent tubes containing a series of concentration gradients of fipronil in sucrose solution, with 20 wasps per tube. Each concentration treatment was repeated 3 times. They were reared at 25 °C and 50% relative humidity, and the survival rate was recorded within 24 hours. Data analysis was performed using SPSS software. If the LC50 of the sterile group and the replacement group was significantly lower than that of the control group, the LC50 of the control group was significantly lower than that of the replacement group. 50 If the confidence intervals do not overlap, then LC 50 The values ​​were considered to be significantly different.

[0050] Result: As Figure 4 , 5 As shown, compared with the sterile group (B), the parasitic wasps (C) replenished with strain D-1 had a lower median lethal concentration (LC50) of dinotefuran. 50 The resistance was significantly enhanced, with resistance multiples reaching 3.064 and 1.933, respectively (see Tables 1 and 2). This directly demonstrates that *Syntrophus shortwave monocytogenes* D-1 colonizes in the gut of parasitic wasps and exerts a detoxifying effect, thereby significantly enhancing the host's drug resistance.

[0051] Table 1. Effects of reintroduced shortwave monocytogenes D-1 on furazolidone resistance in Drosophila melanogaster.

[0052]

[0053] Table 2. Effects of shortwave monocytogenes D-1 on furazolidone resistance in Japanese wrasse.

[0054]

[0055] In summary, the *Shortwave Monoclonal* D-1 strain provided by this invention is a functional strain with significant application potential. It can not only directly degrade neonicotinoid pesticide residues in the environment in vitro, but also effectively enhance the biological control potential of natural enemy insects by colonizing the intestines of parasitic wasps, providing a new solution for achieving green and sustainable agricultural development.

[0056] Finally, it should be noted that the above embodiments are only used to illustrate the technical principles and implementation methods of the present invention, and are not intended to limit the present invention. Within the framework of the core technical solutions disclosed in this invention (such as the described shortwave monoclonal bacteria strain and its application method), any person skilled in the art can easily conceive of various modifications, substitutions, or improvements, such as non-substantial adjustments to the culture medium composition, degradation reaction conditions, in vivo replenishment methods, etc. These changes, as long as they do not depart from the spirit and scope defined by the claims of this invention, should be considered as included within the patent protection of this invention.

Claims

1. A strain of *Bacillus shortwaverum*, characterized in that, This strain is deposited at the China Center for Type Culture Collection (CCTCC) under the name Brevundimonas D-1, with the Latin taxonomic name Brevundimonas huaxiensis and accession number CCTCCNO: M 20252463.

2. The *Shortwave Monoclonal* strain according to claim 1, characterized in that, The strain was isolated from the intestinal contents of adult Drosophila gall midge.

3. The *Shortwave Monoclonal* strain according to claim 1, characterized in that, The 16S rRNA gene sequence of the strain is shown in SEQ ID NO:

1.

4. A method for culturing the *Shortwave Monoclonal* strain according to any one of claims 1 to 3, characterized in that, The strain is transferred to a liquid culture medium and cultured at 28–32°C with shaking; the liquid culture medium is LB medium or an inorganic salt medium with fipronil as the sole carbon source.

5. The use of the *Shortwave Monoclonal* strain according to any one of claims 1 to 3 in the degradation of dinotefuran or in enhancing the resistance of parasitic wasps to dinotefuran.

6. A microbial agent with the function of degrading fipronil, characterized in that, The microbial agent includes the *Shortwave Monoclonal* strain as an active ingredient according to any one of claims 1 to 3, and an agriculturally acceptable carrier.

7. The method of using the microbial agent according to claim 6, characterized in that, When using, add the microbial agent to water at a ratio of 1% to 5%, mix thoroughly, and then apply it as a spray to fields or forests contaminated with fipronil. The application rate should be controlled at 450–750 L / hm². 2 Scope; the carrier in the microbial agent is sterile phosphate buffer, and the viable bacteria concentration is 2×10⁻⁶. 9 cfu / mL.

8. A microbial agent that enhances the resistance of parasitic wasps to fipronil, characterized in that, The microbial agent includes the *Shortwave Monoclonal* strain as an active ingredient according to any one of claims 1 to 3, and an acceptable carrier in parasitic bee feed.

9. The method of using the microbial agent according to claim 8, characterized in that, Before use, parasitic wasps were fed a sucrose solution containing antibiotics to clear the intestinal flora for one day; then, they were fed a microbial agent for two days. The carrier of the microbial agent was sucrose solution, and the live bacteria concentration was 2 × 10⁻⁶. 9 cfu / mL.

10. The method according to claim 9, characterized in that, The parasitic wasps are those belonging to the genera *Gallus spp.* or *Bronchiolochia*.