Application of molecular marker influencing sheep body length character
By screening molecular markers that influence sheep body length traits through genome-wide association analysis, and using the nucleotide sequence shown in SEQ ID NO.2 to identify sheep body length traits at an early stage, this approach solves the problem of slow progress in the genetic improvement of sheep body size traits in existing technologies and improves the efficiency of sheep breeding.
Patent Information
- Application Number
- CN202610442119.7
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-04-07
- Publication Date
- 2026-05-19
- Estimated Expiration
- 2046-04-07
AI Technical Summary
The lack of effective means in the current technology to accurately and early identify the genetic potential of sheep body length leads to slow progress in the genetic improvement of body shape traits during the breeding process, which affects the improvement of sheep production performance.
Through genome-wide association analysis, molecular markers affecting sheep body length traits were screened out. Genotype detection was performed using the nucleotide at position 101 bp of the nucleotide sequence shown in SEQ ID NO.2, which is T or C. This allowed for early identification of sheep body length traits and selection of individuals with the CC genotype as parents for breeding.
It enables early and accurate identification of sheep body length traits, significantly shortens the breeding cycle, improves the body length performance of offspring, and enhances breeding efficiency.
Smart Images

Figure CN122060874A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of genetic breeding technology, specifically to the application of a molecular marker that affects the body length trait of sheep. Background Technology
[0002] Suffolk sheep are a large meat sheep breed, developed in 1859 through crossbreeding of the Southhill sheep with the robust, lean-meat-prominent old-type black-headed horned Norfolk sheep. Suffolk sheep are primarily used for purebred breeding and as a high-quality sire for crossbreeding local sheep. Their significant growth rate and superior meat quality effectively shorten the breeding cycle, reduce feed input costs, and improve overall breeding efficiency.
[0003] With the continuous rise in demand for high-end mutton, the market potential of Suffolk sheep's premium meat products is becoming increasingly prominent. As an important meat sheep breed, Suffolk sheep are widely introduced and utilized due to their rapid growth and outstanding meat production performance. Currently, breeding for sheep body shape traits still mainly relies on traditional phenotypic selection methods, which involve measuring body length and other body shape indicators in adult sheep and then selecting parents based on phenotypic performance. This method has significant limitations: firstly, the selection cycle is long, requiring sheep to reach a stable growth stage before accurate assessment; secondly, phenotypes are easily affected by non-genetic factors such as environment and feeding management, resulting in low selection accuracy; and thirdly, it cannot predict the genetic potential of lambs or breeding sheep in the early stages, affecting breeding efficiency. Existing technologies lack effective means to accurately and early identify the genetic potential of sheep body length, thus leading to slow progress in genetic improvement of body length traits during breeding and restricting the improvement of overall herd productivity.
[0004] Therefore, developing a new technology that can accurately identify and screen genetic potential related to body length traits at an early stage is of great significance for accelerating the genetic improvement of sheep body size traits. Summary of the Invention
[0005] To address the above problems, this invention provides an application of molecular markers that affect the body length trait of sheep. These molecular markers can be used to identify the body length trait of sheep and to breed long-bodied sheep.
[0006] This invention is achieved through the following technical solution: This invention provides an application of a molecular marker that affects the body length trait of sheep. The molecular marker is the nucleotide sequence shown in SEQ ID NO.2, where the nucleotide at the 101 bp site is either T or C. The application refers to any one of the following (1) and (2): (1) Determine the body length of the sheep; (2) Increase the body length of sheep offspring.
[0007] Preferably, the method for determining the body length of a sheep is as follows: Genomic DNA was extracted from the sheep to be tested and sequenced. Determine the genotype of the sheep at position 101bp of SEQ ID NO.2; If the genotype at 101bp of SEQ ID NO.2 is CC, then the sheep is of long body length, which means a body length greater than 88cm.
[0008] Preferably, the method for increasing the body length of sheep offspring is as follows: Genomic DNA was extracted from the sheep to be tested and sequenced. Determine the genotype of the sheep at position 101bp of SEQ ID NO.2; By selecting sheep individuals with the genotype CC at 101bp of SEQ ID NO.2 as parents for breeding, the body length of sheep offspring can be increased.
[0009] Preferably, the genomic DNA is derived from sheep blood.
[0010] Preferably, the genomic DNA is extracted using the phenol-chloroform method.
[0011] Preferably, the sheep is a Suffolk sheep.
[0012] Preferably, the body length refers to: The straight-line distance from the front of the sheep's scapula to the back of the ischial tuberosity.
[0013] Compared with the prior art, the present invention has the following beneficial effects: This invention provides an application of a molecular marker affecting sheep body length, wherein the molecular marker is the nucleotide sequence shown in SEQ ID NO.2, and the nucleotide at the 101 bp site is T or C; the application refers to either (1) or (2) below: (1) identifying sheep body length; (2) improving the body length of sheep offspring. This invention screened a molecular marker that significantly affects sheep body length through methods such as genome sequencing, identification of variant sites, and genome-wide association analysis. The results of this invention show that the average body length of individuals with the CC genotype at this locus is significantly higher than that of individuals with the CT and TT genotypes, and the frequency of the CC genotype in the population reaches 64.7%, while the frequency of the C allele is 80.3%, indicating that the molecular marker described in this invention is widely distributed in the population and has strong practicality. Compared with traditional breeding methods that rely on phenotypic measurements, this invention allows for genetic assessment of body length traits in sheep at an early stage of growth and development by detecting the genotype of the molecular marker, which significantly shortens the breeding cycle. Furthermore, by selecting individuals with the CC genotype as parents, the body length performance of offspring can be effectively improved. Based on the molecular markers described in this invention, early and accurate identification of sheep body length traits can be achieved. This invention provides a reliable tool for molecular-assisted breeding of Suffolk sheep and other sheep breeds, helping to improve breeding efficiency and genetic progress. Attached Figure Description
[0014] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.
[0015] Figure 1 This is a distribution diagram of the SNPs after quality control in a 1Mb window of the chromosome. The left Y-axis represents the chromosome name, and the upper X-axis represents the window size.
[0016] Figure 2 This is a visualization of the IBS genetic distance matrix of this invention.
[0017] Figure 3 This is the principal component analysis diagram of the present invention.
[0018] Figure 4 The Manhattan Plots and QQ-plots of this invention show the GWAS results of the body length trait in Suffolk sheep; A is the Manhattan plot of the body length trait in Suffolk sheep, with significant SNPs across the entire genome shown in red; B is the QQ plot of the body length trait in Suffolk sheep. Detailed Implementation
[0019] To facilitate understanding of the present invention, a more comprehensive description is provided below, along with preferred embodiments. However, the present invention can be implemented in many different forms and is not limited to the embodiments described herein. Rather, these embodiments are provided to provide a thorough and complete understanding of the disclosure of the present invention.
[0020] Unless otherwise defined, all technical and scientific terms used in this invention have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains. The terminology used in this invention and in its specification is for the purpose of describing particular embodiments only and is not intended to be limiting of the invention.
[0021] The technical solution of the present invention will be further described below with reference to specific embodiments.
[0022] The following is a list of abbreviations related to this invention: LD: Linkage Disequilibrium; Manhattan Plot; QQ chart: Quantile-Quantile Plot; SNP: Single nucleotide polymorphism; GWAS: Genome-wide association study; IBS: Identity-by-State.
[0023] The experimental animals and phenotypic sources of this invention: The experimental sheep used in this invention were all from Sinosheep Technology Co., Ltd. Body length traits of adult Suffolk sheep from 2020 to 2024 were measured and phenotypes were recorded. Phenotypic descriptions of body length traits are shown in Table 1.
[0024] Blood samples were collected from 300 Suffolk sheep. All samples were immediately stored at -80°C after collection and transported to the laboratory on dry ice for long-term storage at -80°C.
[0025] Table 1. Description of body length traits in Suffolk sheep
[0026] Example 1: Application of a molecular marker affecting sheep body length traits, as detailed below: 1. Genomic DNA extraction and quality control.
[0027] DNA was extracted from blood samples using the phenol-chloroform method. DNA concentration was measured using a NanoDrop2000 spectrophotometer. The absorption wavelength ratio of the highest absorption peak at 260 nm to 280 nm was calculated to measure the content of DNA, protein, and phenolic substances. The absorption wavelength ratio of the highest absorption peak at 260 nm to 230 nm was calculated to measure the content of DNA and carbohydrates. DNA quality was then assessed using 1% (w / v) agarose gel electrophoresis.
[0028] 2. Library construction and sequencing.
[0029] The qualified genomic DNA was randomly fragmented into 350bp fragments using a Covaris ultrasonic disruptor. The DNA fragments underwent end repair, poly(A) addition, sequencing adapter addition, purification, and PCR amplification to complete the library preparation. After library construction, preliminary quantification was performed using Qubit 2.0, and qPCR was used to accurately quantify the effective concentration of the library to ensure library quality. After passing quality checks, sequencing was performed using the BGI MGI-T7 sequencing platform in PE150 mode.
[0030] 3. Identification, screening, and annotation of variant sites.
[0031] Raw reads were filtered into clean reads using FastP software version 0.20.0, and a genome index was built on the reference genome. The quality-controlled clean reads were aligned with the reference genome using Burrows-Wheeler Aligner software version 0.7.17. The aligned SAM files were converted to BAM files using SAMtools software version 1.8-20, and the BAM files were sorted. Duplicates were removed from the sorted BAM files using the MarkDuplicates program in Genome Analysis Toolkit version 3.8, resulting in the final BAM file. An index was built on the final BAM file, and SNP variant detection was performed using the HaplotypeCaller module in GATK software. The resulting VCF file was then filtered using the VariantFiltration module. Functional annotation of the detected gene variants was performed using the ANNOVAR software package. Based on the location of the variant sites on the reference genome and the gene location information on the reference genome, the region in which the variant sites occurred and the impact of the variants, such as synonymous or non-synonymous mutations, can be determined.
[0032] The reference genome used in this invention is Oar_v4.0, GCF_000298735.2.
[0033] 4. Data quality control and group stratification correction.
[0034] Whole-genome resequencing was performed on 300 Suffolk sheep individuals to establish a genotype database, generating a total of 17243.32 Gb of raw reads and obtaining 47,506,993 SNPs.
[0035] The obtained genotyping data were quality controlled using Plink V1.90 software, and individuals with a genotype detection rate of less than 98%, SNPs with a detection rate of less than 98%, SNPs with a minimum allele frequency of less than 5%, and Hardy-Weinberg equilibrium test p-values of less than 10 were removed. -6 SNPs. A total of 20,182,599 high-quality SNPs were identified in the Suffolk population. These loci are evenly distributed across the 26 pairs of autosomes in sheep, such as... Figure 1 As shown.
[0036] The population was analyzed using Plink V1.90 based on the IBS genetic distance matrix, and the results are as follows: Figure 2 As shown. The first five principal components were calculated using the "--pca5" parameter in Plink V1.90. The PCA plot was then drawn using R version 3.6.0, and the results are shown below. Figure 3 As shown, the experimental sample exhibits population stratification and a high degree of genetic correlation among individuals. Therefore, the first five principal components need to be used as covariates to correct for the population stratification phenomenon in Suffolk sheep.
[0037] 5. Genome-wide association analysis.
[0038] The association analysis between SNPs and body length traits was performed using the fastGWA-mlm model in GCTA software version V1.94.0beta. The formula is as follows: .
[0039] in y It is a phenotypic vector; X snp It is a genotype vector, and its effect is β snp ; X c This is the correlation matrix with the first five PCA variables as fixed covariates, and its corresponding coefficients are... β c ; g It is a vector of total genetic effects captured by the genetic relationship matrix derived from SNPs. g ~ N(0, ); π is a genetic relation matrix vector derived from SNP, where all off-diagonal elements are set to 0; e It is the residual vector. e ~ N(0, ).
[0040] Since using the Bonferroni correction method with a value of 0.05 / number of SNPs to determine the significance threshold of GWAS is too stringent, this invention employs linkage disequilibrium screening to remove redundancy, obtaining independent SNPs for threshold calculation. The parameters are: 200: window size, i.e., number of SNPs; 50: step length, i.e., number of SNPs; 0.2: r 2 Delete one of the SNP pairs where LD is greater than 0.2.
[0041] This invention adjusts the threshold for genome-wide significant association to P=1 / 620054, where 620054 is the number of independent SNPs screened by LD. The genome expansion factor, λ, is tested and calculated using the slope of a linear regression between observed quantiles and theoretical quantiles in R version V3.6.0. The calculated λ value for the body length trait is 1.017, indicating no genome expansion.
[0042] Based on resequencing data from 300 Suffolk sheep, 19 significant SNP loci associated with body length were detected. These loci are located on chromosomes 1, 2, 3, 4, 6, 10, 13, 20, 22, and 23, as shown in Table 2. Figure 4 As shown.
[0043] Table 2 Significant SNP sites associated with body length traits
[0044] 6. SNPs affecting body length traits in Suffolk sheep.
[0045] Further investigation of SNPs that reached genome-wide significance revealed that the C→T mutation at position 6085918 on chromosome 13 of the Suffolk sheep genome can significantly affect the body length trait of Suffolk sheep.
[0046] Association analysis was performed on the SNP locus at position 6085918 on chromosome 13 of the Suffolk sheep genome with the body length trait. The results are shown in Table 3.
[0047] Table 3. Polymorphism at position 6085918 on chromosome 13 of the Suffolk sheep genome.
[0048] Note: In the "body length" column of Table 3, different lowercase letters indicate significant differences. P <0.05; the same letter indicates no significant difference.P >0.05.
[0049] As shown in Table 3, individuals with the CC genotype have the longest body length, while individuals with the TT genotype have the shortest body length.
[0050] In the genome-wide association analysis, the SNP molecular marker at position 6085918 on chromosome 13 of the Suffolk sheep genome reached a genome-wide significance level, indicating that this molecular marker is significantly associated with the body length trait of Suffolk sheep. Furthermore, when the base of this molecular marker is C, it is beneficial for Suffolk sheep to have a longer body length, which is greater than 88 cm.
[0051] The frequency of the SNP gene and genotype at position 6085918 on chromosome 13 of the Suffolk sheep genome were then analyzed, as shown in Table 4.
[0052] Table 4. SNP gene frequency and genotype frequency at position 6085918 on chromosome 13
[0053] The nucleotide sequence of the molecular marker containing the C→T mutation site at position 6085918 on chromosome 13 is shown in SEQ ID NO.1 and SEQ ID NO.2.
[0054] SEQ ID NO.1: AAAATAATGCTTCAATGAGCATCCTATGCATTTATTCAAGGATAATGCATAGAAATGACTTTCTGGGCCCAAGAAATAAACATTTTAACTTCCAAAATATCGGCAAATTGCCTTTAAAAAATATTGCATAGCATGTCTCTAGTAGTATGCGAGAGTGCTTGCTTTCTTGTCAGCACTTGATACATTGATATTTTAAAAATA.
[0055] SEQ ID NO.2: AAAATAATGCTTCAATGAGCATCCTATGCATTTATTCAAGGATAATGCATAGAAATGACTTTCTGGGCCCAAGAAATAAACATTTTAACTTCCAAAATATTGGCAAATTGCCTTTAAAAAATATTGCATAGCATGTCTCTAGTAGTATGCGAGAGTGCTTGCTTTCTTGTCAGCACTTGATACATTGATATTTTAAAAATA.
[0056] Based on the above results, we can see that: When the molecular marker base at position 6085918 on chromosome 13 of the Suffolk sheep genome is C, long-bodied Suffolk sheep breeds are selected. Individuals with the CC genotype are selected as paternal or maternal parents to increase the body length of Suffolk sheep offspring.
[0057] It should be noted that when numerical ranges are mentioned in the claims of this invention, it should be understood that the two endpoints of each numerical range and any value between the two endpoints can be selected. To avoid redundancy, the present invention describes preferred embodiments.
[0058] The technical features of the above embodiments can be combined in any way. For the sake of brevity, not all possible combinations of the technical features in the above embodiments are described. However, as long as there is no contradiction in the combination of these technical features, they should be considered to be within the scope of this specification.
[0059] The embodiments described above are merely illustrative of several implementations of the present invention, and while the descriptions are specific and detailed, they should not be construed as limiting the scope of the invention. Those skilled in the art can make various modifications and improvements without departing from the concept of the present invention, and these all fall within the scope of protection of the present invention. Therefore, the scope of protection of this invention should be determined by the appended claims.
Claims
1. The application of a molecular marker affecting sheep body length traits, characterized in that, The molecular marker is the nucleotide sequence shown in SEQ ID NO.2, where the nucleotide at the 101 bp site is either T or C; The application refers to any one of the following (1) and (2): (1) Determine the body length of the sheep; (2) Increase the body length of sheep offspring.
2. The application as described in claim 1, characterized in that, The methods for determining the body length of a sheep are as follows: Genomic DNA was extracted from the sheep to be tested and sequenced. Determine the genotype of the sheep at position 101bp of SEQ ID NO.2; If the genotype at 101bp of SEQ ID NO.2 is CC, then the sheep is of long body length, which means a body length greater than 88cm.
3. The application as described in claim 1, characterized in that, The methods to increase the body length of sheep offspring are: Genomic DNA was extracted from the sheep to be tested and sequenced. Determine the genotype of the sheep at position 101bp of SEQ ID NO.2; By selecting sheep individuals with the genotype CC at 101bp of SEQ ID NO.2 as parents for breeding, the body length of sheep offspring can be increased.
4. The application as described in claim 2 or claim 3, characterized in that, The genomic DNA was derived from sheep blood.
5. The application as described in claim 2 or claim 3, characterized in that, The genomic DNA was extracted using the phenol-chloroform method.
6. The application as described in claim 1, characterized in that, The sheep in question are Suffolk sheep.
7. The application as described in claim 1, characterized in that, The body length refers to: The straight-line distance from the front of the sheep's scapula to the back of the ischial tuberosity.