Application of rice gene OsUGT79 in regulation and control of rice seed germination under salt stress
By regulating the overexpression or knockout of the rice OsUGT79 gene, the problems of rice seed germination speed and seedling establishment rate under salt stress were solved, and stable germination of rice seeds under salt stress was achieved, providing genetic resources for molecular breeding.
Patent Information
- Application Number
- CN202610182814.4
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-02-09
- Publication Date
- 2026-05-12
AI Technical Summary
Rice seed germination is disrupted under salt stress, leading to a decrease in germination rate and seedling establishment rate. Current technologies lack sufficient research on the function of the rice UGT family during seed germination and lack effective regulatory mechanisms.
By overexpressing or knocking out the rice gene OsUGT79, and using CRISPR/Cas9 technology and Agrobacterium-mediated genetic transformation, the germination process of rice seeds under salt stress was regulated, thereby increasing or decreasing their germination rate and speed.
It significantly improves or reduces the germination rate and speed of rice seeds under salt stress, provides stable molecular targets, provides genetic resources for improving the salt tolerance germination trait of rice, and enhances agricultural production efficiency.
Smart Images

Figure CN122012583A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of genetic engineering technology, and in particular to the application of the rice gene OsUGT79 in regulating rice seed germination under salt stress. Background Technology
[0002] Seed germination is one of the most critical stages in the crop life cycle. Its germination rate and uniformity not only affect seedling establishment and field population structure but also determine final yield and agricultural production efficiency. For important food crops such as rice, a stable and controllable germination process is particularly crucial, especially in direct seeding systems, which place higher demands on seed germination capacity. However, under natural conditions, rice seed germination is often affected by abiotic stresses such as drought and salt stress. These adverse conditions can interfere with internal seed metabolic processes, delay or inhibit germination, and even lead to a decrease in seedling establishment rate. Therefore, achieving environmental adaptive regulation of rice seed germination is of great significance for ensuring agricultural production safety.
[0003] Recent studies have shown that seed germination depends not only on the conversion of stored nutrients into energy and structural molecules, but also on the coordinated action of complex metabolic networks and signaling pathways. Among these, carbohydrate metabolism plays a crucial role in germination, acting not only as an energy source but also as a signaling factor regulating metabolic processes, osmotic balance, and stress responses. Salt stress typically disrupts osmotic pressure and metabolic balance, leading to significant alterations in metabolic pathways related to glucose transport, signaling regulation, and the mobilization of stored substances. Glycosylation modification, as an important regulatory mechanism within the carbohydrate metabolism network, can affect substrate activity, stability, and availability, thus playing a potentially vital role in germination and stress responses.
[0004] UDP-glycosyltransferases (UGTs) are important members of the plant glycosylation system, regulating the state and function of various metabolites, signaling molecules, and stress-related substances. Previous studies have shown that different UGT genes are involved in the salt stress tolerance mechanisms of plants. For example, in Arabidopsis, UDP-glycosyltransferases UGT79B2 and UGT79B3 (AtUGT79B2 / B3) respond to various stresses such as low temperature, salt, and drought. Some UGT members may be involved in seed dormancy and germination regulation. For instance, in Arabidopsis, AtUGT71C5 catalyzes the conversion of abscisic acid (ABA) to its glycosylated inactive form ABA-GE, thereby regulating endogenous ABA levels. Changes in its expression significantly affect seed dormancy depth and germination rate. AtUGT74E2 promotes seed germination by mediating the glycosylation of the auxin precursor IBA, altering the ABA-auxin signaling balance. However, compared with model plants, the functional study of the UGT family in rice during seed germination is still relatively limited, and its pathways and regulatory mechanisms have not yet been systematically elucidated. Summary of the Invention
[0005] The purpose of this invention is to provide the application of the rice gene OsUGT79 in regulating rice seed germination under salt stress. This can provide new gene resources for molecular breeding and new germplasm creation related to salt-tolerant germination in plants, and has good application prospects and promotion value.
[0006] The above-mentioned technical objective of the present invention is achieved through the following technical solution:
[0007] Application of rice gene OsUGT79 in regulating rice seed germination under salt stress.
[0008] Preferably, the nucleotide sequence of the rice gene OsUGT79 is shown in SEQ ID NO.1.
[0009] Preferably, the protein sequence encoded by the rice gene OsUGT79 is shown in SEQ ID NO.2.
[0010] Preferably, overexpression of the rice gene OsUGT79 improves the germination rate and germination speed of rice seeds under salt stress.
[0011] Preferably, the plant overexpression vector of the rice gene OsUGT79 is introduced into rice to improve the germination rate and germination speed of rice seeds under salt stress.
[0012] Preferably, a CRISPR / Cas9 gene-edited mutant that knocks out the rice OsUGT79 gene reduces the germination rate and germination speed of rice seeds under salt stress.
[0013] Preferably, the plant overexpression vector of the rice gene OsUGT79 is introduced into rice using Agrobacterium-mediated genetic transformation.
[0014] Preferably, the method for obtaining the nucleotide sequence of the rice gene OsUGT79 is as follows: total RNA is extracted from the japonica rice variety Nipponbare, cDNA is synthesized by reverse transcription, and the full-length cDNA sequence of the OsUGT79 gene is obtained by amplification using specific primers.
[0015] Preferably, the full-length cDNA sequence of the OsUGT79 gene is 1401 bp.
[0016] In summary, the present invention has the following beneficial effects: 1. This invention reveals the regulatory role of the OsUGT79 gene in rice seed germination and elucidates its function in promoting seed germination under salt stress.
[0017] 2. Overexpression of the OsUGT79 gene can significantly improve the germination rate and germination speed of rice seeds under adverse conditions, while knockout of the OsUGT79 gene can significantly reduce the germination rate and germination speed of rice seeds under adverse conditions without affecting normal growth, providing a reliable molecular target for improving the stress-resistant germination trait of rice.
[0018] 3. The OsUGT79 gene and its application provided by this invention can provide new gene resources for molecular breeding and new germplasm creation related to salt-tolerant germination in plants, and have good application prospects and promotion value. Attached Figure Description
[0019] Figure 1 This is a statistical graph showing the dynamic changes in the expression levels of the OsUGT79 gene in the aboveground and underground parts under salt stress conditions over time. Figure 2 This is a graph showing the gene expression levels of seeds from the two overexpression lines and wild-type seeds in Example 4; Figure 3 This is a diagram showing the mutation sites and types of genes in the two mutant strains in Example 5; Figure 4 This is a comparison of the germination of seeds of various materials in Example 6 after 96 hours (4 days) in a petri dish containing 100 mmol / L NaCl; Figure 5 The images show the germination status of the seeds of each material in Example 6 after 96 hours (4 days) in the culture dish of the water group; Figure 6 This is a statistical chart of the germination rate of seeds of each material in the culture dish of the water group at different time points in Example 6; Figure 7 This is a statistical graph showing the germination rate of seeds of various materials in Example 6 at different time points in a culture dish containing 100 mmol / L NaCl. Detailed Implementation
[0020] The specific embodiments of the present invention will be further described below with reference to the accompanying drawings. These embodiments do not constitute a limitation on the present invention.
[0021] The following embodiments define the present invention and describe the methods for isolating and cloning cDNA segments containing the complete coding region of the OsUGT79 gene, and for verifying the function of the OsUGT79 gene. Based on the following description and these embodiments, those skilled in the art can determine the essential features of the present invention, and various changes and modifications can be made to the invention to suit different uses and conditions without departing from its spirit and scope.
[0022] Example 1: Cloning method of OsUGT79 gene Leaf tissues from 3-week-old seedlings of *Nipponbare* were rapidly frozen in liquid nitrogen. The samples were then thoroughly ground in liquid nitrogen. RNA was extracted from the resulting plant tissue samples using the TRNzol Universal Total RNA Extraction Kit (Tiangen Biotech). RNA quality was assessed, and integrity was checked by electrophoresis on a 1.0% agarose gel. The concentration of extracted RNA was also determined using ThermoNANODROP. High-quality RNA was selected and reverse transcribed into cDNA using the FastKing cDNA First-Strand Synthesis Kit (Tiangen Biotech) for cloning the rice OsUGT79 gene. PCR primers (OsUGT79-F / R) were designed based on the target gene sequence, and specificity was ensured by BLAST alignment using NCBI. Primer design for overexpression vector construction needs to consider restriction sites and cloning methods. When designing experiments, consider adding an upstream primer UTG79-OE-F containing a Kpn I site and a linker TCGAGCTTTCGCGAGCTC at the 5' end and a downstream primer UTG79-OE-R containing an Xba I site and a linker GCATGCCTGCAGGTCGAC at the 3' end, so that they can be used for subsequent restriction digestion to obtain the target fragment.
[0023] The amplification system includes: 2 μL cDNA template, 25 μL 2×KOD One TM PCR MasterMix, 2 μL primer UGT79-OE-F, 2 μL primer UGT79-OE-R, 19 μL double-distilled water, total volume 50 μL. The PCR reaction program was: 94℃ pre-denaturation for 3 min; followed by 35 cycles of: 98℃ denaturation for 30 sec, 68℃ annealing for 45 sec, 68℃ extension for 45 sec; final 72℃ for 5 min, and storage at 4℃. After PCR, the results were detected by agarose gel electrophoresis. Agarose gels containing a single target band were excised and recovered for later use. DNA recovery was performed using the Agarose Gel DNA Recovery Kit (DP209-03) from Tiangen Biotech Co., Ltd., following the kit instructions. The amplified products were detected by next-generation sequencing and were consistent with SEQ ID NO. 1.
[0024] The primers are as follows:
[0025] Example 2: Spatiotemporal expression of the rice OsUGT79 gene after salt stress Using rice (Nipponbare) as the model plant, seedlings (3 weeks old) were subjected to 100 mmol / L salt stress for 24 hours. Aboveground and underground tissues were sampled at 0h, 6h, 12h, 18h, 24h, and 24h after recovery. The samples were rapidly frozen in liquid nitrogen, then thoroughly ground into a dry powder under liquid nitrogen. RNA was extracted from the samples using the TRNzol Universal Total RNA Extraction Kit (Tiangen Biotech), and then reverse transcribed into cDNA. The relative expression level of the OsUGT79 gene at different time points was detected using quantitative real-time PCR (qRT-PCR). Gene expression changes were analyzed by comparing the control group (before treatment at 0h) and the experimental group (at each time point after treatment). The qRT-PCR primers are designed as follows:
[0026] The qPCR reaction system consisted of: 2 μL cDNA template, 10 μL 2×ChamQSYBRqPCRMasterMix (LowROX Premixed), 0.4 μL primer F, 0.4 μL primer R, 7.2 μL double-distilled water, and a total volume of 20 μL. The qPCR reaction program was as follows: pre-denaturation at 95℃ for 30 seconds; followed by 35 cycles of 95℃ for 10 seconds, 60℃ for 30 seconds; and finally, melting curves were collected at 95℃ for 15 seconds, 60℃ for 60 seconds, and 95℃ for 15 seconds.
[0027] Experimental results: like Figure 1 As shown, under salt stress conditions, the OsUGT79 gene exhibited significant expression changes in both the aboveground and underground parts.
[0028] In the aerial parts, the expression level of OsUGT79 was lower than that of the control at the initial treatment (6h and 12h), increased significantly at 18h of treatment, decreased at 24h, and was upregulated again at 24h after recovery, i.e., 48h in the figure.
[0029] In the underground part, the expression of OsUGT79 increased significantly after 18 h of treatment, reached its highest level at 24 h, and then decreased 24 h after recovery, i.e., 48 h as shown in the figure.
[0030] The above results indicate that the OsUGT79 gene can respond to salt stress treatment, and its expression level changes dynamically with treatment time, exhibiting differentiated response characteristics in different tissues.
[0031] Example 3: Creation of rice lines based on one-step construction of OsUGT79 overexpression vector The vector described in this embodiment is a rice OsUGT79 gene inserted into the plant expression vector pWM101, which is used to construct a high-efficiency expression vector containing the OsUGT79 gene downstream of the 35 promoter with an enhancer 35.
[0032] (1) Linearization of cloning vectors The pWM101 vector linearization system consisted of 1 μL Kpn I, 1 μL XbaI, 5 μL CutSmart Buffer, and 12.5 μL pWM101 vector. ddH2O was added to a final volume of 50 μL, and the mixture was incubated at 37°C for 2 hours. The mixture was then analyzed by agarose gel electrophoresis. After gel extraction and recovery, the mixture was ready for ligation, following the same recovery method as in Example 1.
[0033] (2) Connection reaction The ligation reaction was performed in one step according to the instructions (ClonExpress® II). The insert fragment is from Example 1.
[0034]
[0035] Connection reaction parameters: 37℃ for 30 min; after the reaction is complete, place the reaction tube in an ice-water bath to cool.
[0036] (3) Transformation of recombinant plasmids 1) Take a tube containing 100 μL of DH5α Escherichia coli competent cells and 10 μL of ligation product, gently tap the tube wall to mix, and incubate on ice for 30 min; 2) Quickly place it in a 42℃ constant temperature water bath, heat shock for 45 seconds, then ice bath for 2 minutes; 3) Add 900 μL of LB liquid culture medium and mix well; 4) Incubate at 37℃ and 200 rpm for 1 hour to allow the cells to return to normal growth. 5) Spread the bacterial culture evenly on Kana-resistant LB solid medium plates; 6) After 30 minutes, place in a 37°C constant temperature incubator and incubate overnight.
[0037] (4) Colony PCR Select individual colonies and perform colony PCR detection using primer pairs OsUGT79-F and OsUGT79-R. Select positive colonies and shake them for inoculum formation.
[0038] (5) Sequencing and plasmid extraction The plasmids extracted from the above positive bacterial plaques were subjected to Sanger sequencing. The sequencing results were consistent with the target fragment sequence. The corresponding bacterial culture was selected for plasmid extraction. The plasmid extraction was performed according to the instructions of the plasmid mini-prep kit (centrifuge column type, Tiangen Company) provided by TIANGEN. The plasmid was named OsUGT79-pWMOE, which means that the overexpression vector was successfully constructed and stored at -20℃ for later use.
[0039] (6) Creation of rice OsUGT79 overexpression materials After obtaining the overexpression vector OsUGT79-pWMOE, the vector was introduced into rice using Agrobacterium-mediated genetic transformation. The specific steps are as follows: 1) Agrobacterium-mediated transformation The constructed overexpression vector OsUGT79-pWMOE was transformed into Agrobacterium GV3101 competent cells using the freeze-thaw method. The transformed Agrobacterium was plated on LB agar plates containing the corresponding antibiotics (kanamycin and hygromycin) and incubated in the dark at 28°C for 2–3 days. Positive single colonies were picked for propagation and later use.
[0040] 2) Rice callus induction and infection Mature rice embryos were used as explants and cultured in the dark on callus induction medium to induce embryogenic callus formation. Well-grown callus tissue was selected and infected with Agrobacterium tumefaciens containing OsUGT79-pWMOE, and then cultured in the dark on co-culture medium for 2–3 days.
[0041] 3) Resistance screening and regeneration culture After co-culture, the callus tissue was transferred to a selection medium containing the corresponding screening antibiotic for resistance selection, inhibiting the growth of untransformed callus tissue. After multiple rounds of selection, the obtained resistant callus tissue was transferred to a differentiation medium to induce shoot differentiation; subsequently, it was transferred to a rooting medium to induce rooting, obtaining complete regenerated plants.
[0042] 4) Transplantation and identification of transgenic plants The regenerated plants were transplanted into greenhouses or artificial climate chambers for cultivation. Genomic DNA was extracted from the transgenic plants, and the exogenous OsUGT79 gene and vector-specific sequences were detected by PCR to confirm the acquisition of transgenic plants. Further analysis of OsUGT79 expression levels using qRT-PCR was conducted to screen for transgenic rice materials with stable high expression for subsequent functional analysis.
[0043] Example 4: Identification of OsUGT79 overexpression lines Rice seeds from the T2 generation of the OsUGT79 overexpression line were sown simultaneously with wild-type seeds. After seedlings emerged, DNA was extracted, and PCR identification was performed using specific primers. RNA was extracted from positive seedlings, reverse transcribed into cDNA, and its expression level was analyzed using qRT-PCR. Results are shown below. Figure 2 The expression levels of the OsUGT79 gene in two overexpression lines (UGT79-OE-1 and UGT79-OE-41) were significantly higher than those in the wild type.
[0044] Example 5: Identification of homozygous OsUGT79 mutant lines Seeds of the T2 generation of the OsUGT79 mutant homozygous line were sown simultaneously with wild-type seeds. Genomic DNA was extracted from leaves when seedlings reached the 3-leaf stage. Using the upstream and downstream sequences of the Cas9 target (target: CTGAGCGGCCTGTACACGC) as templates, specific primers (F: ACCAACCCGATGCTCCAGTTC; R: CTAGTCTACTATACACTCCCTCCAGGCTAA) were designed for PCR amplification. The amplified products were sequenced using Sanger sequencing to confirm the mutation type, retaining only homozygous deletion or insertion mutants. Results are shown below. Figure 3 Both mutant lines (ugt79-8-1 and ugt79-18-3) showed homozygous frameshift mutations at the target site, indicating that homozygous mutants with loss of OsUGT79 function have been successfully obtained.
[0045] Example 6: Germination ability of CRISPR mutant and overexpression lines of the OsUGT79 gene under salt stress Seeds of wild-type Nipponbare, OsUGT79 overexpression lines (UGT79-OE-1, UGT79-OE-41), and OsUGT79 mutant lines (ugt79-8-1, ugt79-18-3) harvested at the same time and with plump, uniform size were selected. After sterilization and washing, seeds were sown in petri dishes containing water and in petri dishes containing 100 mmol / L NaCl, respectively. Germination status under different treatments was recorded after 4 days of germination. Results are shown below. Figure 4 As shown in Figure 5, the germination rate of overexpression lines was enhanced, while the germination rate of knockout lines was inhibited. This indicates that overexpression lines can improve the germination rate of rice seeds under salt stress. Seed germination rate was recorded starting from h0. Figure 6 , 7 It can be seen that, compared with WT, the OsUGT79 overexpression line exhibits earlier germination, while the OsUGT79 mutant line exhibits delayed germination. Figure 7Germination experiments were conducted on rice seeds under 100 mmol / L NaCl stress. Germination rates were recorded. The OsUGT79 overexpression line reached its maximum germination rate of approximately 60% at 96 h, while the OsUGT79 mutant line only achieved a germination rate of 25% at 96 h. At each time point, the germination rate of the overexpression line was higher than that of the wild type. Overall, the germination rate of the overexpression line was higher than that of the wild type, while the germination rate of the knockout line was significantly lower than that of the wild type, indicating that the OsUGT79 gene can regulate rice seed germination.
[0046] This invention utilizes CRISPR / Cas9 technology to design specific sgRNAs targeting the OsUGT79 gene, constructing CRISPR / Cas9 gene-editing mutants that knock out the OsUGT79 gene in rice. Rice seed germination is significantly affected by salt stress signals. Under salt stress treatment, the OsUGT79 overexpression material showed significantly higher tolerance during seed germination than wild-type lines, indicating that OsUGT79 gene overexpression can improve rice seed germination ability under saline conditions, while OsUGT79 gene knockout inhibits rice seed germination ability under saline conditions. This invention can provide new gene resources for molecular breeding to regulate plant salt tolerance. It has good prospects for application both theoretically and in the creation of new germplasm.
[0047] The above description is merely a preferred embodiment of the present invention and is not intended to limit the present invention. Those skilled in the art can make various modifications or equivalent substitutions to the present invention within the scope of its essence and protection. Such modifications or equivalent substitutions should also be considered to fall within the protection scope of the present invention.
Claims
1. Application of rice gene OsUGT79 in regulating rice seed germination under salt stress.
2. The application according to claim 1, characterized in that: The nucleotide sequence of the rice gene OsUGT79 is shown in SEQ ID NO.
1.
3. The application according to claim 1, characterized in that: The protein sequence encoded by the rice gene OsUGT79 is shown in SEQ ID NO.
2.
4. The application according to claim 1, characterized in that: Overexpression of the rice gene OsUGT79 improved the germination rate and speed of rice seeds under salt stress.
5. The application according to claim 1, characterized in that: The plant overexpression vector of the rice gene OsUGT79 was introduced into rice to improve the germination rate and germination speed of rice seeds under salt stress.
6. The application according to claim 1, characterized in that: The CRISPR / Cas9 gene-edited mutant that knocks out the OsUGT79 gene in rice reduces the germination rate and germination speed of rice seeds under salt stress.
7. The application according to claim 5, characterized in that: The plant overexpression vector of the rice gene OsUGT79 was introduced into rice using Agrobacterium-mediated genetic transformation.
8. The application according to claim 2, characterized in that: The specific method for obtaining the nucleotide sequence of the rice gene OsUGT79 is as follows: total RNA is extracted from the japonica rice variety Nipponbare, cDNA is synthesized by reverse transcription, and the full-length cDNA sequence of the OsUGT79 gene is obtained by amplification using specific primers.
9. The application according to claim 7, characterized in that: The full-length cDNA sequence of the OsUGT79 gene is 1401 bp.