Heterozygous micromyodystrophy protein gene and its uses

Abstract

The present application provides a chimeric protein comprising a dystrophin domain and a utrophin domain, and a polynucleotide, a vector, an AAV viral particle or a pharmaceutical composition thereof. The present application also provides a method for treating a disease.

Description

[0001] priority This application claims the benefit and priority of PCT International Application No. PCT / CN2025 / 075408, filed on January 27, 2025. The entire contents of PCT / CN2025 / 075408 are incorporated herein by reference for all purposes. Technical Field

[0002] This disclosure generally relates to the heterozygous micromyotrophic dystrophin gene and its uses. Background Technology

[0003] Duchenne muscular dystrophy (DMD) is a progressive muscular dystrophy that affects approximately 1 in 5,000 live male births. Globally, about 300,000 boys have DMD, with an estimated 60,000 to 100,000 cases in China and 24,000 in the United States. This progressive condition is caused by a defective gene responsible for producing dystrophin, a key muscle protein. A lack of dystrophin makes cells susceptible to damage and death, potentially leading to heart and respiratory failure. Typically, boys with DMD begin showing symptoms before age 5 and are usually diagnosed at this time. As the disease progresses, they are often confined to a wheelchair by age 12. Unfortunately, most patients do not survive to age 25. Boys with typical symptoms of muscular dystrophy and elevated plasma creatine kinase (CK) levels should undergo genetic testing to confirm the diagnosis. The disease is characterized by reduced muscle mass, weakness, and potential cognitive impairment. In adolescents, pneumonia can also occur due to diaphragmatic weakness, requiring mechanical ventilation. Other complications include heart failure due to decreased cardiac function and cardiomyopathy, as well as muscle inflammation and fibrosis.

[0004] 2.4 The full-length Mb DMD gene contains 8 promoters and 79 exons. Three upstream promoters (Dp427b, Dp427m, and Dp427p) produce an 11.4 kb full-length cDNA and a 427 kDa full-length dystrophin. Four internal promoters (Dp260, Dp140, Dp116, and Dp71) produce an N-terminal truncated non-muscular dystrophin subtype. 3'-terminal alternative splicing and alternative polyadenylation (adding a poly(A) tail to the RNA) produce additional dystrophin subtypes, such as Dp40. The full-length protein produced by Dp427m is the predominant muscle subtype. Deletions and duplications are concentrated in hotspot regions in DMD, located at exons 45-55 and 3-9; approximately 47% and 7% of DMD patients have mutations in these hotspots, respectively. Duan D, Goemans N, Takeda S, Mercuri E, Aartsma-Rus A. Duchenne muscular dystrophy. at Rev Dis Primers. 2021;7(1):13. Published 2021 Feb 18. doi:10.1038 / s41572-021-00248-3 ).

[0005] Tissue representation of muscular dystrophy and dystrophin-glycoprotein complex. Schematic tissue characterization of the dystrophin-glycoprotein complex (DGC) and the etiology of muscular dystrophy. Dystrophin interacts with cytoplasmic, transmembrane, and extracellular proteins in skeletal muscle, similar to how spectroscopy proteins in erythrocytes interact with the overall and peripheral members of the cytoskeleton. Mutations in dystrophin and other members of DGC result in various muscular dystrophys (Table 1). BMD, Becker's muscular dystrophy; CMD, congenital muscular dystrophy; CYS, cysteine; DG, dystrophin proteoglycan; DMD, Duchenne muscular dystrophy; LGMD, umbilical cord muscular dystrophy; NOS, nitric oxide synthase. Khurana TS, Davies KE. Pharmacological strategies for muscular dystrophy. Nat Rev Drug Discov. 2003;2(5):379-390. doi:10.1038 / nrd1085 ).

[0006] The multifaceted pathology associated with DMD poses a major challenge to the development and clinical implementation of effective therapies for the disease. Currently, various treatment strategies are being used to treat DMD. The most active area of ​​research is the "gene replacement" strategy (see [link to relevant documentation]). Oshima et al. (2009) J. Am. Soc.Gene Ther. 17:73-80; Liu et al. (2005) Mol. Ther. 11:245-56; Lai et al. (2006) Hum Gene Ther. 17:1036-42; Odom et al. (2008) Mol. Ther. 16:1539-45 This method involves delivering a copy of the functional dystrophin gene to a patient using a viral delivery vector (typically adeno-associated virus (AAV)) that can deliver a micro-dystrophin construct to all striated muscles. However, the large size of the dystrophin gene makes it incompatible with the limited carrying capacity of common viral vectors. This necessitates the use of a “micro-dystrophin” gene, in which most of the repetitive central portion of the gene is removed to leave only the minimal functional protein. However, it remains unclear whether the expression of “micro-dystrophin” is sufficient to provide clinical benefit. Furthermore, this approach carries the risk of random gene integration into the patient's genome, potentially leading to insertional mutations and possibly triggering an immune response against the delivery vector. Therefore, micro-dystrophin gene therapy still has several significant drawbacks. Thus, alternative gene therapies for treating DMD are urgently needed. Several methods have been developed to construct chimeric proteins with an N-terminal portion from utrophin and a C-terminal portion from dystrophin, demonstrating promising therapeutic effects. Improving performance and evading T-cell-mediated immunity remains a challenge. Summary of the Invention

[0007] On one hand, this disclosure provides a chimeric protein comprising a dystrophin domain and a myotroph-associated protein domain, wherein the chimeric protein comprises the following peptide segments sequentially from the 5' end to the 3' end: a) The first peptide segment, comprising the amino acid sequence of myotrophic-associated protein from the N-terminus to spectrin-like repeat sequence 1, 2 or 3 (uR1, uR2 or uR3); or comprising the amino acid sequence of myotrophic-associated protein from the N-terminus to hinge region 1 (uH1), and dystrophin R1 and R2. b) A second peptide segment comprising the amino acid sequence of dystrophin hinge region 3 (H3); or comprising the amino acid sequence of dystrophin R16 and R17; or comprising the amino acid sequence of dystrophin R16, R17 and H3; or comprising the amino acid sequence of the N-terminus of dystrophin R16 and R17 and the C-terminus of R22; or comprising the amino acid sequence of myotrophic-associated protein uR15 and uR16; or comprising the amino acid sequence of myotrophic-associated protein uR15, uR16 and dystrophin H3; c) The third peptide segment, comprising the amino acid sequence of dystrophin from R24 to the cysteine-rich domain (CR) and the truncated C-terminal domain (sCTD) of dystrophin; or comprising the amino acid sequence of dystrophin from R24 to the CR domain; or comprising the amino acid sequence of dystrophin from R23 to the CR domain; or comprising the amino acid sequence of dystrophin R23, H4 and CR domains.

[0008] In some embodiments, this disclosure provides a chimeric protein comprising, sequentially from the 5' end to the 3' end, the following peptide segments: A) The first peptide segment contains the amino acid sequences of the N-terminal domain (uNTD) of myotrophic-associated protein, the hinge region 1 (uH1) of myotrophic-associated protein, the spectrin-like repeat sequence 1 (uR1) of myotrophic-associated protein, the spectrin-like repeat sequence 2 (uR2) of myotrophic-associated protein, and the spectrin-like repeat sequence 3 (uR3) of myotrophic-associated protein. b) The second peptide segment, which contains the amino acid sequence of dystrophin hinge region 3 (H3); c) The third peptide segment, comprising the amino acid sequence of 24 spectral repeats of dystrophin (R24), 4 spectral region of dystrophin (H4), 4 cysteine-rich domain of dystrophin (CR), and a truncated C-terminal domain of dystrophin (sCTD); or comprising the amino acid sequence of 24 spectral repeats of dystrophin (R24), 4 spectral region of dystrophin (H4), and 4 cysteine-rich domain of dystrophin (CR); or comprising the amino acid sequence of 23 spectral repeats of dystrophin (R23), 24 spectral repeats of dystrophin (R24), 4 spectral region of dystrophin (H4), and 4 cysteine-rich domain of dystrophin (CR).

[0009] In some embodiments, this disclosure provides a chimeric protein comprising, sequentially from the 5' end to the 3' end, the following peptide segments: a) The first peptide segment contains the amino acid sequences of the N-terminal domain (uNTD) of myotrophic-associated protein, the hinge region 1 (uH1) of myotrophic-associated protein, the spectrin-like repeat sequence 1 (uR1) of myotrophic-associated protein, and the spectrin-like repeat sequence 2 (uR2) of myotrophic-associated protein. b) The second peptide segment contains the amino acid sequences of dystrophin spectrin-like repeat sequence 16 (R16) and dystrophin spectrin-like repeat sequence 17 (R17). c) The third peptide segment, comprising an amino acid sequence of dystrophin spectrin-like repeat 23 (R23), dystrophin hinge region 4 (H4), and dystrophin cysteine-rich domain (CR); or comprising an amino acid sequence of dystrophin spectrin-like repeat 23 (R23), dystrophin spectrin-like repeat 24 (R24), dystrophin hinge region 4 (H4), and dystrophin cysteine-rich domain (CR).

[0010] In some embodiments, this disclosure provides a chimeric protein comprising, sequentially from the 5' end to the 3' end, the following peptide segments: a) The first peptide segment contains the amino acid sequence of the N-terminal domain (uNTD), hinge region 1 (uH1), and spectrin-like repeat 1 (uR1) of myotrophic-associated protein. b) The second peptide segment contains the amino acid sequence of dystrophin spectrin-like repeat 16 (R16), dystrophin spectrin-like repeat 17 (R17), and dystrophin hinge region 3 (H3). c) The third peptide segment contains the amino acid sequence of dystrophin spectroscopy-like repeat 24 (R24), dystrophin hinge region 4 (H4), dystrophin cysteine-rich domain (CR), and truncated dystrophin C-terminal domain (sCTD).

[0011] In some embodiments, this disclosure provides a chimeric protein comprising, sequentially from the 5' end to the 3' end, the following peptide segments: a) The first peptide segment contains the amino acid sequence of the N-terminal domain (uNTD), hinge region 1 (uH1), and spectrin-like repeat 1 (uR1) of myotrophic-associated protein. b) The second peptide segment contains the amino acid sequences of myotrophic-associated protein spectrin-like repeat 15 (uR15), myotrophic-associated protein spectrin-like repeat 16 (uR16), and dystrophin hinge region 3 (H3). c) The third peptide segment contains the amino acid sequence of dystrophin spectrin-like repeat 23 (R23), dystrophin spectrin-like repeat 24 (R24), dystrophin hinge region 4 (H4), and dystrophin cysteine-rich domain (CR).

[0012] In some embodiments, this disclosure provides a chimeric protein comprising, sequentially from the 5' end to the 3' end, the following peptide segments: a) The first peptide segment contains the amino acid sequences of the N-terminal domain (uNTD) of myotrophic-associated protein, the hinge region 1 (uH1) of myotrophic-associated protein, the spectrin-like repeat sequence 1 (uR1) of myotrophic-associated protein, and the spectrin-like repeat sequence 2 (uR2) of myotrophic-associated protein. b) The second peptide segment contains the amino acid sequences of myotrophic-associated protein spectrin-like repeat 15 (uR15) and myotrophic-associated protein spectrin-like repeat 16 (uR16). c) The third peptide segment contains the amino acid sequence of dystrophin spectrin-like repeat 23 (R23), dystrophin spectrin-like repeat 24 (R24), dystrophin hinge region 4 (H4), and dystrophin cysteine-rich domain (CR).

[0013] In some embodiments, this disclosure provides a chimeric protein comprising, sequentially from the 5' end to the 3' end, the following peptide segments: a) The first peptide segment contains the amino acid sequences of the N-terminal domain (uNTD) of myotrophic-associated protein, the hinge region 1 (uH1) of myotrophic-associated protein, the spectrin-like repeat sequence 1 (R1) of dystrophin and the spectrin-like repeat sequence 2 (R2) of dystrophin. b) The second peptide segment contains the amino acid sequence of dystrophin spectrin-like repeat 16 (R16) and dystrophin spectrin-like repeat 17 heterozygous 22 (R17 / 22). c) The third peptide segment contains the amino acid sequence of dystrophin spectrin-like repeat 23 (R23), dystrophin spectrin-like repeat 24 (R24), dystrophin hinge region 4 (H4), and dystrophin cysteine-rich domain (CR).

[0014] In some embodiments, the N-terminal domain (uNTD) of the myotrophic-associated protein contains an amino acid sequence that is at least 80%, 85%, 90%, 95%, 98%, or 99%, 100% identical to SEQ ID NO: 21.

[0015] In some embodiments, the myotrophic-associated protein hinge region 1 (uH1) contains an amino acid sequence that is at least 80%, 85%, 90%, 95%, 98%, or 99%, 100% identical to SEQ ID NO: 22.

[0016] In some embodiments, the myotrophic-associated protein spectroscopy-like repeat sequence 1 (uR1) comprises an amino acid sequence having at least 80%, 85%, 90%, 95%, 98%, or 99%, 100% identity with SEQ ID NO: 23.

[0017] In some embodiments, the myotrophic-associated protein spectroscopy-like repeat sequence 2 (uR2) comprises an amino acid sequence having at least 80%, 85%, 90%, 95%, 98%, or 99%, 100% identity with SEQ ID NO: 24.

[0018] In some embodiments, the myotrophic-associated protein spectroscopy-like repeat sequence 3 (uR3) comprises an amino acid sequence having at least 80%, 85%, 90%, 95%, 98%, or 99%, 100% identity with SEQ ID NO: 25.

[0019] In some embodiments, the myotrophic-associated protein spectroscopy-like repeat sequence 15 (uR15) comprises an amino acid sequence having at least 80%, 85%, 90%, 95%, 98%, or 99%, 100% identity with SEQ ID NO: 26.

[0020] In some embodiments, the myotrophic-associated protein spectroscopy-like repeat sequence 16 (uR16) comprises an amino acid sequence having at least 80%, 85%, 90%, 95%, 98%, or 99%, 100% identity with SEQ ID NO: 27.

[0021] In some embodiments, the dystrophin spectrin-like repeat sequence 1 (R1) comprises an amino acid sequence having at least 80%, 85%, 90%, 95%, 98% or 99%, 100% identity with SEQ ID NO: 28.

[0022] In some embodiments, the dystrophin spectrin-like repeat sequence 2 (R2) comprises an amino acid sequence having at least 80%, 85%, 90%, 95%, 98% or 99%, 100% identity with SEQ ID NO: 29.

[0023] In some embodiments, the dystrophin spectroscopy-like repeat sequence 16 (R16) comprises an amino acid sequence having at least 80%, 85%, 90%, 95%, 98% or 99%, 100% identity with SEQ ID NO: 30.

[0024] In some embodiments, the dystrophin spectrin-like repeat sequence 17 (R17) comprises an amino acid sequence having at least 80%, 85%, 90%, 95%, 98%, or 99%, 100% identity with SEQ ID NO: 31.

[0025] In some embodiments, the dystrophin spectrin-like repeat sequence 17 heterozygous 22 (R17 / 22) comprises an amino acid sequence having at least 80%, 85%, 90%, 95%, 98% or 99%, 100% identity with SEQ ID NO: 32.

[0026] In some embodiments, the dystrophin spectroscopy-like repeat sequence 23 (R23) comprises an amino acid sequence having at least 80%, 85%, 90%, 95%, 98% or 99%, 100% identity with SEQ ID NO: 33.

[0027] In some embodiments, the dystrophin spectroscopy-like repeat sequence 24 (R24) comprises an amino acid sequence having at least 80%, 85%, 90%, 95%, 98% or 99%, 100% identity with SEQ ID NO: 34.

[0028] In some embodiments, the dystrophin hinge region 3 (H3) comprises an amino acid sequence having at least 80%, 85%, 90%, 95%, 98%, or 99%, 100% identity with SEQ ID NO: 35.

[0029] In some embodiments, the dystrophin hinge region 4 (H4) contains an amino acid sequence that is at least 80%, 85%, 90%, 95%, 98% or 99%, 100% identical to SEQ ID NO: 36.

[0030] In some embodiments, the cysteine-rich domain (CR) of the dystrophin contains an amino acid sequence that is at least 80%, 85%, 90%, 95%, 98%, or 99%, 100% identical to SEQ ID NO: 37.

[0031] In some embodiments, the truncated dystrophin C-terminal domain (sCTD) comprises an amino acid sequence having at least 80%, 85%, 90%, 95%, 98%, or 99%, 100% identity with SEQ ID NO: 38.

[0032] In some embodiments, the chimeric protein comprises an amino acid sequence having at least 80%, 85%, 90%, 95%, 98%, or 99%, 100% identity with any one of SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 10, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 16, SEQ ID NO: 18, and SEQ ID NO: 20.

[0033] In some embodiments, the chimeric protein comprises a first peptide, a second peptide, and a third peptide, wherein the first peptide comprises an amino acid sequence of muscular dystrophy-associated protein from the N-terminus to spectroscopy-like repeat 3 (uR3), the second peptide comprises an amino acid sequence of dystrophin hinge region 3 (H3), and the third peptide comprises a dystrophin domain from R24 to the cysteine-rich (CR) domain and a truncated dystrophin C-terminal domain (sCTD).

[0034] In some embodiments, the chimeric protein comprises a first peptide, a second peptide, and a third peptide, wherein the first peptide comprises the amino acid sequence of a myotroph-associated protein from the N-terminus to uR1, the second peptide comprises the amino acid sequence of dystrophin R16, R17, and H3, and the third peptide comprises a dystrophin domain from R24 to the cysteine-rich (CR) domain and a truncated dystrophin C-terminal domain (sCTD).

[0035] In some embodiments, the chimeric protein comprises a first peptide, a second peptide, and a third peptide, wherein the first peptide comprises the amino acid sequence of a myotroph-associated protein from the N-terminus to uR3, the second peptide comprises the amino acid sequence of dystrophin H3, and the third peptide comprises the amino acid sequence of dystrophin from R24 to the CR domain.

[0036] In some embodiments, the chimeric protein comprises a first peptide, a second peptide, and a third peptide, wherein the first peptide comprises the amino acid sequence of a myotroph-associated protein from the N-terminus to R3, the second peptide comprises the amino acid sequence of dystrophin H3, and the third peptide comprises the amino acid sequence of dystrophin from R23 to the CR domain.

[0037] In some embodiments, the chimeric protein comprises a first peptide, a second peptide, and a third peptide, wherein the first peptide comprises the amino acid sequence of a myotroph-associated protein from the N-terminus to uR2, the second peptide comprises the amino acid sequence of dystrophin R16 and R17, and the third peptide comprises the amino acid sequence of dystrophin R23, H4, and CR domains.

[0038] In some embodiments, the chimeric protein comprises a first peptide, a second peptide, and a third peptide, wherein the first peptide comprises the amino acid sequence of myotrophic-associated protein from the N-terminus to uR1, the second peptide comprises the amino acid sequences of myotrophic-associated protein uR15, uR16 and dystrophin H3, and the third peptide comprises the amino acid sequence of dystrophin from R23 to the CR domain.

[0039] In some embodiments, the chimeric protein comprises a first peptide, a second peptide, and a third peptide, wherein the first peptide comprises the amino acid sequence of myotrophic-associated protein from the N-terminus to hinge region 1 (uH1) and dystrophin R1 and R2, the second peptide comprises the amino acid sequence of dystrophin R16 and R17 from the N-terminus and R22 from the C-terminus, and the third peptide comprises the amino acid sequence of dystrophin from R23 to the CR domain.

[0040] In some embodiments, the chimeric protein comprises a first peptide, a second peptide, and a third peptide, wherein the first peptide comprises the amino acid sequence of a myotroph-associated protein from the N-terminus to uR2, the second peptide comprises the amino acid sequence of dystrophin R16 and R17, and the third peptide comprises the amino acid sequence of dystrophin from R23 to the CR domain.

[0041] In some embodiments, the chimeric protein comprises a first peptide, a second peptide, and a third peptide, wherein the first peptide comprises the amino acid sequence of a myotroph-associated protein from the N-terminus to uR2, the second peptide comprises the amino acid sequences of myotroph-associated proteins uR15 and uR16, and the third peptide comprises the amino acid sequence of a dystrophin from R23 to the CR domain.

[0042] On the one hand, this disclosure provides a polynucleotide comprising a nucleotide sequence encoding the chimeric protein described herein.

[0043] In some embodiments, the polynucleotide comprises a nucleotide sequence having at least 80%, 85%, 90%, 95%, 98%, or 99%, 100% identity with any one of SEQ ID NO: 9, SEQ ID NO: 17, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO: 11, SEQ ID NO: 13, SEQ ID NO: 15, and SEQ ID NO: 19.

[0044] In some embodiments, the polynucleotide comprises a nucleotide sequence selected from any one of SEQ ID NO: 9, SEQ ID NO: 17, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO: 11, SEQ ID NO: 13, SEQ ID NO: 15 and SEQ ID NO: 19.

[0045] On the one hand, this disclosure provides a carrier containing the polynucleotides described herein.

[0046] In some embodiments, the vector is a viral vector. Preferably, the viral vector is selected from retroviruses, adenoviruses, herpesviruses, baculoviruses, modified baculoviruses, papillomaviruses, AAV viral vectors, lentiviral vectors, adenovirus vectors, and alphavirus vectors. More preferably, the viral vector is an AAV viral vector.

[0047] On one hand, this disclosure provides a recombinant AAV particle comprising the carrier described in this disclosure encapsulated within an AAV capsid.

[0048] In some embodiments, the AAV capsid comprises a capsid protein derived from any AAV serotype or variant thereof, such as AAV1, AAV2, AAV3, AAV3B, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAV13, AAVrh10, AAVhu37, or isolated from humans and non-human mammals.

[0049] On the one hand, this disclosure provides a composition comprising the AAV particles or carrier described herein and a pharmaceutically acceptable excipient.

[0050] On the one hand, this disclosure provides the use of the chimeric proteins, polynucleotides, carriers, recombinant AAV particles or compositions described herein in the preparation of medicaments for treating diseases or conditions in subjects.

[0051] On the one hand, this disclosure provides a method for treating a disease or condition in a subject in need, comprising administering to the subject the chimeric protein, polynucleotide, carrier, recombinant AAV particles or composition described in this disclosure.

[0052] In some embodiments, the disease or condition is a skeletal muscle disease, preferably Duchenne muscular dystrophy (DMD).

[0053] In some implementations, the subject is a human being.

[0054] By incorporating references All publications, documents, patents and patent applications mentioned in this disclosure, including all forms and figures, are incorporated herein by reference as if each individual publication, patent or patent application were specifically and individually indicated as incorporated by reference.

[0055] For illustrative purposes, the principles of the invention are described by reference to various exemplary embodiments. Although certain embodiments of the invention are specifically described herein, those skilled in the art will readily recognize that the same principles are equally applicable to other systems and methods, and can be employed in other systems and methods. Before explaining the disclosed embodiments of the invention in detail, it should be understood that the application of the invention is not limited to the details of any particular embodiment shown. Furthermore, the terminology used herein is for descriptive purposes and not for limitation. Moreover, although some methods are described with reference to steps presented in a particular order herein, in many cases these steps can be performed in any order that would be understood by those skilled in the art; therefore, the invention is not limited to the specific order of steps disclosed herein. Attached Figure Description

[0056] Some embodiments of the invention have been described herein by way of example only with reference to the accompanying drawings. It is now emphasized, with detailed reference to the drawings, that the details shown are by way of example and for the purpose of illustrative discussion of embodiments of the invention. In this regard, the description taken in conjunction with the drawings will make it clear to those skilled in the art how to practice embodiments of the invention.

[0057] Figure 1 The domain structures of dystrophin and myotroph-associated protein are shown.

[0058] Figure 2 The domain structures of dystrophin in clinical settings are shown.

[0059] Figure 3 The domain structures of the hybrid micromyotrophic protein are shown.

[0060] Figure 4 The comparison of mRNA expression of heterozygous μdys is shown.

[0061] Figure 5 The protein expression of heterozygous μdys is shown. A: diaphragmatic protein; B: quadriceps femoris protein; for HB4, HC2, HC7, HC15, HE10, HE11, HE33, the anti-DMD antibody is PA5-110894 (thermos; 1:2000); for HB2, HB3, HB4, the anti-DMD antibody is CAU22354 (biomatik; 1:2000), solvent group: formulation buffer.

[0062] Figure 6 Anatomical diagrams of the diaphragm of D2.mdx treated with different heterozygous μdys at 8 weeks post-injection (wpi) are shown.

[0063] Figure 7 The fibrosis of the diaphragm of D2.mdx treated with different heterozygous μdys at 8 weeks post-injection (wpi) is shown.

[0064] Figure 8 The septum and quadriceps muscle of D2.mdx injected with heterozygous μdys are shown with H&E staining.

[0065] Figure 9 Immunofluorescence of gastrocnemius muscle injected with heterozygous μdys is shown. Dystrophin (green) and DAPI (blue); scale bar, 100 μm.

[0066] Figure 10 The effect of 8 weeks of treatment on the specific strength of the tibialis anterior muscle in MDX mice was shown. The solvent group consisted of MDX mice treated with the solvent. HB3 to HE11 mice were MDX mice treated with 1E14 vg / kg AVT913-μDys. Balbc was the wild-type control. One-way ANOVA and post-hoc Tukey multiple comparison tests were used. P<0.05, P<0.01, data are expressed as mean ± SD. Detailed Implementation

[0067] Embodiments according to this disclosure will be described more fully below. However, aspects of this disclosure may be embodied in different forms and should not be construed as limited to the embodiments set forth herein. Rather, these embodiments are provided to make this disclosure comprehensive and complete, and to fully convey the scope of the invention to those skilled in the art. The terminology used in the description herein is for descriptive purposes only and is not intended to be limiting.

[0068] Unless otherwise defined, all terms used herein (including technical and scientific terms) shall have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains. It should also be understood that terms such as those defined in common dictionaries shall be interpreted as having a meaning consistent with their meaning in the context of this application and related fields, and shall not be interpreted as having an idealized or overly formalized meaning, unless expressly so defined herein.

[0069] definition As used herein, the singular forms “a,” “an,” and “the” include plural references unless the context clearly specifies otherwise. For example, the term “substitute” or “at least one substitute” may include multiple substitutes, and the term “a domain” or “the domain” may include multiple domains.

[0070] As used herein, the term "about" or "approximately" refers to a quantity, level, value, quantity, frequency, frequency, frequency, frequency, percentage, size, size, amount, weight, or length that differs from a reference quantity, level, value, amount, frequency, frequency, frequency, weight, or length by as much as 30%, 25%, 20%, 25%, 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, or 1%. In certain embodiments, when preceding a numerical value, the term "about" or "approximately" indicates a range of 15%, 10%, 5%, or 1% added to or subtracted from that value.

[0071] As used herein, the terms “comprising,” “including,” and “containing” imply the inclusion of the stated step or element or group of steps or elements, but do not exclude any other step or element or group of steps or elements. For example, “variant includes substitution” may include further substitution.

[0072] Throughout this disclosure, references to “an embodiment,” “an embodiment,” “some embodiments,” “a particular embodiment,” “a related embodiment,” “a certain embodiment,” “an additional embodiment,” or “another embodiment,” or combinations thereof, mean that a particular feature, structure, or characteristic described in connection with that embodiment is included in at least one embodiment of this disclosure. Therefore, the foregoing phrases appearing in various places throughout this specification do not necessarily refer to the same embodiment. Furthermore, a particular feature, structure, or characteristic may be combined in any suitable manner in one or more embodiments.

[0073] As used herein, the term "amino acid" refers to any organic compound containing an amino group (-NH2) and a carboxyl group (-COOH), preferably as a free group or as part of a peptide bond after condensation. "Twenty naturally encoded polypeptides forming α-amino acids" is understood in the art and refers to: alanine (Ala or A), arginine (Arg or R), asparagine (Asn or N), aspartic acid (Asp or D), cysteine ​​(Cys or C), glutamic acid (Glu or E), glutamine (Gln or Q), glycine (Gly or G), histidine (His or H), isoleucine (Ile or I), leucine (Leu or L), lysine (Lys or K), methionine (Met or M), phenylalanine (Phe or F), proline (Pro or P), serine (Ser or S), threonine (Thr or T), tryptophan (Trp or W), tyrosine (Tyr or Y), and valine (Val or V).

[0074] The term "peptide" typically refers to a short polypeptide. The term "protein" typically refers to a longer polypeptide. The left-hand end of a polypeptide sequence is usually described as the amino terminus (N-terminus); the right-hand end of a polypeptide sequence is usually described as the carboxyl terminus (C-terminus).

[0075] As used herein, the term "identity" refers to the relationship between the sequences of two or more polypeptide molecules or two or more nucleic acid molecules, determined by alignment and comparison of sequences. "Identity percentage" refers to the percentage of identical residues among the amino acids or nucleotides in the compared molecules and is calculated based on the size of the smallest molecule among those compared. For these calculations, gaps in alignment (if any) are preferably resolved using a specific mathematical model or computer program (i.e., an "algorithm"). Methods that can be used to compute the identity of aligned nucleic acids or peptides include those found in *Computational Molecular Biology* (Lesk, AM, ed.), 1988, New York: Oxford University Press; *Biocomputing Informatics and Genome Projects* (Smith, DW, ed.), 1993, New York: Academic Press; *Computer Analysis of Sequence Data, Part I* (Griffin, AM, and Griffin, HG, eds.), 1994, New Jersey: Humana Press; von Heinje, G., 1987, *Sequence Analysis in Molecular Biology*, New York: Academic Press; and *Sequence Analysis Primer* (Gribskov, M. and Devereux, J., eds., 1991, New York: M. Stockton). Press; and those described in Carillo et al, 1988, SIAMJ. Applied Math. 48: 1073.

[0076] As used herein, the term "vector" refers to a nucleic acid molecule capable of replicating another nucleic acid linked to it. This term includes vectors that function as autonomously replicating nucleic acid structures as well as vectors incorporated into the genome of a host cell into which they have been introduced. Some vectors can direct the expression of the nucleic acid to which they are operatively linked. Such vectors are referred to herein as "expression vectors." As used herein, the term "vector" refers to a nucleic acid containing, substantially consisting of, or composed of a complete replicon, such that when said vector is placed inside a cell by, for example, transfection, infection, or transformation. It should be understood in the art that once inside a cell, a vector can replicate as an extrachromosomal (free) element or can integrate into the host cell chromosome. Vectors may include nucleic acids derived from retroviruses, adenoviruses, herpesviruses, baculoviruses, modified baculoviruses, papillomaviruses, AAV viral vectors, lentiviral vectors, adenovirus vectors, alphavirus vectors, etc. Alphavirus vectors, such as Semliki forest virus-based vectors and Sindbis virus-based vectors, have also been developed for gene therapy and immunotherapy. See, for example... Schlesinger and Dubensky 1999 Curr.Opin.Biotechnol.5:434- 439 and Ying, et al. (1999) Nat.Med. 5(7):823-827 .

[0077] As used herein, the terms “subject” and “patient” are used interchangeably and can refer to mammals in need of cancer prevention or treatment, such as primates (e.g., humans), companion animals (e.g., dogs and cats), livestock (e.g., cattle, pigs, horses, sheep, and goats), and laboratory animals (e.g., rats, mice, and guinea pigs). In one embodiment of this disclosure, the subject is a human.

[0078] As used herein, the terms "treatment" or "treatment" generally refer to achieving a desired pharmacological and / or physiological effect. This effect may manifest as a therapeutic action, including partial or complete cure of the disease, and / or elimination of adverse reactions caused by the disease. Desired therapeutic effects include, but are not limited to, prevention of disease onset or recurrence, relief of symptoms, reduction of any direct or indirect pathological consequences of the disease, prevention of metastasis, reduction of the rate of disease progression, improvement or slowing of the disease state, and relief or improvement of prognosis. Preferably, "treatment" may refer to a medical intervention for an already developed disease or condition.

[0079] As used herein, the term “application” refers to the administration of a subspecies to a subject for the purpose of achieving a preventive or therapeutic effect (e.g., prevention or treatment of cancer).

[0080] As used herein, the term "pharmaceutically acceptable" means that the carrier, diluent, excipient and / or its salt are chemically and / or physically compatible with other components in the formulation and physiologically compatible with the subject.

[0081] As used herein, the term "pharmaceutically acceptable carrier and / or excipient" means a carrier and / or excipient that is pharmacologically and / or physiologically compatible with the subject and the active agent, and is well known in the art (see, for example, Remington's Pharmaceutical Sciences. Edited by Gennaro AR, 19th ed. Pennsylvania: Mack Publishing Company, 1995This includes, but is not limited to, pH adjusters, surfactants, adjuvants, and ionic strength enhancers. For example, pH adjusters include, but are not limited to, phosphate buffers; surfactants include, but are not limited to, cationic, anionic, or nonionic surfactants, such as Tween-80; and ionic strength enhancers include, but are not limited to, sodium chloride.

[0082] As used herein, the term "adeno-associated virus" or "AAV" refers to a member of the viral class associated with that name and belonging to the genus *Parvovirus-dependent* within the family Parvoviridae. Adeno-associated virus is a single-stranded DNA virus that grows only in cells, where some functions are provided by co-infecting helper viruses. All AAV serotypes exhibit remarkably similar replication characteristics mediated by homologous rep genes; and all carry three associated capsid proteins. At least 13 naturally occurring AAV serotypes are known in the art by serial number. Non-limiting exemplary serotypes used in the methods disclosed herein include any of these 13 serotypes, such as AAV2, AAV8, AAV9, or variant serotypes such as AAV-DJ and AAV PHP.B. AAV particles contain three major viral proteins, VP1, VP2, and VP3, and are substantially composed of or consist of said proteins. In the embodiments, the AAV particles comprise an AAV capsid protein selected from the group consisting of AAVPHP.B, AAVrh74, AAV110, AAV204, AAV214, AAV214A, AAV214e, AAV214e8, AAV214e9, AAV214e10, AAVTB102_45, and AAV214AB. In the embodiments, the AAV refers to serotypes AAV1, AAV2, AAV3, AAV3B, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, or AAV13, AAVrh10, AAVhu37, or any AAV serotype isolated from humans and non-human mammals, or a variant thereof. In this embodiment, the AAV particles include those selected from AAV1, AAV2, AAV2G9, AAV3, AAV3a, AAV3b, AAV3-3, AAV4, AAV4-4, AAV5, AAV6, AAV6.1, AAV6.2, AAV6.1.2, AAV7, AAV7.2, AAV8, AAV9, AAV9.11, AAV9.13, AAV9.16, AAV9.24, AAV9.45, AAV9.47, AAV9.61, AAV9.68, AAV9.84, AAV9.9, and AAV10. AAV11, AAV12, AAV16.3, AAV24.1, AAV27.3, AAV42.12, AAV42-1b, AAV42-2, AAV42-3a, AAV42-3b, AAV42-4, AAV42-5a, AAV42-5b, AAV42-6b, AAV42-8, AAV42-10, AAV42-11, AAV42-12, AAV42-13, AAV42-15, AAV42-aa, AAV43-1, AAV43-12, AAV43-20, AAV43-21,AAV43-23、AAV43-25、AAV43-5、AAV44.1、AAV44.2、AAV44.5、AAV223.1、AAV223.2、AAV223.4、AAV223.5、AAV223.6、AAV223.7、AAV1-7 / rh.48、AAV1-8 / rh.49、AAV2-15 / rh.62、AAV2-3 / rh.61、AAV2-4 / rh.50、AAV2-5 / rh.51、AAV3.1 / hu.6、AAV3.1 / hu.9、AAV3-9 / rh.52、AAV3-11 / rh.53、AAV4-8 / r11.64、A AV4-9 / rh.54、AAV4-19 / rh.55、AAV5-3 / rh.57、AAV5-22 / rh.58、AAV7.3 / hu.7、AAV16.8 / hu.10、AAV16.12 / hu.11、AAV29.3 / bb.1、AAV29.5 / bb.2、AAV106.1 / hu.37、AAV114.3 / hu.40、AAV127.2 / hu.41、AAV127.5 / hu.42、AAV128.3 / hu.44、AAV130.4 / hu.48、AAV145.1 / hu.53、AAV145.5 / hu.54、AAV145.6 / h u.55、AAV161.10 / hu.60、AAV161.6 / hu.61、AAV33.12 / hu.17、AAV33.4 / hu.15、AAV33.8 / hu.16、AAV52 / hu.19、AAV52.1 / hu.20、AAV58.2 / hu.25、AAVA3.3、AAVA3.4、AAVA3.5、AAVA3.7、AAVC1、AAVC2、AAVC5、AAV-DJ、AAV-DJ8、AAVF3、AAVF5、AAVH2、AAVrh.72、AAVhu.8、AAVrh.68、AAVrh.70、AAVpi.1、AAVp i.3、AAVpi.2、AAVrh.60、AAVrh.44、AAVrh.65、AAVrh.55、AAVrh.47、AAVrh.69、AAVrh.45、AAVrh.59、AAVhu.12、AAVH6、AAVLK03、AAVH-1 / hu.1、AAVH-5 / hu.3、AAVLG-10 / rh.40、AAVLG-4 / rh.38、AAVLG-9 / hu.39、AAVN721-8 / rh.43、AAVCh.5、AAVCh.5R1、AAVcy.2、AAVcy.3、AAVcy.4、AAVcy.5、AAVCy.5R1、AAVCy.5R2、AAVCy.5R3、AAVCy.5R4、AAVcy.6、AAVhu.1、AAVhu.2、AAVhu.3、AAVhu.4、AAVhu.5、AAVhu.6、AAVhu.7、AAVhu.9、AAVhu.10、AAVhu.11、AAVhu.13、AAVhu.15、AAVhu.16、AAVhu.17、AAVhu.18、AAVhu.20、AAVhu.21、AAVhu.22、AAVhu.23.2、AAVhu.24、AAVhu.25、AAVhu.27、AAVhu.28、AAVhu.29、AAVhu.29R、AAVhu.31、AAVhu.32、AAVhu.34、AAVhu.35、AAVhu.37、AAVhu.39、AAVhu.40、AAVhu.41、AAVhu.42、AAVhu.43、AAVhu.44、AAVhu.44R1、AAVhu.44R2、AAVhu.44R3、AAVhu.45、AAVhu.46、AAVhu.47、AAVhu.48、AAVhu.48R1、AAVhu.48R2、AAVhu.48R3、AAVhu.49、AAVhu.51、AAVhu.52、AAVhu.54、AAVhu.55、AAVhu.56、AAVhu.57、AAVhu.58、AAVhu.60、AAVhu.61、AAVhu.63、AAVhu.64、AAVhu.66、AAVhu.67、AAVhu.14 / 9、AAVhu.t 19、AAVrh.2、AAVrh.2R、AAVrh.8、AAVrh.8R、AAVrh.10、AAVrh.12、AAVrh.13、AAVrh.13R、AAVrh.14、AAVrh.17、AAVrh.18、AAVrh.19、AAVrh.20、AAVrh.21、AAVrh.22、AAVrh.23、AAVrh.24、AAVrh.25、AAVrh.31、AAVrh.32、AAVrh.33、AAVrh.34、AAVrh.35、AAVrh.36、AAVrh.37、AAVrh.37R2、AAVrh.38、AAVrh.39、AAVrh.40、AAVrh.46、AAVrh.48、AAVrh.48.1、AAVrh.48.1.2、AAVrh.48.2、AAVrh.49、AAVrh.51、AAVrh.52、AAVrh.53、AAVrh.54、AAVrh.56、AAVrh.57、AAVrh.58、AAVrh.61, AAVrh.64, AAVrh.64R1, AAVrh.64R2, AAVrh.67, AAVrh.73, AAVrh.74, AAVrh8R, AAVrh8R A586R mutant, AAVrh8R R533A mutant, AAAV, BAAV, goat AAV, bovine AAV, AAVhE1.1, AAVhEr1.5, AAVhER1.14, AAVhEr1.8, AAVhEr1.16, AAVhEr1.18, AAVhEr1.35, AAVhEr1.7, AAVhEr1.36, AAVhEr2.29, AAVhEr2.4, AAVhEr2.16, AAVhEr2.30, AAVhEr2.31, AAVhEr2.36, AAVhER1.23, AAVhEr3.1, AAV2.5T, AAV-PAEC, AAV-LK01, AAV-LK02, AAV-LK03, AAV-LK04, AAV-LK05, AAV-LK06, AAV-LK07, AAV-LK08, AAV-LK09, AAV-LK10, AAV-LK11, AAV-LK12, AAV-LK13, AAV-LK14, AAV-LK15, AAV-LK16, AAV-LK17, AAV-LK18, AAV-LK19, AAV-PAEC2, AAV-PAEC4, AAV-PAEC6, AAV-PAEC7, AAV-PAEC8, AAV-PAEC11, AAV-PAEC12, AAV-2-pre-miRNA-101, AAV-8h, AAV-8b, AAV-h, AAV-b, AAV SM 10-2, AAV Shuffle 100-1, AAV Shuffle 100-3, AAV Shuffle 100-7, AAV Shuffle 10-2, AAV Shuffle 10-6, AAVShuffle 10-8, AAV Shuffle 100-2, AAV SM 10-1, AAV SM 10-8, AAV SM 100-3, AAV SM100-10, BNP61 AAV, BNP62 AAV, BNP63 AAV, AAVrh.50, AAVrh.43, AAVrh.62, AAVrh.48, AAVhu.19, AAVhu.11, AAVhu.53, AAV4-8 / rh.64, AAVLG-9 / hu.39, AAV54.5 / hu.23, AAV54.2 / hu.22, AAV54.7 / hu.24, AAV54.1 / hu.21, AAV54.4R / hu.27AAV46.2 / hu.28, AAV46.6 / hu.29, AAV128.1 / hu.43, true type AAV (ttAAV), UPENN AAV 10, Japanese AAV 10 serotype, AAVCBr-7.1, AAV CBr-7.10, AAV CBr-7.2, AAV CBr-7.3, AAV CBr-7.4, AAV CBr-7.5, AAV CBr-7.7, AAV CBr-7.8, AAV CBr-B7.3, AAV CBr-B7.4, AAV CBr-E1, AAV CBr-E2, AAV CBr-E3, AAV CBr-E4, AAV CBr-E5, AAV CBr-e5, AAV CBr-E6, AAV CBr-E7, AAV CBr-E8, AAV CHt-1, AAV CHt-2, AAV CHt-3, AAV CHt-6.1, AAV CHt-6.10, AAV CHt-6.5, AAV CHt-6.6, AAV CHt-6.7, AAV CHt-6.8, AAV CHt-P1, AAV CHt-P2, AAV CHt-P5, AAV CHt-P6, AAV CHt-P8, AAVCHt-P9, AAV CKd-1, AAV CKd-10, AAV CKd-2, AAV CKd-3, AAV CKd-4, AAV CKd-6, AAV CKd-7, AAV CKd-8, AAV CKd-B1, AAV CKd-B2, AAV CKd-B3, AAV CKd-B4, AAV CKd-B5, AAV CKd-B6, AAV CKd-B7, AAV CKd-B8, AAV CKd-H1, AAV CKd-H2, AAV CKd-H3, AAV CKd-H4, AAV CKd-H5, AAV CKd-H6, AAV CKd-N3, AAV CKd-N4, AAV CKd-N9, AAV CLg-F1, AAV CLg-F2, AAV CLg-F3, AAV CLg-F4, AAV CLg-F5, AAV CLg-F6, AAV CLg-F7, AAV CLg-F8, AAV CLv-1, AAV CLv1-1, AAV Clv1-10, AAV CLv1-2, AAV CLv-12, AAV CLv1-3, AAV CLv-13, AAV CLv1-4, AAVClv1-7, AAV Clv1-8, AAV Clv1-9, AAV CLv-2, AAV CLv-3, AAV CLv-4, AAV CLv-6,AAV CLv-8, AAV CLv-D1, AAV CLv-D2, AAV CLv-D3, AAV CLv-D4, AAV CLv-D5, AAV CLv-D6, AAV CLv-D7, AAV CLv-D8, AAV CLv-D1, AAV CLv-AAV CLv-K1, AAV CLv-K3, AAV CLv-K6, AAV CLv-L4, AAV CLv-L5, AAV CLv-L6, AAV CLv-M1, AAV CLv-M11, AAV CLv-M2, AAV CLv-MAV-5 CLv-M6, AAVCLv-M7, AAV CLv-M8, AAV CLv-M9, AAV CLv-R1, AAV CLv-R2, AAV CLv-R3, AAV CLv-R4, AAVCLv-R5, AAV-RAV-RAV-RAV CLv-R7, AAV CLv-R8, AAV CLv-R9, AAV CSp-1, AAV CSp-10, AAVCSp-11, AAV CSp-2, AAV CSp-3, AAV CSp-4, AAV CSp-6, AAV CSp-7 CSp-8、AAV CSp-8.10、AAV CSp-8.2、AAV CSp-8.4、AAV CSp-8.5、AAV CSp-8.6、AAV CSp-8.7、AAV CSp-8.8、AAV CSp-89、AAV. CSp-9、AAV.hu.48R3、AAV.VR-355、AAV3B、AAV4、AAV5、AAVF1 / HSC1、AAVF11 / HSC11、AAVF12 / HSC12、AAVF13 / HSC13 / HSC14、ACAVF14 / ACAV14 AVF15 / HSC15,AAVF16 / HSC16,AAVF17 / HSC17,AAVF2 / HSC2,AAVF3 / HSC3,AAVF4 / HSC4,AAVF5 / HSC5,AAVF6 / HSC6,AAVF7 / HSC78,AAVF78 / HSC8、AAVF9 / HSC9、AAV-PHP.B(PHP.B)、AAV-PHP.A(PHP.A)、G2B -26、G2B-13、TH1.1-32、TH1.1-35、AAVPHP.B2、AAVPHP.B3、AAVPHP .N / PHP.B-DGT、AAVPHP.B-EST、AAVPHP.B-GGT、AAVPHP.B-ATP、AAVPHP.B-ATT-T、AAVPHP.B-DGT-T、AAVPHP.B-GGT-T、AAVPHP.B-SGS、AAV capsid proteins comprising the group consisting of AAVPHP.B-AQP, AAVPHP.B-QQP, AAVPHP.B-SNP(3), AAVPHP.B-SNP, AAVPHP.B-QGT, AAVPHP.B-NQT, AAVPHP.B-EGS, AAVPHP.B-SGN, AAVPHP.B-EGT, AAVPHP.B-DST, AAVPHP.B-DST, AAVPHP.B-STP, AAVPHP.B-PQP, AAVPHP.B-SQP, AAVPHP.B-QLP, AAVPHP.B-TMP, AAVPHP.B-TTP, AAVPHP.S / G2A12, AAVG2A15 / G2A3, AAVG2B4, AAVG2B5, or variants thereof.

[0083] In the implementation scheme, AAV refers to serotypes AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, or AAV13. In the implementation scheme, the AAV particles comprise an AAV capsid protein selected from the group consisting of AAVPHP.B, AAVrh74, AAV110, AAV204, AAV214, AAV214A, AAV214e, AAV214e8, AAV214e9, AAV214e10, AAVTB102_45, and AAV214AB.

[0084] As used herein, “AAV vector” refers to a vector containing one or more heterologous nucleic acid (HNA) sequences and one or more AAV inverted terminal repeat (ITR) sequences. Such AAV vectors can replicate in host cells that provide the functionality of the rep and cap gene products and allow the ITRs and the nucleic acids between them to be packaged into infectious viral particles. In embodiments, the adeno-associated virus vector contains a promoter, at least one nucleic acid sequence encoding at least one protein or RNA, and / or an enhancer and / or a terminator between the flanking ITRs, these elements being packaged into infectious adeno-associated virus particles. The nucleic acids between the ITRs and ITRs may be encapsulated in an AAV capsid, and this encapsulated nucleic acid may be referred to as the “AAV vector genome.” The AAV vector may contain elements other than the encapsulated portion, such as antibiotic resistance genes or other elements known in the art that are included in plasmids used for manufacturing purposes but not packaged into AAV particles.

[0085] As used herein, the term "viral capsid" or "capsid" refers to the protein shell or outer shell of a viral particle. The capsid functions to package, protect, transport, and / or release the viral genome into host cells. The capsid is typically composed of oligomeric subunits of proteins ("capsid proteins"). The AAV viral capsid is composed of a mixture of three viral capsid proteins: VP1, VP2, and VP3.

[0086] “AAV viral particle” (or “AAV viral particle” or “AAV particle”) refers to a viral particle composed of at least one AAV capsid protein and a packaged polynucleotide, wherein the polynucleotide is derived from an AAV vector (referred to herein as the AAV vector genome).

[0087] The terms "nucleic acid" and "nucleotide sequence" include DNA molecules (e.g., cDNA or genomic DNA), RNA molecules (e.g., mRNA), combinations or hybrid DNA / RNA molecules, and analogs of DNA or RNA molecules. Such analogs can be produced using, for example, nucleotide analogs, including but not limited to inosine or triphenylmethylated bases. Such analogs may also comprise DNA or RNA molecules with a modified backbone that imparts beneficial properties to the molecule, such as nuclease resistance or enhanced transmembrane transactivity. Nucleic acid or nucleotide sequences can be single-stranded, double-stranded, and may contain single-stranded and double-stranded portions, and may contain triple-stranded portions, but are preferably double-stranded DNA.

[0088] Example The following examples are intended to further describe some embodiments of this disclosure. These examples are illustrative and not intended to limit the scope of this disclosure. It will be apparent to those skilled in the art that other suitable modifications and adjustments to various conditions and parameters commonly encountered in the art are also within the scope of this disclosure.

[0089] Example 1. Construction of heterozygous genes 1.1 Structure of dystrophin and myotrophic-associated proteins Dystrophin and myotrophic-associated protein have similar tissue and binding affinity to other members of the dystrophin-associated protein complex (DAPC). Figure 1The structural domains of dystrophin and myotroph-associated protein are shown. Both proteins contain an N-terminal domain (NTD) that interacts with actin, also known as actin-binding domain 1 (ABD1), a central region composed of different spectrin-like repeat sequences (R1-R24) with four hinge regions (H1-H4) scattered within, a cysteine-rich domain (CR) that binds β-dystrophin, and a C-terminal domain (CTD) that interacts with β-dystrophin and syntrophin. Two main differences exist between the two proteins: the presence of a second actin-binding domain (ABD2) in dystrophin, and the T-cell response region from NTD to R1 in dystrophin (boxed in the figure), which are absent in myotroph-associated protein. Homologous domains in myotroph-associated protein are marked with a "u" before their domain abbreviations.

[0090] 1.2 The structure of dystrophin in clinical practice Figure 2 The structural domains of clinically observed dystrophin proteins are shown. Full-length dystrophin contains an N-terminal domain (NTD), 24 spectroscopy-like repeats (R1 to R24), four hinge regions (H1 to H4), a cysteine-rich domain (CR), and a C-terminal domain (CTD). PF-06939926 (ΔR3-R21+H3 / ΔC) is used in a Pfizer-sponsored clinical trial and is driven by the MCK promoter. SRP-9001 (ΔR4-R23 / ΔC) is a candidate drug developed by Sarepta Therapeutics and regulated by the MHCK7 promoter. SGT-001 (ΔR1-R22+R16R17 / ΔC) is a micro-dystrophin designed by Solid Biosciences and regulated by the CK8 promoter. These three micro-dystrophins share the common characteristics of retaining the N-terminal domain, cysteine-rich domain, and partial spectroscopy-like repeats and hinge regions, and lack a C-terminal domain. The difference lies in the central hinge area and the R16 / 17 nNOS-bonding structural domain. SRP-9001 contains hinge 2, PF-06939926 contains hinge 3, and only SGT-001 carries the R16 / 17 nNOS-bonding structural domain.

[0091] To avoid T-cell responses, patients with mutations in exons 8-13 and 42-45 were excluded for Solid. Similarly, for Pfizer, patients with mutations in exons 9-13 and 29-30 were excluded. For Sarepta, patients with mutations in exons 1-17 and 45 were excluded. All regions are boxed in the figure.

[0092] 1.3 Design of Hybrid Microdystrophy Proteins To develop microdystrophy proteins with improved performance and the ability to evade T-cell-mediated immune responses, hybrid microdystrophy proteins combining various myotrophic-associated proteins (MATs) and dystrophy proteins were designed. Novel hybrid constructs were generated, containing a unique combination of MAT and dystrophy protein domains, with 4 to 6 spectrin-like repeat sequences (SRs) present in either the full-length MAT or dystrophy protein. These novel hybrid microdystrophy proteins were evaluated via rAAV-mediated delivery to malnourished mdx mice, followed by pathophysiological analyses of skeletal muscle and diaphragm at 4, 8, and 12 weeks.

[0093] To ensure stable packaging of these hybrid μDys (microdystrophy protein) clones, the small promoter P001 was used to drive strong and specific muscle expression. The P001 promoter is only 322 bp in size, but its expression intensity is comparable to that of CK8e.

[0094] SEQ ID NO: 96 (P001 promoter) acgcgtccatatatggaatgaaaaccagatggtgacagttccaagatggcggccgcccccagctgattcacccgacacctgacttccggccaaatatggatgactcagccaccagggggcgcgggggagggcgcgcgctaaaaataactccaggtcaccct gacctgacacccaaatatggcgacggttcctcacccgtcgccatatttgggtgtccgccctcggccggggccgcattcctgggggccgggcggtgctcccgcccgcctcgatataaaagccccaggctgggagcagccatcacagaagtccactcattctt In heterozygous micromyotrophic dystrophin, the NTD, H1, and multiple spectrin-like repeat sequences in full-length dystrophin are replaced by non-immunogenic myotrophic-associated protein (MAA) homologous domains. The homologous domains in MAA are marked with a "u" before their domain abbreviations. Heterozygous micromyotrophic dystrophin contains 4 (HB2, HB3), 5 (HE10, HE11), and 6 (HC2, HC7) SRs. sCTD is a truncated CTD domain; R17 / 22 are heterozygous spectrin-like repeat sequences with an N-terminus of R17 and a C-terminus of R22, such as... Figure 3 As shown in Table 1, the sequences of the hybrid micromyotrophic dystrophin and its related domains are presented.

[0095] Table 1. Sequences of heterozygous micromuscular dystrophy proteins

[0096] Example 2. Pathological rescue of diaphragmatic and skeletal muscle in D2.mdx mice by heterozygous micromyodystrophy protein. 2.1 Vector cloning and virus production All heterozygous micromyotrophic dystrophin genes were engineered using standard cloning techniques. The full-length dystrophin (GeneID: 1756) was synthesized from three separate parts by Genewiz (genewiz clone ID: #RA7236-1 / U549368, #RA7236-2 / U549369, #RA7236-3 / U549375). The full-length myotrophic-associated protein (GeneID: 7402) was synthesized from three separate parts by Genewiz (genewiz clone ID: #RA7236-4 / U546976, #RA7236-5 / U546979, #RA7236-6 / U563247). All heterozygous micromyotrophic dystrophin genes were cloned using overlap PCR to fuse different fragments, using the following primers: Table 2. Primers used for cloning the heterozygous micromyodystrophy protein gene SEQ ID NO Primer Name Sequence 39 HB2 F1 agtccactcattcttggatccgccaccatggccaagtatggagaac 40 HB2 R1 ggtcaggctgagtcacctggttggaggaatcttc 41 HB2 F2 ccaggtgactcagcctgacctagctcctggac 42 HB2 R2 tttcaagggtaggtacctccaacatcaaggaagatggc 43 HB2 F3 ggaggtacctacccttgaaagactccaggaacttc 44 HB2 R3 ttattgattaacaagtcgacctacattgtgtcccggggactctggggagaggtg 45 P001-1 gacagttccaagatggcggccgcccccagctgattcacccgacacctgacttccgg 46 P001-2 gcgccccctggtggctgagtcatccatatttggccggaagtcaggtgtcgggtg 47 P001-3 gactcagccaccagggggcgcgggggagggcgcgcgctaaaaataactccaggtcacc 48 P001-4 gtgaggaaccgtcgccatatttgggtgtcaggtcagggtgacctggagttatttttag 49 P001-5 atatggcgacggttcctcacccgtcgccatatttgggtgtccgccctcggccggggcc 50 P001-6 cgaggcgggcgggagcaccgcccggcccccaggaatgcggccccggccgagggcggac 51 P001-7 cggtgctcccgcccgcctcgacaattgtataaaagccccaggctgggagcagcc 52 P001-8 aagaatgagtggacttctgtgatggctgctcccagcctggggct 53 EGFP F cacagaagtccactcattcttggatccatgagcaagggcgaggagctg 54 EGFP R1 cgaattaaacggtttattgattaacaagtcgaccttgtacagctcgtccatgccgtgag 55 EGFP R2 cagagaccaaagttcaactgaaacgaattaaacggtttattgattaacaagtcg 56 EGFP R3 catcactaggggttcctgcgcagagaccaaagttcaactgaaacgaatt 57 HB3 R1 aagaaatttcgtgcagccgggactgtctgtcc 58 HB3 F2 ccggctgcacgaaatttcttatgtgccttctacttatttgactg 59 HB3 R2 taggtcaggctgttcttctagcctcttttttctgtctg 60 HB3 F3 tagaagaacagcctgacctagctcctggactg 61 HB4 R3 ttattgattaacaagtcgacctacattgtgtcagtttccatgttgtccccctctaag 62 HC2 R1 ttacttcactcagatccatgtcaacctcagtgacag 63 HC2 F2 catggatctgagtgaagtaaacctggaccgttatcaaac 64 HC2 R2 aagaaatttcgtcttgtaaaagaacccagcggtcttc 65 HC2 F3 tttacaagacgaaatttcttatgtgccttctacttatttgactg 66 HC2 R3 cttggaggtccttaagataccatttgtatttagcatgttccc 67 HC2 F4 gtatcttaaggacctccaaggtgaaattgaagctc 68 HC7 R1 aagaaatttcttgtaacctattccagcgttcttcagtc 69 HC7 F2 taggttacaagaaatttcttatgtgccttctacttatttgactg 70 HC7 R2 ggtcagaactttcttctagcctcttttttctgtctgacagc 71 HC7 F3 gctagaagaaagttctgaccagtggaagcgtc 72 HE10 R2 actggtcagaaggtacctccaacatcaaggaagatggc 73 HE10 F3 ggaggtaccttctgaccagtggaagcgtctgcacc 74 HE11 R3 ccctgtgggcctcatctatttttctctgccagtcagcg 75 HE11 F4 aatagatgaggcccacagggactttggtccag 76 HC15 R1 gaatagggatttgtaacctattccagcgttcttcagtc 77 HC15 F2 taggttacaaatccctattcaacagaggaaaatgggtc 78 HC15 R2 agaagtcttcgtaaatagcagtgttgagctctggaac 79 HC15 F3 tgctatttacgaagacttctcttttcaggaagactc 80 HC15 R3 ggtcagaactttttagccttggctgcctatccttcac 81 HC15 F4 aaggctaaaaagttctgaccagtggaagcgtctgcacc 82 HE33 R1 gaatagggatcatcagcacatcgtgcagccg 83 HE33 F2 tgtgctgatgatccctattcaacagaggaaaatgggtc 84 HE33 R3 ggtcaggctgttttagccttggctgcctatccttcac 85 HE33 F4 aaggctaaaacagcctgacctagctcctggac 86 HE33 F5 ggaggtaccttctgaccagtggaagcgtctgcacc The minipUC57 sequence (SEQ ID NO: 98) is shown below: A synthetic minimal polyadenylation signal (SEQ ID NO: 97: ttgttaatcaataaaccgtttaattcgtttcagttgaactttggtctctg) engineered from the AAV2 cap gene was subcloned into the 3' end of the heterozygous micromyodystrophy protein gene. The muscle-specific strong promoter P001 was used to drive gene expression. All these heterozygous genes were cloned into a minipUC57 backbone (SEQ ID NO: 98) flanked by the wild-type AAV2 ITR sequence (NCBI: NC_001401.2). A variant AAV9 capsid named AVT913 (based on the wild-type AAV9 capsid, with S586A587Q588 replaced by ENRRGDTNAL) was used for AAV packaging via triplasmic transfection in HEK293 cells, as described below. HEK293T cells were purchased from a nationally certified cell bank (SCSP-502). HEK293 cells were rapidly thawed by gently agitating for 2 minutes in a 37°C water bath. The thawed cells were added to preheated culture medium, centrifuged at low speed to remove the frozen medium, and then resuspended in high-glucose DuPont modified Eagle medium (DMEM) (Gibco Advanced DMEM thermofisher12491015) supplemented with fetal bovine serum (FBS) (final concentration 10%). The cells were then grown in a humidified incubator at 37°C with 5% CO2, with the growth medium changed every 2-3 days.

[0097] For cell transfection: a) Cell seeding: Seed cells 24 hours before transfection and observe cell condition before transfection. Transfection can be performed when the cell density is 70%-80% and the cells are in good condition and free from contamination. b) Prepare the plasmid-PEI transfection complex: plasmid:PEI = 1:1. Add Helper plasmid, Repcap plasmid and GOI plasmid (different micromyotrophic dystrophin expression plasmids) to each 150 mm culture dish. The total amount of plasmid is 58 μg. Prepare the transfection complex and let it stand for 15 minutes. c) Transfection was performed using a transfection complex: serum-containing medium = 1:10, and the transfection was completed by dropping the transfection complex into a 150 mm dish; d) Cultivate for 72 hours and harvest the virus.

[0098] 72 hours after transfection, cells were lysed with 0.4% v / v Triton X-100 and 25 U / mL Benzonase at 37°C with shaking for 2 hours. The clarified and concentrated viral suspension was loaded into a modified iodixanol density gradient (60%, 40%, and 25%) and ultracentrifuged at 490,000 g and 18°C ​​for 70 minutes. The AAV-containing fraction was dialyzed using a 100 kDa membrane in storage buffer (PBS, 63 mM NaCl, 1 mM MgCl2, 0.1% Pluronic F-68), and the purified suspension was further concentrated and sterilized by filtration through a 0.22 μm filter.

[0099] AAV particles were quantified by droplet digital PCR (ddPCR) using primers and probes targeting ITR elements and an internal control with a known titer (protocol adapted from Lock et al., 2014). Endotoxin levels were determined using a chromogenic endotoxin assay based on horseshoe crab cell lysate. Carrier formulations with endotoxin <10 EU / ml were evaluated using the horseshoe crab cell lysate assay with Endosafe nexgen-PTS (Charles River, nexgen-PTS) according to the manufacturer's instructions. The absence of protein impurities in the formulation was confirmed by silver staining.

[0100] Primers and probes targeting ITR elements are shown below: ITRF: GGAACCCTAGTGATGGAGTT (SEQ ID NO: 100); ITRR: CGGCCTCAGTGAGCGA (SEQ ID NO: 101); ITRP: / 56-FAM / CACTCCCTC / ZEN / TCTGCGCGCTGC / 3IABKFQ / (SEQ ID NO: 102) 2.2 Systemic delivery and functional study of AVT913-P001-μDys in D2.md mice 2.2.1 Ethics All applicable parts of this study will comply with the following regulations and guidelines regarding animal care and welfare: the AAALAC International Guidelines reported in the National Research Council's (2011) Guidelines on the Care and Use of Laboratory Animals; and the Regulations on the Administration of Laboratory Animals issued by the Ministry of Science and Technology of the People's Republic of China in 1988.

[0101] Wild-type male BALB / c (#211) and C57BL / 6J (#219) mice were obtained from Charles River Laboratories, dystrophin-deficient D2 type. B10-Dmdmdx / J (D2.mdx) male mice were obtained from Jackson Laboratory (#013141). Initial screening used malnourished BALB / c mice.

[0102] For expression level screening, 4-week-old BALB / c mice were intravenously (tail vein) administered 1E14 vg / kg of recombinant AVT913-P001-μDys vector (N=6). Two weeks post-injection (wpi), the mice were euthanized, and tissues (quadriceps, gastrocnemius, diaphragm, heart, and liver) were collected for total RNA and protein separation. Expression levels were detected using RT-qPCR and Western blot.

[0103] 2.2.2 RT-qPCR analysis Four-week-old male BALB / c mice were intravenously (tail vein) administered 1E14 vg / kg of recombinant AVT913-P001-μDys vector (N=4). Two weeks after injection, the mice were euthanized, and qPCR analysis of heterozygous μdys expression was performed. Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was used as an internal control. P001 drives strongly muscle-specific expression of μdys.

[0104] Total RNA was isolated using the TransZol Up Plus RNA Kit (Transgene, ER501-01) according to the manufacturer's protocol. The purified RNA was treated with RNase-free DNase I and reverse transcribed using the HiScript III 1st Strand cDNA Synthesis Kit (+gDNA wiper) (Vazyme R312-01). Amplification was performed using Premix EX Taq™ (Takara, RR390) on a Real-Time CFX 96 Touch amplifier (Bio-Rad). The following specific primer-probe set was used: Table 3. Primers for qPCR of heterozygous micromyotrophic dystrophy protein SEQ ID NO Primer Name Sequence 87 μDysF 5’-gtgtctgaactggctgctga-3’ 88 μDysR 5’-cctgttgaacttgccacttgc-3’ 89 μDysP 5’-6FAM-acgggacgaacagggaggatccgt-3’-6TAMRA 90 9001-F 5’-ttcagcaagttcggcaagca-3’ 91 9001-R 5’-actctggtgctgcccttctc-3’ 92 9001-P 5’-6FAM-tgggcagcttctggccggtca-3’-6TAMRA 93 musGAPDHF 5’-caatgtgtccgtcgtggatct-3’ 94 musGAPDHR 5’-gtcctcagtgtagcccaagatg-3’ 95 musGAPDHP 5’-6HEX-cgtgccgcctggagaaacctgcc-3’-BHQ1 qPCR was performed with one round of pre-denaturation at 95°C for 30 s, followed by 40 cycles (95°C denaturation for 5 s, 60°C annealing and extension for 30 s). All data are presented as mean ± SD and analyzed using GraphPad Prism 8 software. Figure 4 As shown.

[0105] 2.2.3 Western blotting: protein expression Four-week-old male BALB / c mice were intravenously (tail vein) administered 1E14 vg / kg of recombinant AVT913-P001-μDys vector (N=4). The mice were euthanized, and protein expression of the heterozygous μdys vector was analyzed two weeks after injection. Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was used as an internal loading control.

[0106] 40 mg of quadriceps femoris muscle was homogenized in 400 μl of RIPA lysis buffer (Beyotime, P0013B) containing 1% protease inhibitor PMSF (Beyotime, ST507) using a Qiagen Tissue Homogenizer II. The homogenate was then homogenized at 30 Hz for 2 min and lysed on ice for 5 min. Protein concentration was determined using the Pierce™ BCA Protein Assay Kit (ThermoFisher, 23225). 5 μg of tissue lysate was loaded onto a 3–8% SDS-PAGE gel (Invitrogen, EA03755BOX). Protein was transferred to a PVDF membrane in Power Blotter Select Transfer Stacks (Invitrogen, PB3340). The membrane was blocked for 40 min at room temperature with TBST solution containing 5% milk. μDys were detected using primary antibodies against dystrophin (ThermoFisher, PA5-110894 (anti-R23R24), 1:2000; Abcam, ab251665 (anti-ABD-H1), 1:2000; ThermoFisher, PA5-89628 (anti-CT), 1:2000). GAPDH was used as a loading control (Abcam, ab8245, 1:2000). Species-specific antibodies conjugated with horseradish peroxidase were used as secondary antibodies (Jackson, 111-035-003; Invitrogen, PA1-74421). Incubation with primary antibody was performed overnight at 4°C, followed by three 10-minute washes in TBST and incubation with secondary antibody for 1 hour. Protein detection and quantification were performed using Clarity™ Western ECL substrate (Bio-Rad, 1705060) and ImageLab software. Protein expression results for heterozygous μdys are shown below. Figure 5 As shown.

[0107] 2.2.4 Pathological examination For pathological examination, 2-week-old D2.mdx mice were intravenously (tail vein) injected with 1E14 vg / kg of recombinant AVT913-P001-μDys vector (N=2~3). Eight weeks after injection (wpi), the mice were euthanized, and tissues (quadriceps, gastrocnemius, diaphragm, heart, and liver) were collected for total RNA and protein isolation, RT-qPCR, Western blot H&E staining, and immunofluorescence.

[0108] For H&E staining, the diaphragm and quadriceps femoris muscles were fixed in 10% neutral formalin buffer for 24 hours, then dehydrated in graded ethanol and cleared in xylene using an automated dehydrator (Leica, HistoCore Pegasus), and finally embedded in paraffin using an automated embedding machine (Leica, HistoCore Arcadia). 5 μm thick transverse sections were cut using a HistoCore BIOCUT (Leica). To assess central nucleation and fibrosis, slides were stained with hematoxylin-eosin and masson trichrome using an Auto Staining XL (Leica, ST5010). After staining, slides were scanned using an Aperio CT6 (Leica), and three random regions were evaluated in each slide to determine the percentage of central nucleation / fibrosis and fibrosis.

[0109] Two-week-old D2.mdx mice were intravenously (IV) injected with different heterozygous μdys at 1E14 vg / kg. Gross dissection was performed 8 weeks post-injection (wpi). HB2, HC2, HC7, HE10, and HE11 showed almost 100% therapeutic efficacy, while HB3 and HB4 showed significant but not 100% therapeutic efficacy. All constructs showed better efficacy than SRP9001, such as... Figure 6 As shown.

[0110] Two-week-old D2.mdx mice were intravenously (IV) injected with different heterozygous μdys at 1E14 vg / kg. Gross dissection was performed 8 weeks post-injection (wpi), and the fibrosis percentage of the diaphragm was measured using Qupath. HB2, HC2, HC7, HE10, and HE11 showed almost 100% efficacy, while HB3 and HB4 showed significant but not 100% efficacy. All constructs showed better efficacy than SRP9001, such as... Figure 7 As shown.

[0111] Two-week-old D2.mdx mice were intravenously (IV) injected with different heterozygous μdys at 1E14 vg / kg. H&E staining was performed 8 weeks post-injection (wpi). HB2, HC2, HC7, HE10, and HE11 showed almost 100% therapeutic efficacy, while HB3 and HB4 showed significant but not 100% therapeutic efficacy.Figure 8 As shown, all constructs exhibited better efficacy than SRP9001.

[0112] 2.2.5. Immunofluorescence analysis For immunofluorescence, gastrocnemius muscle was embedded in tissue embedding compound Tissue-Tek OCT (SakuraFinetek, Japan) and frozen in isopentane (PanReac, Spain) pre-cooled in liquid nitrogen. All samples were stored at -70°C prior to analysis.

[0113] Cross sections of gastrocnemius muscle, 8 μm thick, were cut using a Leica CM 1950 cryostat. The muscle sections were fixed with 95% ethanol for 5 minutes at room temperature and permeabilized in PBST (PBS solution containing 0.05% Triton X-100). They were then blocked for 1 hour at room temperature with rapid blocking buffer (Beyotime, P0260) to block non-specific antibody binding. Sections were stained with primary antibody against dystrophin (ThermoFisher, PA5-110894, 1:200; DHSB, MANEX1011B, 1:200) and Alexa-labeled secondary antibody (Abcam, ab150077; Abcam, ab150117, 1:500). Nuclear counterstaining was performed using DAPI (Beyotime, P0131). The antibody and nuclear stain were diluted with rapid blocking buffer. The primary antibody was incubated overnight at 4°C, followed by washing in PBST and incubation with the secondary antibody for 1 hour. Fluorescence images were captured using a StrataFaxs P-S7.

[0114] Two-week-old D2.mdx mice were intravenously (IV) injected with different heterozygous μdys at 1E14 vg / kg. Gastrocnemius muscle was harvested 8 weeks post-injection (wpi). The heterozygous μdys were immunostained and the cell nuclei were labeled with DAPI. Figure 9 Representative frozen sections of the gastrocnemius muscle are shown. HB2, HC2, HC7, HE10, and HE11 showed high levels of expression, with almost 100% of the muscle fibers being positive. HB3 and HB4 showed approximately 80% of the muscle fibers being positive. SRP9001 showed weaker expression due to its low μdys expression level.

[0115] 2.2.6 Functional Analysis of Skeletal Muscle Two-week-old MDX mice were treated with AVT913-μDys intravenously for 8 weeks, and the muscle-generating capacity of the tibialis anterior muscle was assessed at the end of treatment. Muscle physiology was recorded 8 weeks after AAV / drug delivery. Mice were anesthetized by intraperitoneal injection of zoletil-50 (60 mg / kg, teletamine hydrochloride + zoprazepam hydrochloride; Virbac Laboratories, France) and Rompun (10 mg / kg, xylazine hydrochloride; Huamu Animal Health Products Co., Ltd., China). Mice were carefully monitored throughout the experiment to ensure the absence of toe-pinching reflex.

[0116] For muscle strength testing, the distal tendon of the TA was separated from the surrounding tissue and ligated with 5.0 braided surgical sutures (Yuanlikang Co., Ltd., China). Mice were placed on a temperature-controlled mat to maintain a body temperature of 37°C. The feet were secured to a platform, and the ankle and knee joints were stabilized using a 27G sterile disposable injection needle (Sungshim Medical, South Korea). The TA tendon was attached to the lever arm of a 305C dual-mode servo motor sensor (Aurora Scientific, Aurora, Ontario, Canada) via a custom-designed steel hook. TA muscle contraction was induced by stimulating the TA muscle with bipolar platinum electrodes using a 0.2 ms square wave pulse (701C stimulator; Aurora Scientific).

[0117] The servo motor data acquisition and control system operates based on the DMC program (Dynamic Muscle Control and Data Acquisition System; Aurora Scientific) on the Lab-View platform. Optimal muscle length (Lo) is determined by progressively stretching the muscle using a micromanipulator until maximum isometric twitching strength is achieved. Maximum isometric tetanic force (Po) is determined based on plateaus in the force-frequency relationship following a series of stimuli at 20, 40, 50, 60, 80, 100, 120, and 140 Hz. A one-minute rest period is allowed between each tetanic contraction. Muscle length is measured using digital calipers based on well-defined anatomical landmarks near the knee and ankle joints. Specific muscle strength (N / cm) is also measured. 2 The total cross-sectional area is calculated by dividing Po by the TA muscle cross-sectional area. The total cross-sectional area is estimated using the following formula: Muscle weight (g) / [TA fiber length (Lf; cm) × 1.06 (g / cm²)]. 3 )].

[0118] For fatigue assessment, after establishing the force-frequency relationship, the sensitivity of the TA muscle to contraction-induced injury was evaluated. This involved stimulating the muscle at 150 Hz for 700 ms. After 500 ms of stimulation, the muscle was stretched by 10% of Lo at a rate of 0.5 Lo / s. At the end of stimulation, the muscle recovered to Lo at a rate of -0.5 Lo / s. The stimulation-stretch cycle was repeated every 3 minutes for a total of 10 cycles. Rest periods between cycles were used to reduce muscle fatigue. Maximum isometric strength was measured after each stretch-contraction and expressed as a percentage of the initial maximum isometric strength. At the end of the experiment, the muscle was excised, weighed, and prepared for histological analysis. Figure 10 The effect of 8 weeks of treatment on the MDX tibialis anterior muscle strength was shown.

[0119] 2.2.7 Statistical Analysis All statistical analyses were performed using GraphPad Prism 8 software. Data are expressed as mean ± SD. Normality of groups was assessed using the Shapiro-Wilk test. Unpaired two-tailed t-tests or Mann-Whitney U tests were used for one-group comparisons, and one-way ANOVA and post-hoc Tukey tests were used for multiple group comparisons. Specific statistical tests are illustrated in the attached figures. Statistical significance was defined as a p-value less than 0.05.

Claims

1. A chimeric protein comprising a dystrophin domain and a myotroph-associated protein domain, wherein the chimeric protein comprises, from its 5' end to its 3' end, the following peptide segments: a) The first peptide segment, comprising the amino acid sequence of myotrophic-associated protein from the N-terminus to spectrin-like repeat sequence 1, 2 or 3 (uR1, uR2 or uR3); or comprising the amino acid sequence of myotrophic-associated protein from the N-terminus to hinge region 1 (uH1), and dystrophin R1 and R2. b) A second peptide segment comprising the amino acid sequence of dystrophin hinge region 3 (H3); or comprising the amino acid sequence of dystrophin R16 and R17; or comprising the amino acid sequence of dystrophin R16, R17 and H3; or comprising the amino acid sequence of the N-terminus of dystrophin R16 and R17 and the C-terminus of R22; or comprising the amino acid sequence of myotrophic-associated protein uR15 and uR16; or comprising the amino acid sequence of myotrophic-associated protein uR15, uR16 and dystrophin H3; c) The third peptide segment, comprising the amino acid sequence of dystrophin from R24 to the cysteine-rich domain (CR) and the truncated C-terminal domain (sCTD) of dystrophin; or comprising the amino acid sequence of dystrophin from R24 to the CR domain; or comprising the amino acid sequence of dystrophin from R23 to the CR domain; or comprising the amino acid sequence of dystrophin R23, H4 and CR domains.

2. The chimeric protein according to claim 1, wherein the chimeric protein comprises, from the 5' end to the 3' end, the following peptide segments in sequence: a) The first peptide segment contains the amino acid sequences of the N-terminal domain (uNTD) of myotrophic-associated protein, the hinge region 1 (uH1) of myotrophic-associated protein, the spectrin-like repeat sequence 1 (uR1) of myotrophic-associated protein, the spectrin-like repeat sequence 2 (uR2) of myotrophic-associated protein, and the spectrin-like repeat sequence 3 (uR3) of myotrophic-associated protein. b) The second peptide segment, which contains the amino acid sequence of dystrophin hinge region 3 (H3); c) The third peptide segment comprising the amino acid sequence of 24 spectral repeats (R24), 4 (H4), a cysteine-rich domain (CR), and a truncated C-terminal domain (sCTD); or the amino acid sequence comprising 24 spectral repeats (R24), 4 (H4), and a cysteine-rich domain (CR); or the amino acid sequence comprising 23 spectral repeats (R23), 24 spectral repeats (R24), 4 (H4), and a cysteine-rich domain (CR); or a) The first peptide segment contains the amino acid sequences of the N-terminal domain (uNTD) of myotrophic-associated protein, the hinge region 1 (uH1) of myotrophic-associated protein, the spectrin-like repeat sequence 1 (uR1) of myotrophic-associated protein, and the spectrin-like repeat sequence 2 (uR2) of myotrophic-associated protein. b) The second peptide segment contains the amino acid sequences of dystrophin spectrin-like repeat sequence 16 (R16) and dystrophin spectrin-like repeat sequence 17 (R17). c) The third peptide segment comprising the amino acid sequence of dystrophin spectroscopy-like repeat 23 (R23), dystrophin hinge region 4 (H4), and dystrophin cysteine-rich domain (CR); or comprising the amino acid sequence of dystrophin spectroscopy-like repeat 23 (R23), dystrophin spectroscopy-like repeat 24 (R24), dystrophin hinge region 4 (H4), and dystrophin cysteine-rich domain (CR); or a) The first peptide segment contains the amino acid sequence of the N-terminal domain (uNTD), hinge region 1 (uH1), and spectrin-like repeat 1 (uR1) of myotrophic-associated protein. b) The second peptide segment contains the amino acid sequence of dystrophin spectrin-like repeat 16 (R16), dystrophin spectrin-like repeat 17 (R17), and dystrophin hinge region 3 (H3). c) The third peptide segment, comprising the amino acid sequence of dystrophin spectroscopy-like repeat 24 (R24), dystrophin hinge region 4 (H4), dystrophin cysteine-rich domain (CR), and truncated dystrophin C-terminal domain (sCTD); or a) The first peptide segment contains the amino acid sequence of the N-terminal domain (uNTD) of myotrophic-associated protein, the hinge region 1 (uH1) of myotrophic-associated protein, and the spectrin repeat sequence 1 (uR1) of myotrophic-associated protein. b) The second peptide segment contains the amino acid sequences of myotrophic-associated protein spectrin-like repeat 15 (uR15), myotrophic-associated protein spectrin-like repeat 16 (uR16), and dystrophin hinge region 3 (H3). c) The third peptide segment, comprising the amino acid sequence of dystrophin spectroscopy-like repeat 23 (R23), dystrophin spectroscopy-like repeat 24 (R24), dystrophin hinge region 4 (H4), and the dystrophin cysteine-rich domain (CR); or a) The first peptide segment contains the amino acid sequences of the N-terminal domain (uNTD) of myotrophic-associated protein, the hinge region 1 (uH1) of myotrophic-associated protein, the spectrin-like repeat sequence 1 (uR1) of myotrophic-associated protein, and the spectrin-like repeat sequence 2 (uR2) of myotrophic-associated protein. b) The second peptide segment contains the amino acid sequences of myotrophic-associated protein spectrin-like repeat 15 (uR15) and myotrophic-associated protein spectrin-like repeat 16 (uR16). c) The third peptide segment, comprising the amino acid sequence of dystrophin spectroscopy-like repeat 23 (R23), dystrophin spectroscopy-like repeat 24 (R24), dystrophin hinge region 4 (H4), and the dystrophin cysteine-rich domain (CR); or a) The first peptide segment contains the amino acid sequences of the N-terminal domain (uNTD) of myotrophic-associated protein, the hinge region 1 (uH1) of myotrophic-associated protein, the spectrin-like repeat sequence 1 (R1) of dystrophin and the spectrin-like repeat sequence 2 (R2) of dystrophin. b) The second peptide segment contains the amino acid sequence of dystrophin spectrin-like repeat 16 (R16) and dystrophin spectrin-like repeat 17 heterozygous 22 (R17 / 22). c) The third peptide segment contains the amino acid sequence of dystrophin spectrin-like repeat 23 (R23), dystrophin spectrin-like repeat 24 (R24), dystrophin hinge region 4 (H4), and dystrophin cysteine-rich domain (CR).

3. The chimeric protein according to claim 2, wherein... The N-terminal domain (uNTD) of the myotrophic-associated protein contains an amino acid sequence that is at least 80%, 85%, 90%, 95%, 98% or 99%, 100% identical to SEQ ID NO:

21. The myotrophic-associated protein hinge region 1 (uH1) contains an amino acid sequence that is at least 80%, 85%, 90%, 95%, 98% or 99%, 100% identical to SEQ ID NO: 22; The myotrophic-associated protein spectroscopy-like repeat sequence 1 (uR1) contains an amino acid sequence that has at least 80%, 85%, 90%, 95%, 98% or 99%, 100% identity with SEQ ID NO: 23; The myotrophic-associated protein spectroscopy-like repeat sequence 2 (uR2) contains an amino acid sequence that has at least 80%, 85%, 90%, 95%, 98% or 99%, 100% identity with SEQ ID NO: 24; The myotrophic-associated protein spectroscopy-like repeat sequence 3 (uR3) contains an amino acid sequence that has at least 80%, 85%, 90%, 95%, 98% or 99%, 100% identity with SEQ ID NO: 25; The myotrophic-associated protein spectroscopy-like repeat sequence 15 (uR15) contains an amino acid sequence that has at least 80%, 85%, 90%, 95%, 98% or 99%, 100% identity with SEQ ID NO: 26; The myotrophic-associated protein spectroscopy-like repeat sequence 16 (uR16) contains an amino acid sequence that has at least 80%, 85%, 90%, 95%, 98% or 99%, 100% identity with SEQ ID NO: 27; The dystrophin spectroscopy-like repeat sequence 1 (R1) contains an amino acid sequence that has at least 80%, 85%, 90%, 95%, 98% or 99%, 100% identity with SEQ ID NO: 28; The dystrophin spectroscopy-like repeat sequence 2 (R2) contains an amino acid sequence that has at least 80%, 85%, 90%, 95%, 98% or 99%, 100% identity with SEQ ID NO: 29; The dystrophin spectroscopy-like repeat sequence 16 (R16) contains an amino acid sequence that has at least 80%, 85%, 90%, 95%, 98% or 99%, 100% identity with SEQ ID NO: 30; The dystrophin spectroscopy-like repeat sequence 17 (R17) contains an amino acid sequence that has at least 80%, 85%, 90%, 95%, 98% or 99%, 100% identity with SEQ ID NO: 31; The dystrophin spectroscopy-like repeat sequence 17 heterozygous 22 (R17 / 22) contains an amino acid sequence that has at least 80%, 85%, 90%, 95%, 98% or 99%, 100% identity with SEQ ID NO: 32; The dystrophin spectroscopy-like repeat sequence 23 (R23) contains an amino acid sequence that has at least 80%, 85%, 90%, 95%, 98% or 99%, 100% identity with SEQ ID NO: 33; The dystrophin spectroscopy-like repeat sequence 24 (R24) contains an amino acid sequence that has at least 80%, 85%, 90%, 95%, 98% or 99%, 100% identity with SEQ ID NO: 34; The dystrophin hinge region 3 (H3) contains an amino acid sequence that is at least 80%, 85%, 90%, 95%, 98% or 99%, 100% identical to SEQ ID NO:

35. The dystrophin hinge region 4 (H4) contains an amino acid sequence that is at least 80%, 85%, 90%, 95%, 98% or 99%, 100% identical to SEQ ID NO:

36. The cysteine-rich domain (CR) of the dystrophin contains an amino acid sequence having at least 80%, 85%, 90%, 95%, 98% or 99%, 100% identity with SEQ ID NO: 37; or The truncated dystrophin C-terminal domain (sCTD) contains an amino acid sequence that is at least 80%, 85%, 90%, 95%, 98%, or 99%, 100% identical to SEQ ID NO:

38.

4. The chimeric protein according to any one of claims 1-3, wherein the chimeric protein comprises an amino acid sequence having at least 80%, 85%, 90%, 95%, 98% or 99%, 100% identity with any one of SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:8, SEQ ID NO:10, SEQ ID NO:12, SEQ ID NO:14, SEQ ID NO:16, SEQ ID NO:18 and SEQ ID NO:

20.

5. A polynucleotide comprising a nucleotide sequence encoding a chimeric protein according to any one of claims 1-4.

6. The polynucleotide of claim 5, wherein the polynucleotide comprises a nucleotide sequence having at least 80%, 85%, 90%, 95%, 98% or 99%, 100% identity with any one of SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO: 9, SEQ ID NO: 11, SEQ ID NO: 13, SEQ ID NO: 15, SEQ ID NO: 17 and SEQ ID NO:

19.

7. A vector comprising the polynucleotide according to claim 5 or 6, preferably, the vector is a viral vector, more preferably, the viral vector is selected from retroviruses, adenoviruses, herpesviruses, baculoviruses, modified baculoviruses, papillomaviruses, AAV viral vectors, lentiviral vectors, adenovirus vectors and alphavirus vectors, more preferably, the viral vector is an AAV viral vector.

8. A recombinant AAV particle comprising a carrier according to claim 7 encapsulated in an AAV capsid, preferably, the AAV capsid comprising a capsid protein derived from any AAV serotype or variant thereof, of AAV1, AAV2, AAV3, AAV3B, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAV13, AAVrh10, AAVhu37, or isolated from humans and non-human mammals.

9. A composition comprising the carrier according to claim 7 or the AAV particles according to claim 8, and a pharmaceutically acceptable excipient.

10. Use of the chimeric protein according to any one of claims 1-4, the polynucleotide according to claim 5 or 6, the carrier according to claim 7, the recombinant AAV particle according to claim 8, or the composition according to claim 9 in the preparation of a medicament for treating a disease or condition in a subject, preferably, the disease or condition is a skeletal muscle disease, the subject is a human, more preferably, the disease or condition is Duchenne muscular dystrophy (DMD).

Images