Burkholderia sp. AnJ-129 with antagonistic and growth-promoting functions and application of burkholderia sp. AnJ-129

By using a microbial agent developed from Burkholderia AnJ-129, the problems of unstable disease resistance and pollution from chemical control in the prevention and control of bacterial wilt of eucalyptus were solved, achieving effective control of bacterial wilt of eucalyptus and promoting plant growth.

CN122012344APending Publication Date: 2026-05-12BEIJING FORESTRY UNIVERSITY
View PDF 7 Cites 0 Cited by

Patent Information

Application Number
CN202610381645.7
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2026-03-26
Publication Date
2026-05-12

AI Technical Summary

Technical Problem

Control of bacterial wilt in eucalyptus mainly relies on resistant clones and chemical control. However, the resistance is unstable and chemical control pollutes the environment. Therefore, it is necessary to find green and efficient biological control methods.

Method used

Using Burkholderia AnJ-129, which has antagonistic and growth-promoting functions, a microbial agent was developed to control bacterial wilt of eucalyptus and promote plant growth.

Benefits of technology

It effectively inhibits the pathogen of bacterial wilt in eucalyptus, promotes the growth of eucalyptus plants, enhances disease resistance, and is environmentally friendly.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122012344A_ABST
    Figure CN122012344A_ABST
Patent Text Reader

Abstract

The invention belongs to the technical field of biological prevention and control and microbiology, and relates to burkholderia sp. AnJ-129 with antagonism and growth promotion functions and application of the burkholderia sp. AnJ-129. The invention provides a strain of Burkholderia sp. AnJ-129, and the preservation number of the Burkholderia sp. AnJ-129 is CGMCC (China General Microbiological Culture Collection Center) No.37457. The Burkholderia sp. Through physiological and biochemical identification and molecular taxonomy identification, the Burkholderia AnJ-129 is confirmed to belong to a new species of Burkholderia, and species resources and genetic diversity of Burkholderia flora are expanded. The Burkholderia sp. AnJ-129 provided by the invention can be used for remarkably antagonizing pathogenic bacteria of eucalyptus bacterial wilt and also has a promoting effect on growth of eucalyptus. The invention develops a biological control and plant growth promoting method based on the strain, is used for controlling eucalyptus bacterial wilt caused by pathogenic bacteria, and has a wide application prospect.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the fields of biological control technology and microbiology, and in particular to Burkholderia AnJ-129, which has antagonistic and growth-promoting functions, and its applications. Background Technology

[0002] Eucalyptus is an important economic tree species. With the continuous expansion of pure plantation scale, eucalyptus diseases have become increasingly serious. Bacterial wilt of eucalyptus is a major disease in eucalyptus production, causing severe damage and extreme destructiveness. Control of bacterial wilt mainly relies on the selection and breeding of resistant clones combined with localized chemical control. However, during the breeding process of resistant clones, with the increase in reproduction and subgeneration, the resistance of some resistant clones becomes unstable or gradually decreases, hindering the sustainable development of the eucalyptus industry. Furthermore, long-term use of chemical agents not only easily leads to drug resistance in pathogens but may also pollute the environment and harm the balance of the ecosystem. Therefore, seeking green, environmentally friendly, and efficient control methods has become a current research hotspot.

[0003] Furthermore, some microorganisms with nitrogen-fixing, phosphorus-solubilizing, and potassium-solubilizing functions play an important role in microbial inoculants. They can effectively promote the cycling of nutrients in the soil or secrete growth-promoting hormones and antibiotic-like substances, thereby enhancing plant growth activity, improving the plant's resistance to pathogen infection, and inhibiting disease occurrence, thus achieving the goal of increasing yield. Therefore, developing green and safe biological control methods using beneficial microorganisms with disease-preventing and growth-promoting effects is of great significance to the sustainable development of the eucalyptus industry. Summary of the Invention

[0004] The purpose of this invention is to provide Burkholderia AnJ-129 with antagonistic and growth-promoting functions and its applications to overcome the problems of reduced plant disease resistance and environmental pollution caused by chemical control.

[0005] To achieve the above objectives, the present invention provides the following solution: This invention provides a strain of Burkholderia (… Burkholderia Burkholderia sp.) AnJ-129, the Burkholderia AnJ-129 is deposited at the China General Microbiological Culture Collection Center (CGMCC) on January 19, 2026, with accession number CGMCC No. 37457, and the deposit address is No. 3, No. 1 Beichen West Road, Chaoyang District, Beijing.

[0006] This invention provides the application of Burkholderia AnJ-129 in the preparation of microbial agents antagonizing the pathogen of eucalyptus bacterial wilt.

[0007] The present invention provides a microbial agent for antagonizing the pathogen of bacterial wilt of eucalyptus, the microbial agent comprising Burkholderia AnJ-129 as described above.

[0008] This invention provides the application of Burkholderia AnJ-129 or the above-mentioned microbial inoculants in the prevention and control of bacterial wilt in plants.

[0009] This invention provides the application of Burkholderia AnJ-129 or the above-mentioned microbial inoculants in the preparation of products for the prevention and control of bacterial wilt of plants.

[0010] This invention provides the application of Burkholderia AnJ-129 or the above-mentioned microbial inoculants in promoting plant growth.

[0011] This invention provides the application of Burkholderia AnJ-129 or the above-mentioned microbial inoculants in the preparation of plant growth promoters.

[0012] Optionally, the plant includes eucalyptus.

[0013] The present invention provides a plant growth promoter, wherein the plant growth promoter comprises Burkholderia AnJ-129 or the above-mentioned microbial inoculant.

[0014] Optionally, the plant includes eucalyptus.

[0015] Optionally, the plant growth promoter can significantly increase the height and root length of eucalyptus seedlings.

[0016] The present invention provides a method for promoting plant growth, characterized by the step of applying Burkholderia AnJ-129 or the above-mentioned microbial inoculant.

[0017] Optionally, the plant includes eucalyptus.

[0018] Optionally, the plant growth specifically refers to promoting a significant increase in the height and root length of eucalyptus seedlings.

[0019] The present invention discloses the following technical effects: The strain provided by this invention is an antagonistic strain with growth-promoting function—Burkholderia ( Burkholderia sp.) AnJ-129, this strain is Burkholderia (sp.) BurkholderiaThis new species (sp.) expands the species resources and genetic diversity of the Burkholderia genus. The strain was isolated and screened from eucalyptus rhizosphere soil. On LB agar, its colonies are raised, round, pale yellow to yellow, with smooth, transparent edges. This strain was deposited on January 19, 2026, at the China General Microbiological Culture Collection Center (CGMCC), located at No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing, with accession number CGMCC No. 37457. This strain exhibits good inhibitory activity against the pathogen of eucalyptus bacterial wilt, and possesses in vitro growth-promoting properties such as dissolving organic and inorganic phosphorus, producing siderophores, and producing the auxin indoleacetic acid (IAA). It also significantly promotes the growth of eucalyptus plants. In summary, the antagonistic strain Burkholderia AnJ-129 provided by this invention has good biocontrol potential and can be used to develop biocontrol agents with disease-preventing and growth-promoting effects. Meanwhile, this invention has developed a biological control and plant growth promotion method based on this strain, which is used to control eucalyptus bacterial wilt caused by pathogenic bacteria and has broad application prospects. Attached Figure Description

[0020] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0021] Figure 1 The graph shows the inhibitory effect of strain AnJ-129 on the pathogen of bacterial wilt of eucalyptus; where A is the blank control and B is the inhibitory effect of strain AnJ-129 on the pathogen of bacterial wilt of eucalyptus. Figure 2 The images show the morphological characteristics of strain AnJ-129 on LB medium; where A is a macroscopic morphological image of strain AnJ-129 colonies; and B is a single colony morphological image of strain AnJ-129. The scale bar is 200µm. Figure 3 The image shows the Gram staining results of strain AnJ-129, with a scale bar of 10 µm. Figure 4 Phylogenetic tree diagram of strain AnJ-129; Figure 5This diagram illustrates the in vitro growth-promoting function of Burkholderia AnJ-129; where A1 is the blank control (Monkina organic phosphorus medium plate); A2 shows the effect of Burkholderia AnJ-129 in dissolving organic phosphorus; B1 is the blank control (Monkina inorganic phosphorus medium plate); B2 shows the effect of Burkholderia AnJ-129 in dissolving inorganic phosphorus; C1 is the blank control (CAS detection medium plate); C2 shows the effect of Burkholderia AnJ-129 in producing siderophores. Figure 6 The diagram shows the effect of Burkholderia AnJ-129 in producing plant growth hormone IAA; where CK+ is the positive control with 100 µL of IAA solution added; AnJ-129 is Burkholderia AnJ-129.

[0022] Figure 7 A comparative image of live eucalyptus seedlings inoculated with Burkholderia AnJ-129 50 days after inoculation shows the growth promotion effect on the seedlings. The left side shows eucalyptus seedlings inoculated with Burkholderia AnJ-129, while the right side shows the blank control, i.e., eucalyptus seedlings inoculated with sterile water. Detailed Implementation

[0023] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as a limitation of the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0024] It should be understood that the terminology used in this invention is merely for describing particular embodiments and is not intended to limit the invention. Furthermore, with respect to numerical ranges in this invention, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Any stated value or intermediate value within a stated range, as well as each smaller range between any other stated value or intermediate value within said range, is also included in this invention. The upper and lower limits of these smaller ranges may be independently included or excluded from the range.

[0025] Unless otherwise stated, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. While only preferred methods and materials have been described herein, any methods and materials similar or equivalent to those described herein may be used in the implementation or testing of this invention. All references to this specification are incorporated by way of citation to disclose and describe methods and / or materials associated with those references. In the event of any conflict with any incorporated reference, the content of this specification shall prevail.

[0026] Various modifications and variations can be made to the specific embodiments described in this specification without departing from the scope or spirit of the invention, as will be apparent to those skilled in the art. Other embodiments derived from this specification will also be apparent to those skilled in the art. This specification and embodiments are merely exemplary.

[0027] The terms “include,” “including,” “have,” “contain,” etc., used in this article are all open-ended terms, meaning that they include but are not limited to.

[0028] Example 1: Isolation and screening of strain AnJ-129 1. Sample collection Healthy eucalyptus plants were selected from diseased eucalyptus forests in Qingyuan City, Guangdong Province. Surface vegetation and other impurities were removed with a shovel. From four directions 50 cm away from the eucalyptus plants, samples were taken from the root zone 30 cm underground. Large clumps of soil were shaken off, and the root zone soil samples attached to the roots were brushed off. The samples were placed in 50 mL centrifuge tubes, immediately placed in an ice box for low-temperature preservation, and transported back to the laboratory for further processing.

[0029] 2. Isolation of strains (1) Culture medium preparation LB (Luria-Bertani Agar) nutrient agar medium: 10 g tryptone, 5 g yeast extract, 10 g sodium chloride, 15 g agar powder, and deionized water to a final volume of 1000 mL.

[0030] LB (Luria-Bertani) liquid medium: 10 g tryptone, 5 g yeast extract, 10 g sodium chloride, and deionized water to a final volume of 1000 mL.

[0031] NA (Nutrient Agar) beef extract peptone medium: 3 g beef extract powder, 10 g peptone, 5 g sodium chloride, 15 g agar powder, and deionized water to a final volume of 1000 mL.

[0032] TSA (Tryptic Soy Agar) medium: 15 g tryptone, 5 g soybean peptone, 5 g sodium chloride, 15 g agar powder, and deionized water to a final volume of 1000 mL.

[0033] After the culture medium is prepared to the required volume according to the ratio, it is sterilized in an autoclave at 121°C for 15 min.

[0034] (2) Isolation of strains Weigh 1 g of rhizosphere soil sample into an Erlenmeyer flask, add 9 mL of sterile water and sterile steel balls, place in an air bath constant temperature shaker, and shake at 160 r / min at 28℃ for 30 min to obtain 10 -1 A suspension of 10 concentration. Add 9 mL of sterile water to a sterile test tube, and then pipette 1 mL of 10... -1 Add the suspension, shake thoroughly to mix, and prepare a solution of 10 -2 Soil dilution solutions of varying concentrations are prepared in the same manner, to create 10 solutions. -3 10 -4 10 -5 A soil gradient dilution solution with concentrations ranging from 10... -3 10 -4 10 -5 100 µL of each diluted soil solution was taken and spread evenly on LB agar using a sterile spreader. The plates were sealed and incubated upside down at 28°C for 3 consecutive days. After colony growth, single colonies of different morphologies were picked using a sterile inoculation loop and purified on fresh LB agar using the streak plate method. The purified strains were stored at 4°C, and simultaneously, bacterial suspensions were prepared in LB liquid medium and stored at -20°C with 50% glycerol (v / v).

[0035] 3. Screening of strains The antagonistic strains were screened using the plate inhibition zone method. The initial screening method was as follows: Eucalyptus bacterial wilt pathogens (provided by the Chinese Academy of Forestry Sciences' Forest Environmental Protection and Conservation Department) and the isolated strains to be screened were streaked onto LB solid medium for activation. After single colonies grew, individual colonies were picked and placed in LB liquid medium, and cultured in a shaker at 180 rpm at 28°C for 48 h. The eucalyptus bacterial wilt pathogen suspension was then mixed with LB nutrient agar medium (heated to approximately 50°C, bacterial suspension: medium = 1:10, volume ratio) to prepare bacterial plates. Sterile filter paper discs were dipped in the strains to be screened and placed on the bacterial plates, with four discs of the strains to be screened spotted on each plate, symmetrically forming a cross. Filter paper discs inoculated with LB liquid medium served as controls. The plates were sealed and incubated at 28°C. Observations were conducted for 3-5 days, and strains producing inhibition zones were selected for further screening.

[0036] The specific method for secondary screening is as follows: Eucalyptus bacterial wilt pathogen and the strains to be screened are streaked onto LB nutrient agar for activation. After single colonies grow, each single colony is picked and placed in LB liquid medium, and cultured in a shaker at 180 rpm at 28°C for 48 h. The eucalyptus bacterial wilt pathogen suspension is mixed with LB solid medium (heated to approximately 50°C, bacterial suspension: medium = 1:10, volume ratio) until homogeneous, and then agar plates are prepared. Sterile filter paper discs are immersed in the strains to be screened and placed in the center of the agar plates. Filter paper discs inoculated with LB liquid medium serve as controls. Each treatment is repeated three times. After sealing, the plates are incubated at 28°C. Continuous observation is performed for 3-5 days. After the inhibition zone stabilizes, antagonistic strains with good and stable antibacterial activity are screened. The agar plates prepared above serve as blank controls. Experimental results showed that strain AnJ-129 had a good inhibitory effect on the pathogen, with an inhibition zone diameter of 21.3 mm. Figure 1 It is a good antagonistic strain for controlling bacterial wilt of eucalyptus.

[0037] Example 2 Identification of strain AnJ-129 1. Morphological identification The strain AnJ-129 was cultured on LB nutrient agar medium, and its colony characteristics were observed. Colonies of strain AnJ-129 on LB nutrient agar medium were raised, round, pale yellow to yellow, with smooth and transparent edges. Figure 2 Strain AnJ-129 also grows well on NA beef extract peptone medium and TSA tryptic soybean agar medium. Strain AnJ-129 is Gram-negative. Figure 3 (as shown in Table 1), the bacterial cells are short rod-shaped.

[0038] 2. Identification of physiological and biochemical characteristics The physiological and biochemical characteristics of strain AnJ-129 are shown in Table 1. The results showed that strain AnJ-129 is a facultative anaerobe, heat-resistant, and can grow in media with concentrations of 2%-10% NaCl. It also has the ability to liquefy gelatin, produce hydrogen sulfide (H2S), and produce catalase.

[0039] Table 1. Biological characteristics of strain AnJ-129 Note: "+" indicates a positive reaction or that the plant can be utilized and grow; "-" indicates a negative reaction or that the plant cannot be utilized and grow.

[0040] 3. Molecular identification Using a sterile inoculation loop, pick up a single AnJ-129 colony streaked on LB nutrient agar and place it in LB liquid medium. Incubate in a shaker at 180 r / min and 28℃ for 48 h. Transfer 150 µL of the bacterial culture into a 1.5 mL sterile centrifuge tube and place it in a water bath at 100℃ for 10 min. After the water bath, centrifuge at 13000 rpm for 15 min and retain the supernatant containing the DNA of the bacterial strain. Store at -20℃ for later use.

[0041] Molecular biological assays were performed using universal primers for bacterial 16S rDNA (27F / 1492R), gyrB-F / gyrB-R primers, and BCR1 / BCR2 primers to amplify the 16S rDNA, GyrB gene fragment, and RecA gene fragment of the strain, respectively. The primers used were 27F (5'-AGAGTTTGATCCTGGCTCAG-3', SEQ ID NO.1) / 1492R (5'-GGTTACCTTGTTACGACTT-3', SEQ ID NO.2), gyrB-F (5'-CCSACSGACGTGAAGATG-3', SEQ ID NO.3) / gyrB-R (5'-TCCACTGCATSGCGACTTC-3', SEQ ID NO.4), and BCR1 (5'-TGACCGCCGAGAAGAGCAA-3', SEQ ID NO.5) / BCR2 (5'-CTCTTCTTCGTCCATCGCCTC-3', SEQ ID NO.6). The PCR reaction system consisted of: 12.5 µL of 2×Easy Taq Master Mix, 1 µL of each primer, 2 µL of DNA template, and sterile water to a final volume of 25 µL. The reaction program was as follows: 16S rDNA: 94℃ pre-denaturation for 5 min; 94℃ denaturation for 30 s, 55℃ annealing for 30 s, 72℃ extension for 45 s, 30 cycles; 72℃ extension for 10 min. GyrB: 94℃ pre-denaturation for 3 min; 94℃ denaturation for 30 s, 58℃ annealing for 30 s, 72℃ extension for 45 s, 32 cycles; 72℃ extension for 10 min. RecA: 94℃ pre-denaturation for 3 min; 94℃ denaturation for 50 s, 58℃ annealing for 50 s, 72℃ extension for 70 s, 32 cycles; 72℃ extension for 10 min. PCR products were stored at 4℃ and sent to Beijing Nuosai Genome Research Center Co., Ltd. for sequencing. The bidirectional nucleotide sequences spliced ​​using SEQMAN software were aligned and cut using MEGA 6.0 software. Phylogenetic analysis was performed using maximum likelihood and Bayesian methods. A polygenic phylogenetic tree was constructed by combining the above three gene fragments. The phylogenetic tree is shown below. Figure 4As shown in the phylogenetic tree, strain AnJ-129 clusters into a separate clade.

[0042] The nucleotide sequence of the 16S rDNA fragment of strain AnJ-129 is shown in SEQ ID NO.7, specifically:

[0043] The nucleotide sequence of the GyrB gene fragment of strain AnJ-129 is shown in SEQ ID NO.8, specifically: .

[0044] The nucleotide sequence of the RecA gene fragment of strain AnJ-129 is shown in SEQ ID NO.9, specifically: GGGCGACGGCGAGGTGGCCGAGGACATCCAGGTCGTCTCCACGGGTTCGCTGGGGCTCGACATCGCGCTCGGCGTCGGCGGCCTGCCGCGCGGCCGGGTGGTCGAGATCTACGGTCCGGAATCGTCCGGTAAAACCACGCTCACGCTGCAGGTGATCGCCGAACTGCAGAAGATCGGCGGCACGGCCGCGTTCATCGACGCCGAGCACGCGCTCGACGTCCAGTACGCGGCGAAGCTCGGCGTGAACGTGCCGGAACTGCTGATCTCGCAGCCGGACACCGGCGAGCAGGCGCTGGAAATCACCGATGCGCTGGTGCGCTCGGGCTCGATCGACATGATCGTCATCGACTCGGTCGCGGCGCTCGTGCCGAAGGCCGAAATCGAAGGCGAGATGGGCGATTCGCTGCCGGGCCTGCAGGCCCGCCTGATGTCGCAGGCGCTGCGCAAGCTGACCGGCACGATCAAGCGCACGAACTGCCTCGTGATCTTCATCAACCAGATTCGTATGAAGATAGGCGTGATGTTCGGCAACCCGGAAACCACGACGGGCGGCAACGCGCTGAAGTTCTATGCGTCGGTGCGTCTCGACATCCGCCGGATCGGCTCGATCAAGAAGAACGACGAGGTGATCGGCAACGAAACCCGCGTGAAGGTCGTCAAGAACAAGGTATCGCCGCCGTTCCGCGAAGCGATCTTCGACATCCTGTACGGCGAGGGCATCTCGCGCCAGGGCGAGATCATCGACCTCGGCGTGCAGGCGAAGATCGTCGACAAGGCAGGCGCCTGGTACAGCTACAACGGCGAGAAGATCGGCCAGGGCAAGGACAACGCGCGTGAGTTCCTGCGCGAGAATCCGGAAATCGCCCGCGAGATCGAAGAACCGC。

[0045] Based on the above morphological identification, physiological and biochemical characteristics, and molecular biological determination, the results showed that strain AnJ-129 is a new species of the genus Burkholderia. BurkholderiaThe reasons for identifying Burkholderia AnJ-129 as a new species are as follows: (1) Phylogenetic basis: After analysis by maximum likelihood and Bayesian methods, AnJ-129 forms an independent branch in the phylogenetic tree that is different from other known species in the genus, with a support rate of 100% ( Figure 4 (2) Based on the phylogenetic tree diagram results ( Figure 4 AnJ-129 is the species most closely related to it. Burkholderia pyrrocinia (Hiroshi Imanaka, Masanobu Kousaka, Gakuzo Tamura, Kei Arima. Studies on Pyrrolnitrin, a NewAntibiotic. II. Taxonomic Studies on Pyrrolnitrin-Producing Strain. TheJournal of Antibiotics. Series A, 1965, Volume 18, Issue 5, Pages 205-206; Notification that new names and new combinations have appeared in volume 47, part 4 of the IJSB. Int J Syst Bacteriol 1998; 48:329-330) has obvious differences: Burkholderia pyrrocinia The edges are opaque, light gray to cream-colored; it cannot grow in media containing more than 5% NaCl; it is not heat-resistant. AnJ-129 colonies are pale yellow to yellow with smooth, transparent edges; they grow well in media containing 2%-10% NaCl; they are heat-resistant. In summary, AnJ-129 differs significantly from its closely related species and is unlike any currently known species; therefore, AnJ-129 is a new species of the genus *Burkholderia*. This invention names it *Burkholderia* (…). Burkholderia AnJ-129 (sp.) was deposited on January 19, 2026, at the China General Microbiological Culture Collection Center (CGMCC), Institute of Microbiology, Chinese Academy of Sciences, No. 3, No. 1 Beichen West Road, Chaoyang District, Beijing, with accession number CGMCC No. 37457.

[0046] Example 3: Determination of the in vitro growth-promoting ability of Burkholderia AnJ-129 1. Preparation of culture medium CAS detection medium: 60.5 mg chromazine, 72.9 mg cetyltrimethylammonium bromide, 2.645 mg ferric chloride hexahydrate, 295.25 mg sodium dihydrogen phosphate dihydrate, 1213.5 mg disodium hydrogen phosphate dodecahydrate, 125 mg ammonium chloride, 37.5 mg potassium dihydrogen phosphate, 62.5 mg sodium chloride, 9 g agar powder, diluted to 1000 mL with deionized water, pH 6.8.

[0047] Monkina Organic Phosphorus Medium: 10 g glucose, 0.5 g ammonium sulfate, 0.3 g sodium chloride, 0.3 g potassium chloride, 0.3 g magnesium sulfate heptahydrate, 0.03 g ferrous sulfate heptahydrate, 0.03 g manganese sulfate tetrahydrate, 5 g calcium carbonate, 0.025 g lecithin, 18 g agar powder, diluted to 1000 mL with deionized water, pH 7.2.

[0048] Monkina Inorganic Phosphorus Medium: 10 g glucose, 0.5 g ammonium sulfate, 0.3 g sodium chloride, 0.3 g potassium chloride, 0.3 g magnesium sulfate heptahydrate, 0.03 g ferrous sulfate heptahydrate, 0.03 g manganese sulfate hydrate, 5 g calcium phosphate, 0.025 g lecithin, 18 g agar powder, diluted to 1000 mL with deionized water, pH 7.2.

[0049] After the culture medium is prepared to the required volume according to the ratio, it is sterilized in an autoclave at 121°C for 15 min.

[0050] 2. Determination of the in vitro growth-promoting ability of Burkholderia AnJ-129 Burkholderia AnJ-129 obtained in Example 1 was activated, and a single colony was picked with a sterile inoculation loop and inoculated into LB liquid medium. The medium was then cultured in a shaker at 28°C and 180 r / min for 24 h to obtain Burkholderia AnJ-129 bacterial suspension. The effective viable count of this suspension was 1.87 × 10⁻⁶. 9 CFU / mL was used to detect the in vitro growth-promoting ability of Burkholderia AnJ-129.

[0051] (1) Determination of the ability of Burkholderia AnJ-129 to dissolve organophosphates A 4 mm diameter sterile punch was used to make a hole in the center of the prepared Monkina organophosphate agar plate. 30 µL of Burkholderia AnJ-129 bacterial suspension was injected into the hole, and the plate was sealed and incubated at 28°C for 5-7 days. The presence of a clear zone around the colony was observed to determine if the strain possessed the ability to dissolve organophosphates. A Monkina organophosphate agar plate containing an equal volume of sterile LB broth was used as a blank control.

[0052] (2) Determination of the ability of Burkholderia AnJ-129 to dissolve inorganic phosphorus A 4 mm diameter sterile punch was used to make a hole in the center of the prepared Monkina inorganic phosphorus medium plate. 30 µL of Burkholderia AnJ-129 bacterial suspension was injected into the hole, and the plate was sealed and incubated at 28°C for 5-7 days. The presence of a clear zone around the colony was observed to determine the strain's ability to dissolve inorganic phosphorus. A Monkina inorganic phosphorus medium plate containing an equal volume of sterile LB liquid medium served as a blank control.

[0053] (3) Determination of the siderophore production capacity of Burkholderia AnJ-129 A 4 mm diameter sterile punch was used to make a hole in the center of the prepared CAS test medium plate. 30 µL of Burkholderia AnJ-129 bacterial suspension was injected into the hole, and the plate was sealed and incubated at 28°C for 5-7 days. The presence of a hydrolysis zone or orange halo around the colony was observed to determine whether the strain possessed the ability to produce siderophores. A CAS test medium plate containing an equal volume of sterile LB liquid medium served as a blank control.

[0054] (4) Determination of the ability of Burkholderia AnJ-129 to produce IAA Burkholderia AnJ-129 obtained in Example 1 was activated. A single colony was picked with a sterile inoculation loop and inoculated into LB liquid medium containing 100 mg / L L-tryptophan. The medium was shaken at 180 r / min and 28°C for 24 h. 50 μL of Burkholderia AnJ-129 bacterial suspension was dropped onto a white ceramic plate, and an equal volume of Salkowski chromogenic solution was added to initiate a colorimetric reaction. A standard solution containing 50 µL of IAA (50 mg / L) was used as a positive control. The white ceramic plate was placed at room temperature and in the dark for 30 min before observation. A red reaction indicated the production of IAA, and the deeper the red, the higher the IAA yield.

[0055] The in vitro growth-promoting ability of Burkholderia AnJ-129 showed that Burkholderia AnJ-129 can dissolve organic and inorganic phosphorus, and has a strong ability to produce siderophores. Figure 5 ), and can also generate IAA ( Figure 6 These capabilities demonstrate that Burkholderia AnJ-129 can effectively utilize nutrients in the soil to provide necessary nutrients for eucalyptus plant growth, thereby exerting a good growth-promoting function and making it an excellent growth-promoting strain.

[0056] Example 4: Determination of the effect of Burkholderia AnJ-129 on the growth promotion of eucalyptus seedlings 1. Inoculation of strains Burkholderia AnJ-129 obtained in Example 1 was activated, and a single colony was picked with a sterile inoculation loop and inoculated into LB liquid medium. The medium was then cultured in a shaker at 180 r / min and 28°C for 24 h. The bacterial culture was centrifuged at 4000 rpm for 15 min, the supernatant was discarded, and the bacterial cells were collected and resuspended in sterile water to prepare OD200. 600 A bacterial suspension with a concentration of 0.5 mL was prepared. Uniformly growing eucalyptus seedlings were selected and cultivated in a standardized nutrient soil substrate. The bacterial suspension was inoculated around the roots of the eucalyptus seedlings using the root irrigation method, with each seedling inoculated with 30 mL of the suspension. This was designated as the treatment group. Eucalyptus seedlings inoculated with an equal volume of sterile water served as the control group (CK). Sixty seedlings were inoculated in each group. All seedlings were cultured in a climate chamber at 24 ± 2℃ and 80% humidity.

[0057] 2. Determination of the effect of Burkholderia AnJ-129 on the growth promotion of eucalyptus seedlings After inoculation with bacterial suspension, 10 eucalyptus seedlings from each of the treatment group and the control group were randomly selected every 10 days, and their plant height and root length were measured and analyzed (Tables 2 and 3).

[0058] Table 2 Effects of Burkholderia AnJ-129 on the height growth of eucalyptus seedlings (height measurement unit: cm) Note: Data are expressed as mean ± standard error; p <0.01; p <0.001, d10, d20, d30, d40, and d50 represent the 10th, 20th, 30th, 40th, and 50th days after inoculation, respectively, and the same applies below.

[0059] Table 3. Effects of Burkholderia AnJ-129 on root growth of eucalyptus seedlings (root length measurement unit: cm) Note: Data are expressed as mean ± standard error; p <0.05; p <0.01; p <0.001.

[0060] Two-way ANOVA was performed on the data from the control group and the treatment group. The results showed that the treatment group promoted the growth of eucalyptus seedling height at different time points, and the promoting effect of Burkholderia AnJ-129 remained relatively stable over time. Burkholderia AnJ-129 also promoted the growth of eucalyptus seedling root length, but the promoting effect was not significant in the first 20 days after inoculation with the bacterial suspension. From day 30 onwards, the promoting effect of Burkholderia AnJ-129 on the root length of eucalyptus seedlings gradually became significant. Simultaneously, eucalyptus seedlings treated with Burkholderia AnJ-129 had larger leaf areas, more numerous and longer roots, and the overall growth of the eucalyptus seedlings in the treatment group was superior to that in the control group. Figure 7 The results showed that Burkholderia AnJ-129 significantly promoted the growth of eucalyptus seedlings. Better growth of eucalyptus plants is conducive to their own resistance to pathogen invasion and improves the disease resistance of eucalyptus plants.

[0061] The embodiments described above are merely preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Various modifications and improvements made by those skilled in the art to the technical solutions of the present invention without departing from the spirit of the present invention should fall within the protection scope defined by the claims of the present invention.

Claims

1. A strain of Burkholderia ( Burkholderia sp.) AnJ-129, characterized in that, Burkholderia AnJ-129 is deposited at the China General Microbiological Culture Collection Center (CGMCC) on January 19, 2026, with accession number CGMCC No. 37457, at No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing.

2. The use of Burkholderia AnJ-129 as described in claim 1 in the preparation of a microbial agent antagonizing the pathogen of eucalyptus bacterial wilt.

3. A microbial inoculant antagonizing the pathogen of eucalyptus bacterial wilt, characterized in that, The microbial agent comprises Burkholderia AnJ-129 as described in claim 1.

4. The application of Burkholderia AnJ-129 as described in claim 1 or the microbial agent as described in claim 3 in the prevention and control of bacterial wilt in plants.

5. The use of Burkholderia AnJ-129 as described in claim 1 or the microbial agent as described in claim 3 in the preparation of products for the prevention and control of bacterial wilt of plants.

6. The application of Burkholderia AnJ-129 as described in claim 1 or the microbial agent as described in claim 3 in promoting plant growth.

7. The use of Burkholderia AnJ-129 as described in claim 1 or the microbial agent as described in claim 3 in the preparation of plant growth promoters.

8. The application according to any one of claims 4-7, characterized in that, The plants mentioned include eucalyptus trees.

9. A plant growth promoter, characterized in that, The plant growth promoter comprises Burkholderia AnJ-129 as described in claim 1 or the microbial agent as described in claim 3.

10. A method for promoting plant growth, characterized in that, The procedure includes the step of applying Burkholderia AnJ-129 as described in claim 1 or the microbial agent as described in claim 3.