Pyrazolopyridine-based DNA-dependent protein kinase inhibitors and compositions and their applications in gene editing

Abstract

This disclosure relates to a DNA-PK inhibitor having formula (I), (I), or a pharmaceutically acceptable salt, stereoisomer, solvate, prodrug, or tautomer thereof, methods for preparing the foregoing and combinations thereof, and methods of using compounds of formula (I) in combination with DNA cleaving agents.

Description

Cross-reference to related applications

[0001] This application claims the benefit and priority of U.S. Provisional Patent Application No. 63 / 578,860, filed August 25, 2023, the entire contents of which are incorporated herein by reference. Technical Field

[0002] This disclosure generally relates to compounds, compositions, methods, and kits for increasing genome editing efficiency by administering a DNA protein kinase (DNA-PK) inhibitor of general formula (I) and a genome editing system to one or more eukaryotic cells. This disclosure also relates to compositions comprising a DNA-PK inhibitor of general formula (I), methods for inserting a target polynucleotide into the eukaryotic cell genome, and kits for inserting a target gene into the eukaryotic cell genome. The methods and kits can improve the efficiency of CRISPR / Cas-mediated polynucleotide insertion in cells, particularly in CRISPR-engineered CAR-T cells. By referencing and incorporating into the sequence list

[0003] This application contains a sequence list submitted via EFS-WEB in .XML format and hereby incorporated in its entirety by reference. The .XML copy was created on August 24, 2023, named 055920-612P01US_SeqList_ST26.xml, and is 75 KB in size. Background Technology

[0004] Developing cost-effective and reliable methods for precisely targeting alterations to the genome of living cells is a long-term goal. Genome editing has the potential to eliminate genes that cause specific disorders (i.e., gene “knockout”), or alternatively provide means for gene manipulation or insertion to correct genetic defects or enhance biological processes through gene “knock-in”. Genome editing can be applied to the treatment of a variety of disorders, including genetic disorders, hematological disorders, and cancer, and can be used in immunotherapy approaches. Clustered regularly spaced short palindromic repeats (CRISPR) and CRISPR-associated (Cas) systems are part of the prokaryotic immune system (Ishino et al., Journal of Bacteriology 169:5429-5433 (1987)), which provide immunity against viruses and plasmids by targeting their nucleic acids in a sequence-specific manner (Soret et al., Nature Reviews Microbiology 6:181-186 (2008)). Since its initial discovery, numerous groups have conducted extensive research on the potential applications of the CRISPR system in genetic engineering, including gene editing (Jinek et al., Science 337(6096):816-821 (2012); Cong et al., Science 339(6121):819-823 (2013); and Mali et al., Science 339(6121):823-826 (2013)). The CRISPR-Cas9 gene editing system has been successfully used in a variety of organisms and cell lines.

[0005] The Cas9 endonuclease generates a double-strand DNA break at the target sequence upstream of the prototypical spacer adjacent motif (PAM). The target sequence can then be removed, or the target sequence can be inserted into the target sequence using the cell's endogenous repair pathways. Endogenous DNA repair pathways include non-homologous end joining (NHEJ), microhomologous end joining (MMEJ), and homology-directed repair (HDR).

[0006] The NHEJ, MMEJ, and HDR pathways repair double-stranded DNA breaks, but the repair of these breaks can result in insertions or deletions at the break site. In NHEJ, repairing breaks in DNA does not require a homologous template. NHEJ repair can be error-prone, although errors are reduced when the DNA break includes compatible overhangs. NHEJ and MMEJ are mechanistically distinct DNA repair pathways, each involving a different subset of DNA repair enzymes. Unlike NHEJ, which can be precise in some cases or error-prone in others, MMEJ is always error-prone and results in both deletions and insertions at the repair site. MMEJ-related deletions are due to microhomology (2–10 base pairs) on either side of the double-strand break. In contrast, HDR requires a homologous template to guide the repair, but HDR repair is generally high-fidelity and less error-prone. Therefore, HDR-driven repair of double-stranded DNA breaks is superior to NHEJ or MMEJ-mediated repair; however, in many cell types, HDR is limited by NHEJ activity at all cell cycle stages, and HDR is mainly used in the S / G2 phase of cell growth (Mao et al., Cell Cycle, 7:2902-2906 (2008)).

[0007] With the recent discovery and implementation of CRISPR / Cas9 editing technology, the ability to modify the genome of any cell at a precise location has been improved. However, the ability to introduce specific, directional changes at a given locus is hampered by the fact that the primary cellular repair pathway following Cas9-mediated DNA cleavage is the erroneous non-homologous end joining (NHEJ) pathway. Homologous directional recombination (HDR) is less efficient than NHEJ, reducing editing efficiency in eukaryotic cells. While some reports indicate that insertions or deletions from NHEJ have achieved efficiencies as high as 70%, HDR efficiency remains challenging, with rates less than 1%. Therefore, there is a need to increase genome editing efficiency, particularly HDR efficiency.

[0008] Studies have shown that decreased NHEJ activity in vivo leads to increased HDR activity, and this phenomenon can be used to increase the efficiency of HDR-mediated CRISPR / Cas9 precise genome engineering. Pierce et al. Genes Dev., 15, 3237-3242 (2001), Ma et al. RNA Biol., 13, 605-612 (2016), Maruyama et al. Nat. Biotechnol., 33, 538-542 (2015), Robert et al. Genome Med., 7, 93 (2015).

[0009] DNA-dependent protein kinases (DNA-PKs) are ribose / threonine kinases that have been shown to be essential in DNA double-strand break repair mechanisms. In mammals, the primary pathway for repairing double-strand DNA breaks is the non-homologous end joining (NHEJ) pathway, which is functional regardless of cell cycle stage and works by removing both the unjoinable and joining ends of the double-strand break. There is a need for potent and selective DNA-PK inhibitors (DNA-PKi) that transiently block the NHEJ pathway to promote DNA repair via the desired HDR pathway, thereby enhancing the efficiency of CRISPR / Cas-mediated polynucleotide insertion in cells such as CRISPR CAR-T cells. Summary of the Invention

[0010] The first aspect of this disclosure relates to compounds of formula (I): (I), and its pharmaceutically acceptable salts, stereoisomers, solvates, prodrugs, and tautomers, in: A is arbitrarily defined by one or more R. 3 Substituted 6- to 8-membered cycloalkyl groups; X 1 Is it N or CR? 4 ; X 2 It is O, S, CH-OH, NH or N (C1-C4 alkyl); R 1 It is H or a 6- to 8-membered heterocyclic alkyl or heteroaryl group containing at least one heteroatom selected from N and O, wherein the heterocyclic alkyl or heteroaryl group is optionally surrounded by one or more R groups. 5 replace; R 2 It is H, -COO (C1-C4 alkyl), -C(O)O- (aryl or heteroaryl), or a heteroaryl group containing at least one heteroatom selected from N, O, and S, wherein the aryl or heteroaryl group is optionally surrounded by one or more R atoms. 6 replace; Each R 3 Independently selected from halogens, C1-C4 alkyl groups, and C1-C4 alkoxy groups; R 4 Selected from -CN, halogen, C1-C4 alkyl, C1-C4 alkoxy, CO (C1-C4 alkyl) and CHO; Each R 5 Independently selected from halogens and C1-C4 alkyl groups; and Each R 6Independently selected from hydrogen, halogen, -CN, C1-C4 alkyl, C1-C4 haloalkyl, C1-C4 alkoxy, C1-C4 haloalkoxy, CONH (C1-C4 alkyl), COO (C1-C4 alkyl), COO (C3-C8 cycloalkyl), and NH2; or two R atoms connected to adjacent atoms of the heteroaryl ring. 6 The group forms a fused 5- or 6-membered ring containing 0-3 heteroatoms selected from O, N, and S.

[0011] Another aspect of this disclosure relates to compounds of formula (I): (I), and its pharmaceutically acceptable salts, stereoisomers, solvates, prodrugs, and tautomers, in: A is arbitrarily defined by one or more R. 3 Substituted 6- to 8-membered cycloalkyl groups; X 1 Is it N or CR? 4 ; X 2 It is O, S, CH-OH, NH or N (C1-C4 alkyl); R 1 It is H or a 6- to 8-membered heterocyclic alkyl or heteroaryl group containing at least one heteroatom selected from N and O, wherein the heterocyclic alkyl or heteroaryl group is optionally surrounded by one to five R atoms. 5 replace; R 2 It is H, -COO (C1-C4 alkyl), -C(O)O- (aryl or heteroaryl), or a heteroaryl group containing at least one heteroatom selected from N, O, and S, wherein the aryl or heteroaryl group is optionally surrounded by one to three R atoms. 6 replace; Each R 3 Independently selected from halogens, C1-C4 alkyl groups, and C1-C4 alkoxy groups; R 4 Selected from -CN, halogen, C1-C4 alkyl, C1-C4 alkoxy, CO (C1-C4 alkyl) and CHO; Each R 5 Independently selected from halogens and C1-C4 alkyl groups; and Each R 6 Independently selected from hydrogen, halogen, -CN, C1-C4 alkyl, C1-C4 haloalkyl, C1-C4 alkoxy, C1-C4 haloalkoxy, CONH (C1-C4 alkyl), COO (C1-C4 alkyl), COO (C3-C8 cycloalkyl), and NH2; or two R atoms connected to adjacent atoms of the heteroaryl ring. 6The group forms a fused 5- or 6-membered ring containing 0-3 heteroatoms selected from O, N, and S.

[0012] Another aspect of this disclosure relates to pharmaceutical compositions comprising a compound of formula (I) or a pharmaceutically acceptable salt, hydrate, solvate, prodrug, stereoisomer, or tautomer thereof, and a pharmaceutically acceptable carrier. The pharmaceutically acceptable carrier may further comprise excipients, diluents, or surfactants.

[0013] Another aspect of this disclosure relates to a composition comprising (a) a DNA protein kinase inhibitor (DNA-PKI) and (b) a DNA cleaving agent, wherein the DNA-PKI is a compound of formula (I) or a pharmaceutically acceptable salt, hydrate, solvate, prodrug, stereoisomer, or tautomer thereof.

[0014] Another aspect of this disclosure relates to a method for targeted genome editing in cells, the method comprising contacting the cells with a DNA cutting agent and a DNA-PKI, wherein the DNA-PKI is a compound of formula (I) or a pharmaceutically acceptable salt, hydrate, solvate, prodrug, stereoisomer, or tautomer thereof.

[0015] Another aspect of this disclosure relates to a method for repairing double-stranded DNA breaks in a cellular genome, the method comprising contacting the cells with a DNA cutting agent and a DNA-PKI, wherein the DNA-PKI is a compound of formula (I) or a pharmaceutically acceptable salt, hydrate, solvate, prodrug, stereoisomer, or tautomer thereof.

[0016] Another aspect of this disclosure relates to a method for inhibiting or repressing the repair of DNA breaks in cells via a non-homologous end joining (NHEJ) pathway, the method comprising contacting the cells with a DNA cutting agent and a DNA-PKI, wherein the DNA-PKI is a compound of formula (I) or a pharmaceutically acceptable salt, hydrate, solvate, prodrug, stereoisomer, or tautomer thereof.

[0017] Another aspect of this disclosure relates to a method for targeted insertion of donor DNA into the genome of a cell, the method comprising contacting the cell with a DNA cutting agent, the donor DNA, and a DNA-PKI, wherein the DNA-PKI is a compound of formula (I) or a pharmaceutically acceptable salt, hydrate, solvate, prodrug, stereoisomer, or tautomer thereof.

[0018] Another aspect of this disclosure relates to compounds of formula (I) and pharmaceutically acceptable salts, hydrates, solvates, prodrugs, stereoisomers, tautomers, or pharmaceutical compositions thereof for use in the manufacture of medicaments for cell therapy.

[0019] Another aspect of this disclosure relates to the use of compounds of formula (I) or pharmaceutically acceptable salts, hydrates, solvates, prodrugs, stereoisomers, tautomers or pharmaceutical compositions thereof in the treatment of cells.

[0020] In some respects, this disclosure provides a method for preparing the compounds of this disclosure.

[0021] In some respects, this disclosure provides a method for preparing a compound, the method comprising one or more steps described herein.

[0022] Other features and advantages of this disclosure will become clear from the following detailed description and claims. Attached Figure Description

[0023] Figure 1 The effect of the DNA-PK inhibitor compound 18 of Example 18 on cell viability is shown 5 days after electroporation. Viable cells are shown as a percentage of total cells.

[0024] Figure 2 The effect of the DNA-PK inhibitor compound 18 of Example 18 on T cell proliferation was shown 5 days after electroporation. Total viable cell count (x10e6) is shown.

[0025] Figure 3 The effect of the DNA-PK inhibitor compound 18 of Example 18 on CAR insertion into the TRAC locus was shown 5 days after electroporation. The frequency of CAR+ T cells is shown as a percentage of total viable cells.

[0026] Figure 4 The effect of DNA-PK inhibitor compound 18 of Example 18 on CAR insertion into the TRAC locus was shown 5 days after electroporation. KI efficiency is shown as a percentage change relative to the untreated control condition (calculated by dividing the DNA-PKi-treated CAR+% by the untreated CAR, subtracting 1, and multiplying by 100).

[0027] Figure 5The effect of DNA-PK inhibitor compound 18 of Example 18 on total CAR+ cell yield is shown 5 days after electroporation. Relative CAR+ yield is shown as a percentage change relative to the untreated control condition (calculated by dividing the number of CAR+ cells in the DNA-PKi-treated condition by the untreated condition, subtracting 1, and multiplying by 100). Detailed Implementation definition

[0028] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure pertains. In this specification, the singular form also includes the plural unless the context clearly requires otherwise. While methods and materials similar to or equivalent to those described and materials herein may be used in the practice or testing of this disclosure, suitable methods and materials are described below. All publications, patent applications, patents, and other references mentioned herein are incorporated herein by reference. References cited herein are not considered prior art to the claimed disclosure. In case of conflict, this specification (including definitions) shall prevail. Furthermore, materials, methods, and examples are illustrative only and are not intended to be restrictive. In case of conflict between the chemical structures and names of compounds disclosed herein, the chemical structure shall prevail.

[0029] The articles “a” and “an” are used in this disclosure to refer to one or more (i.e., at least one) grammatical object of the article. For example, “a” means one or more elements.

[0030] Unless otherwise stated, the term “and / or” as used in this disclosure means “and” or “or”.

[0031] The term "optionally substituted" should be understood to mean that a given chemical moiety (e.g., alkyl) may (but is not required to) be bonded to other substituents (e.g., heteroatoms). For example, an optionally substituted alkyl group may be a fully saturated alkyl chain (i.e., a pure hydrocarbon). Alternatively, the same optionally substituted alkyl group may have substituents other than hydrogen. For example, it may be bonded to a halogen atom, a hydroxyl group, or any other substituent described herein at any position on the chain. Thus, the term "optionally substituted" means that a given chemical moiety has the potential to contain other functional groups, but does not necessarily have any additional functional groups. Suitable substituents used in the optional substitution of the described groups include, but are not limited to, halogens, oxo groups, -OH, -CN, -COOH, -CH2CN, -O-(C1-C6)alkyl, (C1-C6)alkyl, (C1-C6)alkoxy, (C1-C6)haloalkyl, (C1-C6)haloalkoxy, -O-(C2-C6)alkenyl, -O-(C2-C6)ynyl, (C2-C6)alkenyl, (C2-C6)ynyl, -OH, -OP(O)(O H)2, -OC(O)(C1-C6)alkyl, -C(O)(C1-C6)alkyl, -OC(O)O(C1-C6)alkyl, -NH2, -NH((C1-C6)alkyl), -N((C1-C6)alkyl)2, -NHC(O)(C1-C6)alkyl, -C(O)NH(C1-C6)alkyl, -S(O)2(C1-C6)alkyl, -S(O)NH(C1-C6)alkyl, and S(O)N((C1-C6)alkyl)2. The substituent itself may be optionally substituted. As used herein, "optionally substituted" also refers to substituted or unsubstituted substances, as defined below.

[0032] As used herein, the term "substituted" means that any one or more hydrogen atoms on a specified atom are selectively substituted from the indicated group, provided that the substitution does not exceed the normal valence of the specified atom, and that the substitution produces a stable compound. When the substituent is an oxo or ketone (i.e., ═O), then two hydrogen atoms on the atom are substituted. Keto substituents are not present on the aromatic moiety. As used herein, a cyclic double bond is a double bond formed between two adjacent ring atoms (e.g., C═C, C═N, or N═N). "Stable compound" and "stable structure" are intended to indicate that the compound is robust enough to withstand separation from the reference material (RM) to useful purity and formulation into an effective therapeutic agent. For example, an aryl group substituted with a cycloalkyl group may indicate that the cycloalkyl group is attached to one atom of the aryl group by a bond or by fusion with the aryl group and sharing two or more common atoms.

[0033] As used herein, the term “unsubstituted” means that a particular group does not have substituents.

[0034] As used herein, “alkyl” refers to an optionally substituted straight-chain and branched aliphatic group having 1 to 30 carbon atoms. “C1, C2, C3, C4, C5, or C6 alkyl” or “C1-C6 alkyl” is intended to include C1, C2, C3, C4, C5, or C6 straight-chain (linear) saturated aliphatic hydrocarbon groups and C3, C4, C5, or C6 branched saturated aliphatic hydrocarbon groups. For example, C1-C6 alkyl is intended to include C1, C2, C3, C4, C5, and C6 alkyl groups. Examples of alkyl groups include portions having one to six carbon atoms, such as, but not limited to, methyl, ethyl, n-propyl, isopropyl, n-butyl, sec-butyl, tert-butyl, n-pentyl, isopentyl, or n-hexyl. In some embodiments, the straight-chain or branched alkyl group has six or fewer carbon atoms (e.g., C1-C6 for straight-chain, C3-C6 for branched-chain), and in another embodiment, the straight-chain or branched alkyl group has four or fewer carbon atoms. As used herein, the term "heteroalkyl" encompasses an alkyl group having one or more heteroatoms. As used herein, the term "optionally substituted alkyl" refers to an unsubstituted alkyl group or an alkyl group in which one or more hydrogen atoms on one or more carbons of a hydrocarbon skeleton are replaced by a specified substituent. Such substituents may include, for example, alkyl, alkenyl, alkynyl, halogen, hydroxyl, alkyl carbonyloxy, aryl carbonyloxy, alkoxy carbonyloxy, aryloxy carbonyloxy, carboxylic acid ester, alkyl carbonyl, aryl carbonyl, alkoxy carbonyl, amino carbonyl, alkyl amino carbonyl, dialkyl amino carbonyl, alkyl thiocarbonyl, alkoxy, phosphate ester, phosphonate group, hypophosphonate group, amino (including alkylamino, dialkylamino, arylamino, diarylamino and alkylarylamino), acylamino (including alkyl carbonylamino, aryl carbonylamino, carbamoyl and urea), amido, imino, mercapto, alkylthio, arylthio, thiocarboxylic acid ester, sulfate ester, alkyl sulfinyl, sulfonate group, aminosulfonyl, sulfonamide, nitro, trifluoromethyl, cyano, azide, heterocyclic, alkyl aryl or aromatic or heteroaromatic moiety.

[0035] "Alkoxy" refers to a straight-chain or branched saturated hydrocarbon containing 1-12 carbon atoms, i.e., -O (alkyl). Examples of alkoxy groups include, but are not limited to, methoxy, ethoxy, propoxy, butoxy, tert-butoxy, or pentoxy.

[0036] As used herein, the term "alkenyl" includes unsaturated or partially unsaturated aliphatic groups with similar length and possible substitutions to the alkyl groups described above, but containing at least one double bond. For example, the term "alkenyl" includes straight-chain alkenyl groups (e.g., vinyl, propenyl, butenyl, pentenyl, hexenyl, heptenyl, octenyl, nonenyl, decenyl) and branched alkenyl groups. In some embodiments, the straight-chain or branched alkenyl groups have six or fewer carbon atoms in their backbone (e.g., for straight chains, C1). 2-6 For sidechains, C3-6 ). Term "C 2-6 "Including alkenyl groups containing two to six carbon atoms. The term "C" 3-6 "Including alkenyl groups containing three to six carbon atoms."

[0037] As used herein, the term "optionally substituted alkenyl" refers to an unsubstituted alkenyl or an alkenyl in which one or more hydrogen atoms on one or more carbon atoms of a hydrocarbon skeleton are replaced by a specified substituent. Such substituents may include, for example, alkyl, alkenyl, alkynyl, halogen, hydroxyl, alkyl carbonyloxy, aryl carbonyloxy, alkoxy carbonyloxy, aryloxy carbonyloxy, carboxylic acid ester, alkyl carbonyl, aryl carbonyl, alkoxy carbonyl, amino carbonyl, alkyl amino carbonyl, dialkyl amino carbonyl, alkyl thiocarbonyl, alkoxy, phosphate ester, phosphonate group, hypophosphonate group, amino (including alkylamino, dialkylamino, arylamino, diarylamino and alkylarylamino), acylamino (including alkyl carbonylamino, aryl carbonylamino, carbamoyl and urea), amido, imino, mercapto, alkylthio, arylthio, thiocarboxylic acid ester, sulfate ester, alkyl sulfinyl, sulfonate group, aminosulfonyl, sulfonamide group, nitro, trifluoromethyl, cyano, heterocyclic, alkyl aryl or aromatic or heteroaromatic moiety.

[0038] As used herein, the term "alkynyl" includes an unsaturated aliphatic group with a similar length and possible substitutions to the alkyl groups described above, but containing at least one triple bond. For example, "alkynyl" includes straight-chain alkynyl groups (e.g., ethynyl, propynyl, butynyl, pentyynyl, hexynyl, heptyynyl, octyynyl, nonynyl, decanynyl) and branched-chain alkynyl groups. In some embodiments, the straight-chain or branched alkynyl group has six or fewer carbon atoms in its backbone (e.g., for a straight chain, C...). 2-6 For sidechains, C 3-6 ). Term "C 2-6 "Including ynyl groups containing two to six carbon atoms. The term "C" 3-6 "Including ynyl groups containing three to six carbon atoms."

[0039] As used herein, the term "optionally substituted alkynyl" refers to an unsubstituted alkynyl or an alkynyl group in which one or more hydrogen atoms on one or more carbon atoms of a hydrocarbon skeleton are replaced by a specified substituent. Such substituents may include, for example, alkyl, alkenyl, alkynyl, halogen, hydroxyl, alkyl carbonyloxy, aryl carbonyloxy, alkoxy carbonyloxy, aryloxy carbonyloxy, carboxylic acid ester, alkyl carbonyl, aryl carbonyl, alkoxy carbonyl, amino carbonyl, alkyl amino carbonyl, dialkyl amino carbonyl, alkyl thiocarbonyl, alkoxy, phosphate ester, phosphonate group, hypophosphonate group, amino (including alkylamino, dialkylamino, arylamino, diarylamino and alkylarylamino), acylamino (including alkyl carbonylamino, aryl carbonylamino, carbamoyl and urea), amido, imino, mercapto, alkylthio, arylthio, thiocarboxylic acid ester, sulfate ester, alkyl sulfinyl, sulfonate group, aminosulfonyl, sulfonamide, nitro, trifluoromethyl, cyano, azide, heterocyclic, alkyl aryl or aromatic or heteroaromatic moiety.

[0040] Other optional substituted portions (such as optional substituted cycloalkyl, heterocycloalkyl, aryl, or heteroaryl) include both unsubstituted portions and portions having one or more specified substituents. For example, substituted heterocycloalkyl includes those substituted with one or more alkyl groups, such as 2,2,6,6-tetramethyl-piperidinyl and 2,2,6,6-tetramethyl-1,2,3,6-tetrahydropyridinyl.

[0041] As used herein, the term "cycloalkyl" refers to a group having 3 to 30 carbon atoms (e.g., C36, C46, ​​C56, C6 ... 3-12 C 3-10 Or C 3-8 Cycloalkyl refers to monocyclic or polycyclic (e.g., fused, bridged, or spiro) systems of saturated or partially unsaturated hydrocarbons. Examples of cycloalkyl groups include, but are not limited to, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, cycloheptyl, cyclooctyl, cyclopentenyl, cyclohexenyl, cycloheptenyl, 1,2,3,4-tetrahydronaphthyl, and adamantyl. In the case of polycyclic cycloalkyl groups, only one ring in the cycloalkyl group must be non-aromatic.

[0042] As used herein, the term "heterocyclic alkyl" refers to a saturated or partially unsaturated 3-8 member monocyclic or bicyclic, 7-12 member bicyclic (fused, bridged, or spirocyclic) or 11-14 member tricyclic system having one or more heteroatoms (such as O, N, S, P, or Se) (e.g., 1 or 1-2 or 1-3 or 1-4 or 1-5 or 1-6 heteroatoms, or for example 1, 2, 3, 4, 5, or 6 heteroatoms independently selected from nitrogen, oxygen, and sulfur, unless otherwise specified). Examples of heterocyclic alkyl groups include, but are not limited to, piperidinyl, piperazinyl, pyrrolyl, dioxyl, tetrahydrofuranyl, isoindolinyl, indololinyl, imidazoalkyl, pyrazolyl, oxazolyl, isoxazolyl, triazolyl, ethylene oxide, aziridine, oxazolyl, thioheptanyl, 1,2,3,6-tetrahydropyridinyl, tetrahydropyranyl, dihydropyranyl, pyranyl, morpholinyl, tetrahydrothiopyranyl, 1,4-diazacycloheptyl, 1,4-oxazacycloheptyl, 2- Oxa-5-azabicyclo[2.2.1]heptyl, 2,5-diazabicyclo[2.2.1]heptyl, 2-oxa-6-azaspiro[3.3]heptyl, 2,6-diazaspiro[3.3]heptyl, 1,4-dioxa-8-azaspiro[4.5]decyl, 1,4-dioxaspiro[4.5]decyl, 1-oxaspiro[4.5]decyl, 1-azaspiro[4.5]decyl, 3'H-spiro[cyclohexane-1,1'-isobenzofuran]-yl, 7'H-spiro[cyclohexane-1, 5'-furano[3,4-b]pyridinyl]-yl, 3'H-spiro[cyclohexane-1,1'-furano[3,4-c]pyridinyl]-yl, 3-azabicyclo[3.1.0]hexyl, 3-azabicyclo[3.1.0]hex-3-yl, 1,4,5,6-tetrahydropyrrolo[3,4-c]pyrazolyl, 3,4,5,6,7,8-hexahydropyrido[4,3-d]pyrimidinyl, 4,5,6,7-tetrahydro-1H-pyrazolo[3,4-c]pyridinyl, 5,6,7 ,8-Tetrahydropyrido[4,3-d]pyrimidinyl, 2-azaspiro[3.3]heptyl, 2-methyl-2-azaspiro[3.3]heptyl, 2-azaspiro[3.5]nonyl, 2-methyl-2-azaspiro[3.5]nonyl, 2-azaspiro[4.5]decyl, 2-methyl-2-azaspiro[4.5]decyl, 2-oxa-azaspiro[3.4]octyl, 2-oxa-azaspiro[3.4]oct-6-yl, 5,6-dihydro-4H-cyclopentadien[b]thiophenyl, etc. In the case of polycyclic heterocyclic alkyl groups, only one ring in the heterocyclic alkyl group must be non-aromatic (e.g., 1,3-dihydrobenzo[c]isoxazol-3-yl).

[0043] As used herein, the term "optionally substituted heterocyclic alkyl" refers to an unsubstituted heterocyclic alkyl group in which one or more hydrogen atoms on one or more carbons or heteroatoms are replaced by a specified substituent. Such substituents may include, for example, alkyl, alkenyl, alkynyl, halogen, hydroxyl, alkyl carbonyloxy, aryl carbonyloxy, alkoxy carbonyloxy, aryloxy carbonyloxy, carboxylic acid ester, alkyl carbonyl, aryl carbonyl, alkoxy carbonyl, amino carbonyl, alkyl amino carbonyl, dialkyl amino carbonyl, alkyl thiocarbonyl, alkoxy, phosphate ester, phosphonate group, hypophosphonate group, amino (including alkylamino, dialkylamino, arylamino, diarylamino and alkylarylamino), acylamino (including alkyl carbonylamino, aryl carbonylamino, carbamoyl and urea), amido, imino, mercapto, alkylthio, arylthio, thiocarboxylic acid ester, sulfate ester, alkyl sulfinyl, sulfonate group, aminosulfonyl, sulfonamide, nitro, trifluoromethyl, cyano, azide, heterocyclic, alkyl aryl or aromatic or heteroaromatic moiety.

[0044] Unless otherwise explicitly defined, the term "aryl" refers to a cyclic aromatic hydrocarbon group having one to three aromatic rings, including monocyclic or bicyclic groups such as phenyl, biphenyl, or naphthyl. In cases containing two aromatic rings (bicyclic, etc.), the aromatic rings of the aryl group may be joined at a single point (e.g., biphenyl) or fused (e.g., naphthyl). The aryl group may optionally be substituted at any attachment point with one or more substituents (e.g., one to five substituents). Exemplary substituents include, but are not limited to, -H, -halogen, -O-(C 1-6 )alkyl, (C 1-6 )alkyl, -O-(C 2-6 )alkenyl, -O-(C 2-6 ) ynyl group, (C 2-6 )alkenyl, (C 2-6 ) alkynyl group, -OH, -OP(O)(OH)2, -OC(O)(C 1-6 )alkyl, -C(O)(C 1-6 )alkyl, -OC(O)O(C 1-6 )alkyl, -NH2, NH((C 1-6 )alkyl), N((C 1-6 )alkyl)2、-S(O)2-(C 1-6 )alkyl, -S(O)NH(C 1-6 )alkyl and -S(O)N((C 1-6Alkyl group 2. The substituent itself may be optionally substituted. Furthermore, when containing two or more fused rings, the aryl group as defined herein may have a saturated or partially unsaturated ring fused to a fully unsaturated aromatic ring. Exemplary ring systems of these aryl groups include, but are not limited to, phenyl, biphenyl, naphthyl, anthracene, phenatenyl, indanyl, indenyl, tetrahydronaphthyl, tetrahydrobenzoanthrenyl, 10,11-dihydro-5H-dibenzo[a,d][7]anthrenyl, etc. Furthermore, when containing two or more fused rings, the aryl group as defined herein may have a saturated or partially unsaturated heterocycle fused to a fully unsaturated aromatic ring. Exemplary cyclic systems of these aryl groups include, but are not limited to, benzo[d][1,3]dioxacyclopenten-5-yl, 2,3-dihydrobenzo[b][1,4]dioxin-6-yl, benzo[d]isoxazol-3(2H)-one-6-yl, benzo[d]oxazol-2(3H)-one-6-yl, and benzo[d]oxazol-2(3H)-one-5-yl.

[0045] Unless otherwise explicitly defined, "heteroaryl" means a monovalent monocyclic or polycyclic aromatic group of 5 to 24 ring atoms, containing one or more cyclic heteroatoms selected from N, O, S, P, Se, or B, with the remaining ring atoms being C. As defined herein, "heteroaryl" also means a bicyclic heteroaromatic group in which the heteroatoms are selected from N, O, S, P, Se, or B. As defined herein, "heteroaryl" also means a tricyclic heteroaromatic group containing one or more cyclic heteroatoms selected from N, O, S, P, Se, or B. The aromatic group may optionally be independently substituted by one or more substituents as described herein.Examples include, but are not limited to, furanyl, thiophene, pyrrolyl, pyridyl, pyrazolyl, pyrimidinyl, imidazoleyl, isoxazolyl, oxazolyl, oxadiazolyl, pyrazinyl, indoleyl, thiophene-2-yl, quinolinyl, benzopyranyl, isothiazolyl, thiazolyl, thiadiazole, indazole, benzimidazolyl, thieno[3,2-b]thiophene, triazolyl, triazinyl, imidazo[1,2-b]pyrazolyl, furan[2,3-c]pyridyl, imidazo[1,2-a]pyridyl, indazoleyl, pyrrolo[2,3-c]pyridyl, pyrrolo[3,2-c]pyridyl, pyrazolo[3,4-c]pyridyl, thieno[3,2-c]pyridyl, thieno[3,2-c]pyridyl, thieno[2,3-c]pyridyl, pyrrolo[3,2-c]pyridyl, pyrazololo[3,4-c]pyridyl, thieno[3,2 ... [2,3-c]pyridyl, thieno[2,3-b]pyridyl, benzothiazolyl, indole, indolinyl, indololinyl, indololinone, dihydrobenzothiaphenyl, dihydrobenzofuranyl, benzofuran, chromanyl, thiochromanyl, tetrahydroquinolinyl, dihydrobenzothiazine, quinolinyl, isoquinolinyl, 1,6-naphthidyl, benzo[de]isoquinolinyl, pyrido[4,3-b][1,6]naphthidyl, thieno[2,3-b]pyrazinyl, quinazolinyl, tetrazo[1,5-a]pyridyl, [1,2,4]triazo[4,3-a]pyridyl, isoindolyl, pyrrolo[2,3-b]pyridyl, pyrrolo[3,4-b]pyridyl , pyrrolo[3,2-b]pyridyl, imidazo[5,4-b]pyridyl, pyrrolo[1,2-a]pyrimidinyl, tetrahydropyrrolo[1,2-a]pyrimidinyl, 3,4-dihydro-2H-1λ2-pyrrolo[2,1-b]pyrimidinyl, dibenzo[b,d]thiophene, pyridin-2-one, furano[3,2-c]pyridyl, furano[2,3-c]pyridyl, 1H-pyrido[3,4-b][1,4]thiazinyl, benzoxazolyl, benzoisoxazolyl, furano[2,3-b]pyridyl, benzothiophene, 1,5-naphthidyl, furano[3,2-b]pyridine, [1,2,4]triazol[1,5- a]pyridyl, benzo[1,2,3]triazolyl, imidazo[1,2-a]pyrimidinyl, [1,2,4]triazol[4,3-b]pyridazinyl, benzo[c][1,2,5]thiadiazolyl, benzo[c][1,2,5]oxadiazole, 1,3-dihydro-2H-benzo[d]imidazol-2-one, 3,4-dihydro-2H-pyrazolo[1,5-b][1,2]oxazinyl, 4,5,6,7-tetrahydropyrazolo[1,5-a]pyridyl, thiazo[5,4-d]thiazolyl, imidazo[2,1-b][1,3,4]thiadiazolyl, thieno[2,3-b]pyrroleyl, 3H-indolyl and their derivatives.Furthermore, when containing two or more fused rings, the heteroaryl group as defined herein may have one or more saturated or partially unsaturated rings fused to a fully unsaturated aromatic ring, for example, a 5-membered heteroaromatic ring containing 1 to 3 heteroatoms selected from N, O, S, P, Se, or B, or a 6-membered heteroaromatic ring containing 1 to 3 nitrogen atoms, wherein the saturated or partially unsaturated ring comprises 0 to 4 heteroatoms selected from N, O, S, P, Se, or B, and is optionally substituted with one or more oxo groups. In heteroaryl ring systems containing more than two fused rings, the saturated or partially unsaturated ring may be further fused to the saturated or partially unsaturated rings described herein. Exemplary ring systems of these heteroaryl groups include, for example, indololinyl, indololinone, dihydrobenzothiophene, dihydrobenzofuran, chromanyl, thiochromanyl, tetrahydroquinolinyl, dihydrobenzothiazine, 3,4-dihydro-11H-isoquinolinyl, 2,3-dihydrobenzofuranyl, benzofuranone, indololinyl, hydroxyindolyl, indolyl, 1,6-dihydro-7H-pyrazolo[3,4-c]pyridin-7-one, 7,8-dihydro-6H-pyrido[3, [2-b]pyrrolizinyl, 8H-pyrido[3,2-b]pyrrolizinyl, 1,5,6,7-tetrahydrocyclopentadien[b]pyrazolo[4,3-e]pyridinyl, 7,8-dihydro-6H-pyrido[3,2-b]pyrrolizin, pyrazolo[1,5-a]pyrimidin-7(4H)-keto, 3,4-dihydropyrazolo[1,2-a]indole-1(2H)-keto or benzo[c][1,2]oxaborane-1(3H)-olyl. Cycloalkyl, heterocycloalkyl, aryl, or heteroaryl rings may be substituted at one or more ring positions (e.g., where the ring forms a carbon atom or a heteroatom such as N) with substituents such as alkyl, alkenyl, alkynyl, halogen, hydroxyl, alkoxy, alkylcarbonyloxy, arylcarbonyloxy, alkoxycarbonyloxy, aryloxycarbonyloxy, carboxylic ester, alkylcarbonyl, alkylaminocarbonyl, aralkylaminocarbonyl, alkenylaminocarbonyl, alkylcarbonyl, arylcarbonyl, aralkylcarbonyl, alkenylcarbonyl, alkoxycarbonyl, amino Carbonyl, alkylthiocarbonyl, phosphate ester, phosphonate group, hypophosphonate group, amino (including alkylamino, dialkylamino, arylamino, diarylamino and alkylarylamino), acylamino (including alkylcarbonylamino, arylcarbonylamino, carbamoyl and urea), amido, imino, mercapto, alkylthio, arylthio, thiocarboxylic acid ester, sulfate ester, alkylsulfinyl, sulfonate group, aminosulfonyl, sulfonamide group, nitro, trifluoromethyl, cyano, azide, heterocyclic, alkylaryl or aromatic or heteroaromatic moiety. Aryl and heteroaryl groups can also be fused or bridged with alicyclic or heterocyclic (which are not aromatic) to form polycyclic systems (e.g., tetrahydronaphthalene, methylenedioxyphenyl such as benzo[d][1,3]dioxacyclopenten-5-yl).

[0046] When the bond between a substituent and a substituent crosses with the bonds between two atoms in the ring, the substituent can bond to any atom in the ring. For example, in structural... In the middle, R 6 Substituents can replace any hydrogen atom attached to an atom in the ring, including hydrogen atom attached to the ring atom indicated by B. When a substituent is listed without specifying the atom to which it is bonded to the remainder of the compound in the given formula, then the substituent can be bonded via any atom in the formula. For example, structure Coverage Combinations of substituents and / or variables are only permitted if such combinations produce stable compounds.

[0047] When any variable (e.g., R) appears more than once in any component or formula of a compound, its definition for each occurrence is independent of its definition for each subsequent occurrence. Thus, for example, if a group is shown to be substituted by 0-2 R moieties, the group may optionally be substituted by up to two R moieties, and R is independently selected from the definition of R for each occurrence. Furthermore, combinations of substituents and / or variables are only permitted if such combinations produce a stable compound.

[0048] As used herein, the term "hydroxyl" or "hydroxyl" includes groups having -OH or -O-.

[0049] As used in this article, the terms “halogenated group” or “halogen” refer to fluorine, chlorine, bromine and iodine.

[0050] The terms "haloalkyl" or "haloalkoxy" refer to an alkyl or alkoxy group that has been substituted with one or more halogen atoms. Examples of haloalkyl groups include, but are not limited to, trifluoromethyl, difluoromethyl, pentafluoroethyl, and trichloromethyl. Examples of haloalkoxy groups include, but are not limited to, trifluoromethoxy, difluoromethoxy, pentafluoroethoxy, and trichloromethoxy.

[0051] As used herein, the term "cyano" refers to a nitrile group (e.g., -CN).

[0052] As used herein, the term "optionally substituted haloalkyl" refers to an unsubstituted haloalkyl group in which one or more hydrogen atoms on one or more carbon atoms of a hydrocarbon skeleton are replaced by a specified substituent. Such substituents may include, for example, alkyl, alkenyl, alkynyl, halogen, hydroxyl, alkyl carbonyloxy, aryl carbonyloxy, alkoxy carbonyloxy, aryloxy carbonyloxy, carboxylic acid ester, alkyl carbonyl, aryl carbonyl, alkoxy carbonyl, amino carbonyl, alkyl amino carbonyl, dialkyl amino carbonyl, alkyl thiocarbonyl, alkoxy, phosphate ester, phosphonate group, hypophosphonate group, amino (including alkylamino, dialkylamino, arylamino, diarylamino and alkylarylamino), acylamino (including alkyl carbonylamino, aryl carbonylamino, carbamoyl and urea), amido, imino, mercapto, alkylthio, arylthio, thiocarboxylic acid ester, sulfate ester, alkyl sulfinyl, sulfonate group, aminosulfonyl, sulfonamide, nitro, trifluoromethyl, cyano, azide, heterocyclic, alkyl aryl or aromatic or heteroaromatic moiety.

[0053] As used herein, the term "alkoxy" or "alkoxyl" includes substituted and unsubstituted alkyl, alkenyl, and alkynyl groups covalently linked to an oxygen atom. Examples of alkoxy or alkoxyl groups include, but are not limited to, methoxy, ethoxy, isopropyloxy, propoxy, butoxy, and pentoxy. Examples of substituted alkoxy groups include haloalkoxy groups. Alkoxy groups can be substituted with groups such as alkenyl, alkynyl, halogen, hydroxyl, alkyl carbonyloxy, aryl carbonyloxy, alkoxy carbonyloxy, aryloxy carbonyloxy, carbonate, alkyl carbonyl, aryl carbonyl, alkoxy carbonyl, amino carbonyl, alkyl amino carbonyl, dialkyl amino carbonyl, alkyl thiocarbonyl, alkoxy, phosphate ester, phosphonate group, hypophosphonate group, amino (including alkylamino, dialkylamino, arylamino, diarylamino and alkylarylamino), acylamino (including alkyl carbonylamino, aryl carbonylamino, carbamoyl and urea), amido, imino, mercapto, alkylthio, arylthio, thiocarboxylic acid ester, sulfate ester, alkyl sulfinyl, sulfonate group, aminosulfonyl, sulfonamide, nitro, trifluoromethyl, cyano, azide, heterocyclic, alkyl aryl or aromatic or heteroaromatic moiety. Examples of halogen-substituted alkoxy groups include, but are not limited to, fluoromethoxy, difluoromethoxy, trifluoromethoxy, chloromethoxy, dichloromethoxy, and trichloromethoxy.

[0054] As used herein, the term "solvent" refers to a solvation form containing stoichiometric or non-stoichiometric amounts of solvent. Some compounds tend to trap a fixed molar ratio of solvent molecules in their crystalline solid state, thus forming a solvate. If the solvent is water, the solvate formed is a hydrate, and if the solvent is an alcohol, the solvate formed is an alcohol. Hydrates are formed by the combination of one or more water molecules with a molecule of another substance, where the water retains its molecular state as H₂O.

[0055] As used herein, the term "isomer" refers to compounds that have the same molecular formula but differ in the bonding order of their atoms or in the spatial arrangement of their atoms. Isomers with different spatial arrangements of their atoms are called "stereoisomers." Stereoisomers that are not mirror images of each other are called "diastereomers," and stereoisomers that are not superimposed mirror images of each other are called "enantiomers" or sometimes optical isomers. A mixture containing equal amounts of individual enantiomers with opposite chirality is called a "racemic mixture." Compounds of formula (I) may have one or more asymmetric carbon atoms and may appear as racemates, racemic mixtures, and as individual enantiomers or diastereomers.

[0056] As used herein, the term "tautomer" is one of two or more structural isomers that exist in equilibrium and are readily converted from one isomer to another. This conversion results in the formal migration of hydrogen atoms, accompanied by the conversion of adjacent conjugated double bonds. Tautomers exist in solution as a mixture of tautomer groups. In solutions where tautomerization is possible, a chemical equilibrium of tautomers will be reached. The exact ratio of tautomers depends on several factors, including temperature, solvent, and pH. The concept of tautomers that can interconvert through tautomerization is called tautomerism. In keto-enol tautomerism, the simultaneous transfer of electrons and hydrogen atoms occurs.

[0057] It should be understood that the compounds described in this disclosure may be described as different tautomers. It should also be understood that when a compound has tautomer forms, all tautomer forms are intended to be included within the scope of this disclosure, and the naming of the compound does not exclude any tautomer form. It should be understood that some tautomers may have higher levels of activity than others.

[0058] This disclosure also covers isotopically labeled compounds of formula I (e.g., those labeled with...). 2 H and 14Those of C). Replacing with a heavier isotope (such as deuterium) can provide certain therapeutic advantages due to greater metabolic stability (e.g., increased in vivo half-life or reduced dose requirement). Isotope-labeled compounds of formula I can generally be prepared by replacing non-isotope-labeled reagents with appropriate isotope-labeled reagents through a similar procedure to those disclosed in the schemes herein and / or the examples below.

[0059] This disclosure also includes pharmaceutical compositions comprising an effective amount of the disclosed compound and a pharmaceutically acceptable carrier.

[0060] As used herein, the term "pharmaceutically acceptable salt" refers to a derivative of a compound of this disclosure, wherein the parent compound is modified by preparing its acidic or basic salt. Examples of pharmaceutically acceptable salts include, but are not limited to, mineral or organic salts of basic residues (such as amines), basic or organic salts of acidic residues (such as carboxylic acids), etc. Pharmaceutically acceptable salts include, for example, conventional non-toxic salts or quaternary ammonium salts of parent compounds formed from non-toxic inorganic or organic acids. For example, such conventional non-toxic salts include, but are not limited to, those derived from inorganic and organic acids selected from: 2-acetoxybenzoic acid, 2-hydroxyethanesulfonic acid, acetic acid, ascorbic acid, benzenesulfonic acid, benzoic acid, bicarbonic acid, carbonic acid, citric acid, edemaic acid, ethanedisulfonic acid, 1,2-ethanesulfonic acid, fumaric acid, glucoheponic acid, gluconic acid, glutamic acid, glycolic acid, glycolylarsanilic acid, hexylresorcinic acid, hydra Bamic acid, hydrobromic acid, hydrochloric acid, hydroiodic acid, hydroxymaleic acid, hydroxynaphthenic acid, hydroxyethanesulfonic acid, lactic acid, lactobionic acid, lauryl sulfonic acid, maleic acid, malic acid, mandelic acid, mesylic acid, napsylic acid, nitric acid, oxalic acid, primordic acid, pantothenic acid, phenylacetic acid, phosphoric acid, polygalacturonic acid, propionic acid, salicylic acid, stearic acid, subacetic acid, succinic acid, aminosulfonic acid, p-aminobenzenesulfonic acid, sulfuric acid, tannic acid, tartaric acid, toluenesulfonic acid, and common amino acids (e.g., glycine, alanine, phenylalanine, arginine, etc.).

[0061] In some implementations, pharmaceutically acceptable salts are sodium, potassium, calcium, magnesium, diethylamine, choline, meglumine, benzathine penicillin, tromethamine, ammonium, arginine, or lysine.

[0062] Other pharmaceutically acceptable examples of salts include hexanoic acid, cyclopentanepropionic acid, pyruvate, malonic acid, 3-(4-hydroxybenzoyl)benzoic acid, cinnamic acid, 4-chlorobenzenesulfonic acid, 2-naphthalenesulfonic acid, 4-toluenesulfonic acid, camphorsulfonic acid, 4-methylbicyclo-[2.2.2]-oct-2-en-1-carboxylic acid, 3-phenylpropionic acid, trimethylacetic acid, tert-butylacetic acid, mucoconic acid, etc. This disclosure also covers salts formed when an acidic proton present in the parent compound is replaced by a metal ion (e.g., an alkali metal ion, alkaline earth ion, or aluminum ion) or coordinated with an organic base (such as ethanolamine, diethanolamine, triethanolamine, tromethamine, N-methylglucosamine, etc.). It should be understood that in salt form, the ratio of the compound to the cation or anion of the salt can be 1:1, or any ratio other than 1:1, such as 3:1, 2:1, 1:2, or 1:3.

[0063] It should be understood that all references to pharmaceutically acceptable salts include the same salt in its solvation form (solvent) or crystalline form (polymorph) as defined herein.

[0064] "Patient" or "subject" is a mammal, such as a human, mouse, rat, guinea pig, dog, cat, horse, cow, pig, or a non-human primate (such as a monkey, chimpanzee, baboon, or rhesus monkey).

[0065] When used in combination with a compound, "effective amount" is the amount that is effective for use in cell therapy.

[0066] As used in this disclosure, the term “carrier” encompasses carriers, excipients, and diluents, and refers to materials, compositions, or media that involve carrying or delivering a pharmaceutical agent from one organ or part of a subject’s body to another organ or part of the body, such as liquid or solid fillers, diluents, excipients, solvents, or encapsulating materials.

[0067] Unless otherwise stated, the term “barrier” as used in this disclosure means disease, symptom or patient and is used interchangeably with it.

[0068] As used in this disclosure, the terms “administer,” “administering,” or “administration” mean the direct administration of the disclosed compound or a pharmaceutically acceptable salt or composition thereof to a subject, or the administration of the compound or a pharmaceutically acceptable salt of the compound to a subject, wherein the prodrug derivative or analog or composition thereof may form an equivalent amount of the active compound in the subject’s body.

[0069] As used in this disclosure, the term "prodrug" means a compound that can be converted into the disclosed compound in vivo through metabolism (e.g., through hydrolysis).

[0070] This disclosure relates to compounds and compositions capable of inhibiting DNA-dependent protein kinases (DNA-PK) in subjects or biological samples.

[0071] In a first aspect of this disclosure, compounds of formula (I) are described: (I), and pharmaceutically acceptable salts, hydrates, solvates, prodrugs, stereoisomers, and tautomers, of which A and R 1 R 2 X 1 and X 2 As described in this article.

[0072] The details of this disclosure are set forth in the accompanying description. Although methods and materials similar to or equivalent to those described and materials herein may be used in the practice or testing of this disclosure, illustrative methods and materials are described hereafter. Other features, objectives, and advantages of this disclosure will become clear from the specification and the claims. In this specification and the appended claims, the singular form also includes the plural form unless the context clearly requires otherwise. Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure pertains. All patents and publications referenced in this specification are incorporated herein by reference in their entirety.

[0073] In some implementations, A is optionally represented by one or more R 3 Substituted 6- to 8-membered cycloalkyl groups, wherein each R 3 Independently selected from halogens, C1-C4 alkyl groups, and C1-C4 alkoxy groups. In some embodiments, A is optionally separated by one or more R groups. 3 A substituted 6-membered cycloalkyl group. In some embodiments, A is optionally replaced by one or more R groups. 3 A substituted 7-membered cycloalkyl group. In some embodiments, A is optionally replaced by one or more R groups. 3 Substituted 8-membered cycloalkyl group. In some embodiments, A is a 6- to 8-membered cycloalkyl group. In some embodiments, A is substituted with an R 3 Substituted 6- to 8-membered cycloalkyl groups. In some embodiments, A is composed of two R groups. 3 Substituted 6- to 8-membered cycloalkyl groups. In some embodiments, A is composed of three R groups. 3 Substituted 6- to 8-membered cycloalkyl groups. In some embodiments, A is composed of four R groups. 3Substituted 6- to 8-membered cycloalkyl groups. In some embodiments, A is composed of five R groups. 3 Substituted 6- to 8-membered cycloalkyl groups.

[0074] In some implementation schemes, A is selected from: , , , , , , , , and , Where p is 0, 1, 2, or 3. In some embodiments, p is 0. In some embodiments, p is 1. In some embodiments, p is 2. In some embodiments, p is 3. In some embodiments, p is 0 or 1. In some embodiments, p is 0, 1, or 2.

[0075] In some implementation schemes, X 1 Is it N or CR? 4 , where R 4 Selected from -CN, halogens, C1-C4 alkyl, C1-C4 alkoxy, CO (C1-C4 alkyl), and CHO. In some embodiments, X 1 It is N. In some implementations, X 1 It is CR 4 .

[0076] In some implementation schemes, X 2 It is O, S, CH-OH, NH, or N (C1-C4 alkyl). In some embodiments, X 2 It is O. In some implementations, X 2 It is S. In some implementations, X 2 It is CH-OH. In some implementations, X 2 It is NH. In some implementations, X 2 It is an N (C1-C4 alkyl)

[0077] In some implementation schemes, R 1 It is H or a 6- to 8-membered heterocyclic alkyl or heteroaryl group containing at least one heteroatom selected from N and O, wherein the heterocyclic alkyl or heteroaryl group is optionally surrounded by one or more R groups. 5 Replace, where each R 5 Independently selected from halogens and C1-C4 alkyl groups. In some embodiments, R 1 It is H. In some implementations, R 1It is a 6- to 8-membered heterocyclic alkyl or heteroaryl group containing at least one heteroatom selected from N and O, wherein the heterocyclic alkyl or heteroaryl group is optionally surrounded by one or more R 5 replace.

[0078] In some implementation schemes, R 1 It is a 6-membered heterocyclic alkyl or heteroaryl group containing at least one heteroatom selected from N and O. In some embodiments, R 1 It is a 7-membered heterocyclic alkyl or heteroaryl group containing at least one heteroatom selected from N and O. In some embodiments, R 1 It is an 8-membered heterocyclic alkyl or heteroaryl group containing at least one heteroatom selected from N and O. In some embodiments, R 1 It is a 6-membered heterocyclic alkyl or heteroaryl group containing at least one heteroatom selected from N and O, wherein the heterocyclic alkyl or heteroaryl group is optionally surrounded by one or more R atoms. 5 Replacement. In some implementations, R 1 It is a 7-membered heterocyclic alkyl or heteroaryl group containing at least one heteroatom selected from N and O, wherein the heterocyclic alkyl or heteroaryl group is optionally surrounded by one or more R atoms. 5 Replacement. In some implementations, R 1 It is an 8-membered heterocyclic alkyl or heteroaryl group containing at least one heteroatom selected from N and O, wherein the heterocyclic alkyl or heteroaryl group is optionally surrounded by one or more R atoms. 5 Replacement. In some implementations, R 1 It is a 6-membered heterocyclic alkyl or heteroaryl group containing at least one heteroatom selected from N and O, wherein the heterocyclic alkyl or heteroaryl group is affected by one or more R atoms. 5 Replacement. In some implementations, R 1 It is a 7-membered heterocyclic alkyl or heteroaryl group containing at least one heteroatom selected from N and O, wherein the heterocyclic alkyl or heteroaryl group is affected by one or more R atoms. 5 Replacement. In some implementations, R 1 It is an 8-membered heterocyclic alkyl or heteroaryl group containing at least one heteroatom selected from N and O, wherein the heterocyclic alkyl or heteroaryl group is affected by one or more R atoms. 5 replace.

[0079] In some implementation schemes, R 1 Selected from: , , , , , , , , , , , , , , , , and Where n is 0, 1, 2, or 3. In some embodiments, n is 0. In some embodiments, n is 1. In some embodiments, n is 2. In some embodiments, n is 3. In some embodiments, n is 0 or 1. In some embodiments, n is 0, 1, or 2.

[0080] In some implementation schemes, R 2 It is H, -COO (C1-C4 alkyl), -C(O)O- (aryl or heteroaryl), or a heteroaryl group containing at least one heteroatom selected from N, O, and S, wherein the aryl or heteroaryl group is optionally surrounded by one or more R atoms. 6 Replacement. In some implementations, R 2 It is H. In some implementations, R 2 It is -COO (C1-C4 alkyl) or -C(O)O- (aryl or heteroaryl). In some embodiments, R 2 It is -COO (C1-C4 alkyl) or -C(O)O- (aryl or heteroaryl), wherein the aryl or heteroaryl group is optionally surrounded by one or more R groups. 6 Replacement. In some implementations, R 2 It is -COO (C1-C4 alkyl) or -C(O)O- (aryl or heteroaryl), wherein the aryl or heteroaryl group is influenced by one or more R groups. 6 Replacement. In some implementations, R 2 It is a heteroaryl group containing at least one heteroatom selected from N, O, and S. In some embodiments, R 2 It is a heteroaryl group containing at least one heteroatom selected from N, O, and S, wherein the heteroaryl group is optionally surrounded by one or more R atoms. 6 Replacement. In some implementations, R 2 It is a heteroaryl group containing at least one heteroatom selected from N, O, and S, wherein the heteroaryl group is affected by one or more R atoms. 6 replace.

[0081] In some implementation schemes, R 2 yes Where X 3 X 4 X 5 and X 6 Each of them is independently selected from N and C(R) 6 ), where X 3 X 4X 5 and X 6 At least one of them is C(R) 6 ).

[0082] In some implementation schemes, R 2 yes Where X 3 X 4 X 5 and X 6 Each of these elements is independently selected from N, NH, O, S, and C(R). 6 In some implementations, X 3 X 4 X 5 and X 6 At most one of them is O or S. In some implementations, X 3 X 4 X 5 and X 6 At most one of them is O. In some implementations, X 3 X 4 X 5 and X 6 At most one of them is S.

[0083] In some implementation schemes, R 2 Selected from: , , , , , , , , , , , , , , , , and , Where m is 0, 1, 2, or 3. In some embodiments, m is 0. In some embodiments, m is 1. In some embodiments, m is 2. In some embodiments, m is 3. In some embodiments, m is 0 or 1. In some embodiments, m is 0, 1, or 2.

[0084] In some implementations, each R 3 Independently selected from halogens, C1-C4 alkyl groups, and C1-C4 alkoxy groups. In some embodiments, each R... 3Independently selected from halogens, C1-C3 alkyl groups, and C1-C3 alkoxy groups. In some embodiments, each R... 3 Independently selected from halogens, C1-C2 alkyl groups, and C1-C2 alkoxy groups. In some embodiments, each R... 3 Independently selected from halogens, C1 alkyl groups, and C1 alkoxy groups. In some embodiments, each R... 3 Independently selected from C1-C4 alkyl and C1-C4 alkoxy groups. In some embodiments, each R... 3 Independently selected from halogens and C1-C4 alkoxy groups. In some embodiments, each R... 3 Independently selected from halogens and C1-C4 alkyl groups. In some embodiments, each R... 3 The halogen is independently selected. In some implementations, each R... 3 Independently selected from C1-C4 alkyl groups. In some embodiments, each R 3 It is independently selected from C1-C4 alkoxy groups.

[0085] In some implementation schemes, R 4 Selected from -CN, halogen, C1-C4 alkyl, C1-C4 alkoxy, CO (C1-C4 alkyl), and CHO. In some embodiments, R 4 Yes -CN. In some implementations, R 4 It is a halogen. In some implementations, R 4 It is a C1-C4 alkyl group. In some embodiments, R 4 It is a C1-C4 alkoxy group. In some embodiments, R 4 It is CO (C1-C4 alkyl). In some embodiments, R 4 It is CHO. In some implementations, R 4 Selected from halogens, C1-C4 alkyl groups, C1-C4 alkoxy groups, CO (C1-C4 alkyl), and CHO. In some embodiments, R 4 Selected from -CN, C1-C4 alkyl, C1-C4 alkoxy, CO (C1-C4 alkyl), and CHO. In some embodiments, R 4 Selected from -CN, halogens, C1-C4 alkoxy groups, CO (C1-C4 alkyl), and CHO. In some embodiments, R 4 Selected from -CN, halogens, C1-C4 alkyl, CO (C1-C4 alkyl), and CHO. In some embodiments, R 4 Selected from -CN, halogens, C1-C4 alkyl, C1-C4 alkoxy, and CHO. In some embodiments, R 4 Selected from -CN, halogen, C1-C4 alkyl, C1-C4 alkoxy and CO (C1-C4 alkyl).

[0086] In some implementations, each R 5 Independently selected from halogens and C1-C4 alkyl groups. In some embodiments, each R... 5 Independently selected from halogens and C1-C3 alkyl groups. In some embodiments, each R... 5 Independently selected from halogens and C1-C2 alkyl groups. In some embodiments, each R... 5 Independently selected from halogens and C1 alkyl groups. In some embodiments, each R... 5 It is halogen independently. In some implementations, each R... 5 It is independently a C1-C4 alkyl group.

[0087] In some implementations, each R 6 Independently selected from hydrogen, halogen, -CN, C1-C4 alkyl, C1-C4 haloalkyl, C1-C4 alkoxy, C1-C4 haloalkoxy, CONH (C1-C4 alkyl), COO (C1-C4 alkyl), COO (C3-C8 cycloalkyl), and NH2; or two R atoms connected to adjacent atoms of the heteroaryl ring. 6 The groups form fused 5- or 6-membered rings containing 0-3 heteroatoms selected from O, N, and S. In some embodiments, each R 6 Independently selected from hydrogen, halogen, -CN, C1-C4 alkyl, C1-C4 haloalkyl, C1-C4 alkoxy, C1-C4 haloalkoxy, CONH (C1-C4 alkyl), COO (C1-C4 alkyl), COO (C3-C8 cycloalkyl), and NH2. In some embodiments, each R 6 Independently selected from halogens, -CN, C1-C4 alkyl, C1-C4 haloalkyl, C1-C4 alkoxy, C1-C4 haloalkoxy, CONH (C1-C4 alkyl), COO (C1-C4 alkyl), COO (C3-C8 cycloalkyl), and NH2. In some embodiments, each R 6 Independently selected from hydrogen, halogens, and -CN. In some embodiments, each R... 6 Independently selected from C1-C4 alkyl, C1-C4 haloalkyl, C1-C4 alkoxy, and C1-C4 haloalkoxy. In some embodiments, each R 6 The components are independently selected from CONH (C1-C4 alkyl), COO (C1-C4 alkyl), COO (C3-C8 cycloalkyl), and NH2. In some embodiments, the two R atoms attached to the adjacent atoms of the heteroaryl ring... 6 The group forms a fused 5- or 6-membered ring containing 0-3 heteroatoms selected from O, N, and S. In some embodiments, two R atoms are attached to adjacent atoms of the heteroaryl ring. 6The group forms a fused 5-membered ring containing 0-3 heteroatoms selected from O, N, and S. In some embodiments, two R atoms are attached to adjacent atoms of the heteroaryl ring. 6 The group forms a fused 6-membered ring containing 0-3 heteroatoms selected from O, N and S.

[0088] In one embodiment, the compound of formula (I) has formula (Ia-1): (Ia-1), Or a pharmaceutically acceptable salt, stereoisomer, solvate, prodrug, or tautomer thereof.

[0089] In one embodiment, the compound of formula (I) has formula (Ia-2): (Ia-2), Or a pharmaceutically acceptable salt, stereoisomer, solvate, prodrug, or tautomer thereof.

[0090] In one embodiment, the compound of formula (I) has formula (Ia-3): (Ia-3), Or a pharmaceutically acceptable salt, stereoisomer, solvate, prodrug, or tautomer thereof.

[0091] In one embodiment, the compound of formula (I) has formula (Ia-4): (Ia-4), Or a pharmaceutically acceptable salt, stereoisomer, solvate, prodrug, or tautomer thereof.

[0092] In some embodiments, the compound of formula (I) has formula (Ib-1): (Ib-1), Or a pharmaceutically acceptable salt, stereoisomer, solvate, prodrug, or tautomer thereof.

[0093] In some embodiments, the compound of formula (I) has formula (Ib-2): (Ib-2), Or a pharmaceutically acceptable salt, stereoisomer, solvate, prodrug, or tautomer thereof.

[0094] In some embodiments, the compound of formula (I) has formula (Ib-3): (Ib-3), Or a pharmaceutically acceptable salt, stereoisomer, solvate, prodrug, or tautomer thereof.

[0095] In some embodiments, the compound of formula (I) has formula (Ib-4): (Ib-4), Or a pharmaceutically acceptable salt, stereoisomer, solvate, prodrug, or tautomer thereof.

[0096] In some embodiments, the compound of formula (I) has formula (Ib-5): (Ib-5), Or a pharmaceutically acceptable salt, stereoisomer, solvate, prodrug, or tautomer thereof.

[0097] In some embodiments, the compound of formula (I) has formula (Ib-6): (Ib-6), Or a pharmaceutically acceptable salt, stereoisomer, solvate, prodrug, or tautomer thereof.

[0098] In some embodiments, the compound of Formula I is selected from the compounds provided in Table 1, or pharmaceutically acceptable salts, stereoisomers, solvates, prodrugs, or tautomers thereof.

[0099] In some embodiments, the compound of Formula I is selected from the compounds provided in Table 2, or their pharmaceutically acceptable salts, stereoisomers, solvates, prodrugs, or tautomers.

[0100] In some of the foregoing embodiments, the compound of Formula I is a compound or a pharmaceutically acceptable salt, stereoisomer, solvate, prodrug, or tautomer thereof.

[0101] Table 1. Exemplary DNA-PKi compounds

[0102] Table 2. Other exemplary DNA-PKi compounds

[0103] It should be understood that all isomers are included in this disclosure, including mixtures thereof. If the compound contains a double bond, the substituents may be in the E or Z configuration. If the compound contains a disubstituted cycloalkyl group, the cycloalkyl substituent may have a cis or trans configuration. All tautomers are also intended to be included.

[0104] The compounds disclosed herein, as well as their pharmaceutically acceptable salts, hydrates, solvates, stereoisomers, and prodrugs, can exist in their tautomeric forms (e.g., as amides or imino ethers). All such tautomeric forms are considered as part of this disclosure.

[0105] The compounds disclosed herein may contain asymmetric or chiral centers and therefore exist in different stereoisomeric forms. It is contemplated that all stereoisomeric forms of the compounds of this disclosure, as well as mixtures thereof (including racemic mixtures), constitute a part of this disclosure. Furthermore, this disclosure includes all geometric and positional isomers. For example, if a compound of this disclosure incorporates a double bond or a fused ring, both the cis and trans forms, as well as mixtures thereof, are included within the scope of this disclosure. Each compound disclosed herein includes all enantiomers conforming to the general structure of the compound. Compounds may be in racemic or enantiomerically pure forms, or any other form for stereochemical purposes. Measurement results may reflect data collected in the racemic form, the enantiomerically pure form, or any other form for stereochemical purposes.

[0106] A mixture of diastereomers can be separated into their individual diastereomers based on their physicochemical differences using methods well known to those skilled in the art (e.g., by chromatography and / or fractional crystallization). Enantiomers can be separated by reacting the enantiomer mixture with a suitable optically active compound (e.g., a chiral auxiliary such as a chiral alcohol or Mosher's acid chloride), separating the diastereomers, and converting (e.g., hydrolyzing) the respective diastereomers into their corresponding pure enantiomers. Furthermore, some compounds in this disclosure may be transisomers (e.g., substituted biaryl groups) and are considered part of this disclosure. Enantiomers can also be separated using a chiral HPLC column.

[0107] It is also possible that the compounds of this disclosure can exist in different tautomeric forms, and all such forms are included within the scope of this disclosure. Furthermore, for example, all keto-enol and imine-enamine forms of the compounds are included in this disclosure.

[0108] All stereoisomers of the compounds of this invention (e.g., geometric isomers, optical isomers, etc.) (including salts, solvates, esters, and prodrugs of the compounds, as well as salts, solvates, and esters of prodrugs), such as those due to the possible presence of asymmetric carbons on various substituents, including enantiomers (which can even exist in the absence of asymmetric carbons), rotational isomers, trans-blocking isomers, and diastereomeric isomers, are also included within the scope of this disclosure, as are positional isomers (e.g., like 4-pyridyl and 3-pyridyl). (For example, if the compounds of formula (I) incorporate double bonds or fused rings, both cis and trans forms, as well as mixtures, are included within the scope of this disclosure. Furthermore, for example, all keto-enol and imine-enamine forms of the compounds are included in this disclosure.) Individual stereoisomers of the compounds of this disclosure may, for example, be substantially free of other stereoisomers, or may be mixed as, for example, racemic mixtures or mixed with all other stereoisomers or other selected stereoisomers. The chiral centers of this disclosure may have an S or R configuration as defined in IUPAC 1974 Recommendations. The use of the terms “salt,” “solvent,” “ester,” “prodrug,” etc., is intended to equally apply to salts, solvates, esters, and prodrugs of enantiomers, stereoisomers, rotational isomers, tautomers, positional isomers, racemates, or prodrugs of the compounds of this invention.

[0109] Compounds of Formula I can form salts, which are also within the scope of this disclosure. Unless otherwise stated, references to compounds of the formulas described herein should be construed as including references to their salts.

[0110] This disclosure relates to compounds as described herein and their pharmaceutically acceptable salts, hydrates, solvates, prodrugs, stereoisomers or tautomers, as well as pharmaceutical compositions comprising one or more compounds as described herein or their pharmaceutically acceptable salts, hydrates, solvates, prodrugs, stereoisomers or tautomers. Methods for synthesizing compounds

[0111] The compounds of this disclosure can be prepared by a variety of methods well known to those skilled in the art of organic synthesis. For example, the compounds of this disclosure can be synthesized using the methods described below, as well as synthetic methods known in the field of synthetic organic chemistry, or variations thereof as understood by those skilled in the art. Standard synthetic methods and procedures for the preparation of organic molecules and the transformation and manipulation of functional groups are available from relevant scientific literature in the art or from standard textbooks. Although not limited to any one or more sources, classic texts such as the following are known and recognized as useful and recognized reference textbooks for organic synthesis by those skilled in the art: Smith, MB, March, J., March's Advanced Organic Chemistry: Reactions, Mechanisms, and Structure, 5th ed., John Wiley & Sons: New York, 2001; Greene, TW, Wuts, PGM, Protective Groups in Organic Synthesis, 3rd ed., John Wiley & Sons: New York, 1999; R. Larock, Comprehensive Organic Transformations, VCH Publishers (1989); L. Fieser and M. Fieser, Fieser and Fieser's Reagents for Organic Synthesis, John Wiley and Sons (1994); and L. Paquette (ed.), Encyclopedia of Reagents for Organic Synthesis, John Wiley and Sons (1995), which are incorporated herein by reference.

[0112] During the reaction sequence and synthetic scheme described herein, the order of certain steps can be altered, such as the introduction and removal of protecting groups. Those skilled in the art will recognize that certain groups may require protection from the effects of reaction conditions by using protecting groups. Protecting groups can also be used to distinguish similar functional groups within a molecule. A list of protecting groups and how to introduce and remove them can be found in Greene, TW, Wuts, PGM, Protective Groups in Organic Synthesis, 3rd Edition. John Wiley & Sons. New York, 1999.

[0113] It should be understood that the synthetic methods of this disclosure are tolerant of a wide variety of functional groups, and therefore a wide range of substituted starting materials can be used. The methods typically provide the desired final compound at or near the end of the process, but in some cases it may be desirable to further convert the compound into its pharmaceutically acceptable salt.

[0114] In the synthetic schemes described herein, compounds may be drawn using a specific configuration for simplicity. Such a specific configuration should not be construed as limiting this disclosure to one or more isomers, tautomers, regioisomers, or stereoisomers, nor preclude mixtures of isomers, tautomers, regioisomers, or stereoisomers. However, it should be understood that a given isomer, tautomer, regioisomer, or stereoisomer may have a higher level of activity than another isomer, tautomer, regioisomer, or stereoisomer.

[0115] The methods include, but are not limited to, those described below. The compounds of this disclosure can be synthesized according to the steps outlined in General Schemes 1-3, which include assembling intermediates and compounds in different sequences. Starting materials are commercially available or prepared using known procedures reported in the literature or as shown in the figures. General Solution 1.

[0116] Suitable general routes for preparing the compounds of this application can be described in general schemes 1-3 herein. As shown in general scheme 1, a suitably protected amino carbide ring G1 containing an alcohol functional group can be activated to form the corresponding methanesulfonate ester G2, which can then undergo a displacement reaction with a bromophenol core G3 in the presence of a base such as Cs₂CO₃ and under heating (80ºC-120ºC) to form the key bromine intermediate G4. Various Rs in general formula I... 1 The incorporation of the group into intermediate G4 can be achieved through the Buchwald-Hartwig coupling reaction (e.g., in the presence of ligands such as BINAP and bases such as Cs2CO3 containing NH4+). 1 Coupling with Pd2(dba)3) or Suzuki-Miyaura CC (e.g., in the presence of a base such as Na2CO3, R) 1 -Borate esters and Pd(dppf)2Cl2) are used to achieve this. G5 is deprotected, and then the resulting amine G6 is coupled with a suitable heteroaryl halide within the scope of this invention using a catalytic system such as RockphosPrecat G3. CN coupling yields general formula I.

[0117] As shown in General Scheme 2, heteroaryl esters having general formula I can be synthesized using a set of similar transformations described in General Scheme 1. General Solution 2

[0118] Alternatively, the reaction sequence in general schemes 1 and 2 can be switched based on the needs of SAR exploration. As shown in general scheme 1, deprotecting intermediate G4 and then using a catalytic system such as Rockphos PrecatG3 to perform Buchwald-Hartwig coupling with a suitable heteroaryl halide within the scope of this invention yields G7. 1 The group can be coupled using the Buchwald-Hartwig coupling reaction (e.g., R containing NH in the presence of a base such as NaOtBu). 1 Coupling with Ruphos Precat G3 or Suzuki-Miyaura CC (e.g., in the presence of a base such as Na2CO3, R) 1 -Borate esters with Pd(dppf)2Cl2) are used to achieve this. Alternatively, instead of using the bromophenol bicyclic core G3, the bromofluorobicyclic core G15 can be used to react with corresponding alcohol-containing spouses such as G14 and G17, as shown in General Scheme 3. General Solution 3. Compositions containing compounds disclosed herein

[0119] Another aspect of this disclosure relates to compositions comprising (a) a DNA protein kinase inhibitor (DNA-PKI) and (b) a DNA cleaving agent, wherein the DNA-PKI is a compound of formula (I) or a pharmaceutically acceptable salt, hydrate, solvate, prodrug, stereoisomer, or tautomer thereof. In some embodiments, the composition further comprises cells. In some embodiments, the composition further comprises donor DNA. In some embodiments, the composition further comprises cells and donor DNA.

[0120] In some embodiments, the cells are eukaryotic cells. In some embodiments, the cells are used for adoptive cell therapy (ACT). In some embodiments, the cells are stem cells. In some embodiments, the cells are hematopoietic stem cells (HSCs) or induced pluripotent stem cells (iPSCs). In some embodiments, the cells are immune cells. In some embodiments, the immune cells are leukocytes or lymphocytes (e.g., T cells, B cells, or NK cells). In some embodiments, the immune cells are lymphocytes. In some embodiments, the lymphocytes are T cells. In some embodiments, the lymphocytes are primary T cells. In some embodiments, the lymphocytes are regulatory T cells. In some embodiments, the lymphocytes are activated T cells. In some embodiments, the lymphocytes are inactivated T cells. In some embodiments, the cells are human cells. In some embodiments, the cells are not cancer cells.

[0121] In some implementations, the donor DNA contains a template that includes a sequence encoding a protein, a regulatory sequence, or a sequence encoding structural RNA.

[0122] In some implementations, the DNA cleavage agent is selected from zinc finger nucleases, TALE effector domain nucleases (TALEN), CRISPR / Cas nuclease components, and combinations thereof.

[0123] In some embodiments, the DNA cutting agent comprises a CRISPR / Cas nuclease component and an optional guide RNA component. In some embodiments, the CRISPR / Cas nuclease component comprises a Cas nuclease or mRNA encoding a Cas nuclease. In some embodiments, the CRISPR / Cas nuclease component comprises or encodes a CRISPR / Cas nuclease that produces double-strand or single-strand DNA breaks. In some embodiments, the CRISPR / Cas nuclease component comprises or encodes a CRISPR / Cas nuclease that produces single-strand DNA breaks.

[0124] In some embodiments, the DNA cleavage agent is a CRISPR / Cas nuclease component and a guide RNA component. In some embodiments, the CRISPR / Cas nuclease component contains a Cas nuclease or mRNA encoding a Cas nuclease. In some embodiments, the Cas nuclease is a type II Cas nuclease. In some embodiments, the Cas nuclease is a Cas9 nuclease (e.g., *Streptococcus pyogenes* Cas9 nuclease). In some embodiments, the Cas nuclease is a type V Cas nuclease. In some embodiments, the Cas nuclease is a Cas12a nuclease (e.g., *Acidaminococcus sp.* Cas12a nuclease).

[0125] In some embodiments, the composition comprises modified RNA.

[0126] In some embodiments, the guide RNA component is a guide RNA nucleic acid. In some embodiments, the guide RNA component is guide RNA (gRNA). In some embodiments, the guide RNA nucleic acid is or encodes a dual guide RNA (dgRNA). In some embodiments, the dual guide RNA consists of crRNA and tracrRNA. In some embodiments, the guide RNA nucleic acid is or encodes a single guide RNA (sgRNA). In some embodiments, the gRNA is a modified gRNA.

[0127] In some embodiments, the DNA cleavage agent is Cas9 or mRNA encoding Cas9, and a modified gRNA comprising one or more nucleotides of the first five nucleotides at the 5' end. In some embodiments, the cleavage agent is Cas12a or mRNA encoding Cas12a, and a modified gRNA comprising a DNA / RNA hybrid molecule. In some embodiments, the modified gRNA comprises a modification at one or more nucleotides of the last five nucleotides at the 3' end.

[0128] In some implementations, the DNA cleavage agent is a type II or type V Cas nuclease and a guide RNA nucleic acid; and the molar ratio of guide RNA to Cas nuclease is approximately 4:1 to 1:4.

[0129] In some embodiments, the composition further comprises a vector. In some embodiments, the vector encodes donor DNA. In some embodiments, the vector is a viral vector (e.g., AAV). In some embodiments, the vector is a non-viral vector. In some embodiments, the vector is a non-viral vector containing donor DNA having linear, closed ends, circular, single-stranded, or double-stranded forms.

[0130] In some embodiments, the composition further comprises an inhibitor of the microhomology-mediated end joining (MMEJ) pathway. In some embodiments, the MMEJ pathway inhibitor is a DNA polymerase θ (Polθ or POLQ) inhibitor. In some embodiments, the MMEJ pathway inhibitor is a FEN1 inhibitor. In some embodiments, the MMEJ pathway inhibitor is selected from PolQ inhibitors, said PolQ inhibitors being compounds described in J. Med. Chem 2023, 66, 6498 and its references, such as ART558 (Artios Pharma Limited), ART812 (Artios Pharma Limited), neomycin (Dana-Farber Cancer Institute, Inc.), compound 23 (Ideaya Biosciences, Inc.), and RP-6685 (Repare Therapeutics), or combinations thereof.

[0131] In some embodiments, the concentration of DNA-PKI in the composition is about 10 μM or less. In some embodiments, the concentration of DNA-PKI in the composition is about 0.1 μM to about 10 μM. In some embodiments, the concentration of DNA-PKI in the composition is about 0.25 μM to about 5 μM. In some embodiments, the concentration of DNA-PKI in the composition is about 0.25 μM to about 10 μM. In some embodiments, the concentration of DNA-PKI in the composition is about 0.1 μM to about 5 μM. In some embodiments, the concentration of DNA-PKI in the composition is about 0.1 μM to about 0.25 μM. Method using the disclosed compounds

[0132] Another aspect of this disclosure relates to a method for targeted genome editing in cells, the method comprising contacting the cells with a DNA cutting agent and a DNA-PKI, wherein the DNA-PKI is a compound of formula (I) or a pharmaceutically acceptable salt, hydrate, solvate, prodrug, stereoisomer, or tautomer thereof.

[0133] Another aspect of this disclosure relates to a method for repairing double-stranded DNA breaks in a cellular genome, the method comprising contacting the cells with a DNA cleaving agent and a DNA-PKI, wherein the DNA-PKI is a compound of formula (I) or a pharmaceutically acceptable salt, hydrate, solvate, prodrug, stereoisomer, or tautomer thereof. In some embodiments, the double-stranded DNA break is a blunt-end break. In some embodiments, the double-stranded DNA break comprises paired single-strand breaks (e.g., generated by a combination of cleavage enzymes or nucleases).

[0134] Another aspect of this disclosure relates to a method for inhibiting or repressing DNA break repair in cells via the non-homologous end joining (NHEJ) pathway, the method comprising contacting the cells with a DNA cutting agent and a DNA-PKI, wherein the DNA-PKI is a compound of formula (I) or a pharmaceutically acceptable salt, hydrate, solvate, prodrug, stereoisomer, or tautomer thereof. In some embodiments, the method further comprises contacting the cells with an inhibitor of the microhomologous end joining (MMEJ) pathway. In some embodiments, the inhibitor of the MMEJ pathway is a DNA polymerase θ (Polθ or POLQ) inhibitor. In some embodiments, the inhibitor of the MMEJ pathway is a FEN1 inhibitor. In some embodiments, the inhibitor of the MMEJ pathway is selected from PolQ inhibitors, which are compounds described in J. Med. Chem 2023, 66, 6498 and its references, such as ART558 (Artios Pharma Limited), ART812 (Artios Pharma Limited), neomycin (Dana-Farber Cancer Institute, Inc.), compound 23 (Ideaya Biosciences, Inc.), and RP-6685 (Repare Therapeutics), or combinations thereof.

[0135] Another aspect of this disclosure relates to a method for targeted insertion of donor DNA into the genome of a cell, the method comprising contacting the cell with a DNA cutting agent, the donor DNA, and a DNA-PKI, wherein the DNA-PKI is a compound of formula (I) or a pharmaceutically acceptable salt, hydrate, solvate, prodrug, stereoisomer, or tautomer thereof.

[0136] In some embodiments of the methods disclosed herein, the methods include growing cells in a cell culture medium that does not contain DNA-PKI and adding DNA-PKI to the cell culture medium.

[0137] In some embodiments of the methods disclosed herein, the method includes contacting cells with a DNA cutting agent prior to contacting cells with a DNA-PKI. In some embodiments, the method includes contacting cells with a DNA-PKI within approximately six hours of contacting the cells with the DNA cutting agent. In some embodiments, the method includes contacting cells with a DNA-PKI within approximately three hours of contacting the cells with the DNA cutting agent. In some embodiments, the method includes contacting cells with a DNA-PKI within approximately two hours of contacting the cells with the DNA cutting agent. In some embodiments, the method includes contacting cells with a DNA-PKI between approximately 15 minutes and approximately 45 minutes of contacting the cells with the DNA cutting agent. In some embodiments, the method includes contacting cells with a DNA-PKI within approximately 30 minutes of contacting the cells with the DNA cutting agent.

[0138] In some implementations, the method includes contacting cells with a DNA-PKI simultaneously with a DNA cutting agent.

[0139] In some embodiments of the methods disclosed herein, the methods include growing cells in a cell culture medium containing DNA-PKI.

[0140] In some embodiments, the method includes contacting the cells with a DNA cutting agent after contacting the cells with DNA-PKI. In some embodiments, the method includes contacting the cells with a DNA cutting agent within approximately three hours of contacting the cells with DNA-PKI.

[0141] In some embodiments, contacting cells with the DNA cutting agent includes electroporating the cells to allow the DNA cutting agent to enter the cells. In some embodiments, contacting cells with the DNA cutting agent includes delivering the DNA cutting agent to the cells using other methods, such as microinjection or via lipid nanoparticles, liposomes, exogenous bodies, or gold nanoparticles. In some embodiments, the method includes simultaneously contacting the cells with the DNA cutting agent and donor DNA.

[0142] In some embodiments of the methods disclosed herein, the methods include contacting cells with a DNA cutting agent and a DNA-PKI for at least about one day. In some embodiments, the methods include contacting cells with a DNA cutting agent and a DNA-PKI for about one day. In some embodiments, the methods include contacting cells with a DNA cutting agent and a DNA-PKI for about one day to about two weeks. In some embodiments, the methods include contacting cells with a DNA cutting agent and a DNA-PKI for about two weeks.

[0143] In some embodiments of the methods disclosed herein, the method includes contacting cells with DNA-PKI in a cell culture medium, wherein the concentration of DNA-PKI in the cell culture medium is about 10 μM or less. In some embodiments, the method includes contacting cells with DNA-PKI in a cell culture medium, wherein the concentration of DNA-PKI in the cell culture medium is between about 0.1 μM and about 10 μM. In some embodiments, the method includes contacting cells with DNA-PKI in a cell culture medium, wherein the concentration of DNA-PKI in the cell culture medium is between about 0.25 μM and about 5 μM.

[0144] In some embodiments of the methods disclosed herein, the cells are eukaryotic cells. In some embodiments, the cells are used in adoptive cell therapy (ACT). In some embodiments, the cells are used in autologous cell therapy. In some embodiments, the cells are used in allogeneic cell therapy. In some embodiments, the cells are stem cells. In some embodiments, the cells are hematopoietic stem cells (HSCs) or induced pluripotent stem cells (iPSCs). In some embodiments, the cells are immune cells. In some embodiments, the immune cells are leukocytes or lymphocytes (e.g., T cells, B cells, or NK cells). In some embodiments, the immune cells are lymphocytes. In some embodiments, the lymphocytes are T cells. In some embodiments, the lymphocytes are primary T cells. In some embodiments, the lymphocytes are regulatory T cells. In some embodiments, the lymphocytes are activated T cells. In some embodiments, the lymphocytes are inactivated T cells. In some embodiments, the cells are human cells. In some embodiments, the cells are not cancer cells.

[0145] In some embodiments of the methods disclosed herein, the DNA cutting agent is selected from zinc finger nucleases, TALE effector domain nucleases (TALENs), CRISPR / Cas nuclease components, and combinations thereof.

[0146] In some embodiments of the methods disclosed herein, the DNA cutting agent comprises a CRISPR / Cas nuclease component and an optional guide RNA component. In some embodiments, the CRISPR / Cas nuclease component comprises a Cas nuclease or mRNA encoding a Cas nuclease. In some embodiments, the CRISPR / Cas nuclease component comprises or encodes a CRISPR / Cas nuclease that produces double-strand DNA breaks or single-strand DNA breaks. In some embodiments, the CRISPR / Cas nuclease component comprises or encodes a CRISPR / Cas nuclease that produces single-strand DNA breaks.

[0147] In some embodiments of the methods disclosed herein, the DNA cutting agent is a CRISPR / Cas nuclease component and a guide RNA component. In some embodiments, the CRISPR / Cas nuclease component contains a Cas nuclease or mRNA encoding a Cas nuclease. In some embodiments, the Cas nuclease is a type II Cas nuclease. In some embodiments, the Cas nuclease is a Cas9 nuclease (e.g., *Streptococcus pyogenes* Cas9 nuclease). In some embodiments, the Cas nuclease is a type V Cas nuclease. In some embodiments, the Cas nuclease is a Cas12a nuclease (e.g., *Aminococcus* Cas12a nuclease).

[0148] In some embodiments of the methods disclosed herein, the methods further include contacting the cells with modified RNA.

[0149] In some embodiments of the methods disclosed herein, the methods further include contacting the cell with a guide RNA component. In some embodiments, the guide RNA component is a guide RNA nucleic acid. In some embodiments, the guide RNA component is guide RNA (gRNA). In some embodiments, the guide RNA nucleic acid is or encodes dual guide RNA (dgRNA). In some embodiments, the guide RNA nucleic acid is or encodes single guide RNA (sgRNA). In some embodiments, the gRNA is a modified gRNA.

[0150] In some embodiments of the methods disclosed herein, the DNA cleavage agent is Cas9 or mRNA encoding Cas9, and a modified gRNA comprising a modification at one or more nucleotides in the first five nucleotides of the 5' end. In some embodiments, the cleavage agent is Cas12a or mRNA encoding Cas12a, and a modified gRNA comprising a DNA / RNA hybrid molecule. In some embodiments, the modified gRNA comprises a modification at one or more nucleotides in the last five nucleotides of the 3' end.

[0151] In some embodiments of the methods disclosed herein, the DNA cutting agent is a Class 2 or Class 5 Cas nuclease and a guide RNA nucleic acid; and the molar ratio of guide RNA to Cas nuclease is approximately 4:1 to 1:4.

[0152] In some embodiments of the methods disclosed herein, the DNA cleavage agent interacts with a target sequence within the TRAC gene of T cells.

[0153] In some embodiments of the methods disclosed herein, the methods include contacting cells with at least two different DNA cutting agents that target different gene loci.

[0154] In some embodiments, the method includes contacting cells with a vector encoding a DNA cleavage agent. In some embodiments, the vector encodes a DNA cleavage agent and donor DNA. In some embodiments, the method includes contacting cells with a vector encoding a DNA cleavage agent and a second vector encoding donor DNA.

[0155] In some embodiments, the vector is a viral vector (e.g., AAV). In some embodiments, the vector is a non-viral vector. In some embodiments, the vector is a non-viral vector containing donor DNA having linear, closed ends, circular, single-stranded, or double-stranded forms.

[0156] In some embodiments of the methods disclosed herein, a DNA cleaving agent interacts with a target sequence within the cell genome, resulting in double-stranded DNA breaks (DSBs).

[0157] In some embodiments of the methods disclosed herein, the methods further include contacting cells with donor DNA. In some embodiments, the methods include contacting cells with a vector containing donor DNA. In some embodiments, the vector encodes donor DNA. In some embodiments, the donor DNA contains a template that includes a sequence encoding a protein, a regulatory sequence, or a sequence encoding structural RNA. In some embodiments, the donor DNA contains a template that includes a foreign nucleic acid encoding a protein. In some embodiments, the protein is selected from cytokines, immunosuppressants, antibodies, receptors, and enzymes. In some embodiments, the protein is a receptor. In some embodiments, the receptor is selected from immunoreceptors, T-cell receptors (TCRs), and chimeric antigen receptors. In some embodiments, the foreign nucleic acid encodes a TCR chain, such as a TCR α, β, δ, or γ chain, or any combination thereof. In some embodiments, the foreign nucleic acid encodes a TCR α and / or TCR β chain. In some embodiments, the template includes a first homologous arm and a second homologous arm, respectively complementary to sequences located upstream and downstream of the cleavage site.

[0158] In some embodiments of the methods disclosed herein, the methods result in gene knockout. In some embodiments of the methods disclosed herein, the methods result in gene correction. In some embodiments of the methods disclosed herein, the methods result in gene insertion.

[0159] In some embodiments, the method further includes contacting the cells with an inhibitor of the microhomology-mediated end joining (MMEJ) pathway. In some embodiments, the inhibitor of the MMEJ pathway is DNA polymerase θ (Polθ or POLQ). In some embodiments, the inhibitor of the MMEJ pathway is a FEN1 inhibitor. In some embodiments, the inhibitor of the MMEJ pathway is selected from PolQ inhibitors, said PolQ inhibitors being compounds described in J. Med. Chem 2023, 66,6498 and its references, such as ART558 (Artios Pharma Limited), ART812 (Artios Pharma Limited), neomycin (Dana-Farber Cancer Institute, Inc.), compound 23 (Ideaya Biosciences, Inc.), and RP-6685 (Repare Therapeutics), or combinations thereof.

[0160] Another aspect of this disclosure relates to compounds of formula (I) and pharmaceutically acceptable salts, hydrates, solvates, prodrugs, stereoisomers, tautomers, or pharmaceutical compositions thereof for use in the manufacture of medicaments for cell therapy.

[0161] Another aspect of this disclosure relates to the use of compounds of formula (I) or pharmaceutically acceptable salts, hydrates, solvates, prodrugs, stereoisomers, tautomers or pharmaceutical compositions thereof in the treatment of cells.

[0162] In one implementation, the subjects are mammals.

[0163] In one implementation, the mammal is a human.

[0164] The disclosed compounds can also be administered via any mode of therapeutic application. These modes include systemic or local administration, such as oral, nasal, parenteral, transdermal, subcutaneous, vaginal, buccal, rectal, or topical administration.

[0165] Depending on the intended mode of administration, the disclosed compositions may be in solid, semi-solid, or liquid dosage forms, such as injections, tablets, suppositories, pills, time-release capsules, elixirs, tinctures, emulsions, syrups, powders, liquids, suspensions, etc., sometimes in unit doses and in accordance with standard pharmaceutical practice. Similarly, they may be administered intravenously (both bolus and infusion), intraperitoneally, subcutaneously, or intramuscularly, all in forms well known to those skilled in the art of pharmaceutical work.

[0166] The illustrative pharmaceutical compositions are tablets and gelatin capsules comprising the compounds of this disclosure and pharmaceutically acceptable carriers such as a) diluents, such as purified water, triglyceride oils (such as hydrogenated or partially hydrogenated vegetable oils or mixtures thereof), corn oil, olive oil, sunflower oil, safflower oil, fish oil (such as EPA or DHA) or esters or triglycerides thereof or mixtures thereof, omega-3 fatty acids or derivatives thereof, lactose, dextran, sucrose, mannitol, sorbitol, cellulose, sodium, saccharin, glucose and / or glycine; b) lubricants, such as silica, talc, stearic acid, its magnesium or calcium salts, sodium oleate, sodium stearate, magnesium stearate, sodium benzoate, sodium acetate, sodium chloride and / or polyethylene glycol; also used in tablets; c) Binders, such as magnesium aluminum silicate, starch paste, gelatin, astragalus gum, methylcellulose, sodium carboxymethyl cellulose, magnesium carbonate, natural sugars (such as glucose or β-lactose), corn sweeteners, natural and synthetic gums (such as gum arabic, astragalus gum, or sodium alginate), waxes, and / or polyvinylpyrrolidone (if desired); d) disintegrants, such as starch, agar, methylcellulose, bentonite, xanthan gum, alginate or its sodium salt, or effervescent mixtures; e) absorbents, colorants, flavorings, and sweeteners; f) emulsifiers or dispersants, such as Tween 80, Labrasol, HPMC, DOSS, Caproyl 909, Labrafac, Labrafil, Peceol, Transcutol, Capmul MCM, Capmul PG-12, Captex 355, Gelucire, Vitamin E TGPS, or other acceptable emulsifiers; and / or g) Reagents that promote compound absorption, such as cyclodextrin, hydroxypropyl-cyclodextrin, PEG400, and PEG200.

[0167] Liquid (especially injectable) compositions can be prepared, for example, by dissolution, dispersion, etc. For instance, the disclosed compound can be dissolved in or mixed with a pharmaceutically acceptable solvent (such as water, saline, aqueous dextran, glycerol, ethanol, etc.) to form an injectable isotonic solution or suspension. Proteins such as albumin, chylomicrons, or serum proteins can be used to dissolve the disclosed compound.

[0168] The disclosed compounds can also be formulated into suppositories, which can be prepared from fat emulsions or suspensions; using polyalkylene glycols such as propylene glycol as carriers.

[0169] The disclosed compounds can also be administered in the form of liposome delivery systems, such as small unilamellar vesicles, large unilamellar vesicles, and multilayer vesicles. Liposomes can be formed from various phospholipids and contain cholesterol, stearamine, or phosphatidylcholine. In some embodiments, the membrane of the lipid component is hydrated with an aqueous solution of the drug to form a lipid layer encapsulating the drug, as described in U.S. Patent No. 5,262,564, which is incorporated herein by reference in its entirety.

[0170] The disclosed compound can also be delivered by using a monoclonal antibody as a separate carrier conjugated to the disclosed compound. The disclosed compound can also be conjugated to a soluble polymer as a targeted drug carrier. Such polymers may include polyvinylpyrrolidone, pyran copolymers, polyhydroxypropyl methacrylamide-phenol, polyhydroxyethyl asparagine-phenol, or poly(ethylene oxide) polylysine substituted with palmitoyl residues. Furthermore, the disclosed compound can be conjugated to a class of biodegradable polymers that can be used to achieve controlled drug release, such as polylactic acid, poly(ε-caprolactone), polyhydroxybutyric acid, polyorthoesters, polyacetals, polydihydropyran, polycyanoacrylates, and crosslinked or amphiphilic hydrogel block copolymers. In one embodiment, the disclosed compound is not covalently bound to a polymer (e.g., a polycarboxylic acid polymer or a polyacrylate).

[0171] Parenteral injectable preparations are typically administered subcutaneously, intramuscularly, or intravenously. Injectable formulations can be prepared in conventional forms, as liquid solutions or suspensions, or as solids suitable for dissolving in a liquid prior to injection.

[0172] Another aspect of this disclosure relates to pharmaceutical compositions comprising a compound of formula (I) and a pharmaceutically acceptable carrier. The pharmaceutically acceptable carrier may also comprise excipients, diluents, or surfactants. In some embodiments, the pharmaceutical composition may also comprise additional pharmaceutically active agents.

[0173] In one implementation, the pharmaceutically acceptable carrier further comprises excipients, diluents, surfactants, or any combination thereof.

[0174] In one embodiment, the pharmaceutical composition further comprises at least one additional therapeutic agent.

[0175] Another aspect of this disclosure relates to pharmaceutical compositions for use in cell therapy, said pharmaceutical composition comprising a compound of formula (I) or a pharmaceutically acceptable salt thereof.

[0176] The compositions can be prepared according to conventional mixing, granulation or coating methods, and the pharmaceutical compositions of the present invention can contain about 0.1% to about 99%, about 5% to about 90%, or about 1% to about 20% of the disclosed compounds by weight or volume.

[0177] In one embodiment, the composition comprises about 1 mg to about 2000 mg of the compound.

[0178] In one embodiment, the composition is administered to the subject twice daily, once daily, every other day, or once weekly. Example

[0179] This disclosure is further illustrated by the following embodiments and synthetic schemes, which should not be construed as limiting this disclosure to the scope or spirit of the specific procedures described herein. It should be understood that the embodiments are provided to illustrate certain implementations and are therefore not intended to limit the scope of this disclosure. It should be further understood that various other embodiments, modifications, and equivalents that may be proposed by those skilled in the art may be necessary without departing from the spirit of this disclosure and / or the scope of the appended claims.

[0180] The compounds described in this disclosure can be prepared using known chemical reactions and procedures. However, the following general preparation methods are presented to assist the reader in synthesizing the compounds, with specific details provided below in the experimental section to illustrate working examples.

[0181] Unless otherwise defined below, all groups of variables for these methods are as described in the general description.

[0182] It should be understood that the compounds of this disclosure having each claimed optional functional group can be prepared without using each of the methods listed below. Within the scope of each method, optional substituents may appear on the reagent or intermediate, which may act as protecting groups or other non-participating groups. These groups are introduced and / or removed during the synthesis of the compounds provided in this disclosure using methods well known to those skilled in the art.

[0183] The abbreviations used in the following embodiments and elsewhere herein are: Analysis program NMR

[0184] The following conditions were used to obtain proton nuclear magnetic resonance (NMR) spectra: NMR spectra were acquired at 400 MHz or 500 MHz. Bruker instruments used DMSO-d6 or CDCl3 as solvent and internal standard. Raw NMR data were analyzed using ADC Labs' ACD Spectrus 2015-01 version or MestReNova software.

[0185] Chemical shifts are reported in low-field parts per million (ppm) relative to the internal tetramethylsilane (TMS) or relative to the TMS position inferred from the deuterated NMR solvent. Obvious multiplicity is reported as: singlet -s, doublet -d, triplet -t, quartt -q, or multiplicity -m. Peaks exhibiting broadening are also indicated as br. Integrals are approximate. It should be noted that the integrated intensity, peak shape, chemical shift, and coupling constant can depend on the solvent, concentration, temperature, pH, and other factors. Furthermore, peaks overlapping or exchanging with water or solvent peaks in the NMR spectrum cannot provide reliable integrated intensities. In some cases, water peak suppression can be used to obtain NMR spectra, which may result in overlapping peaks being invisible or having altered shapes and / or integrals. Liquid chromatography

[0186] The following preparative and / or analytical (LC / MS) liquid chromatography methods were used.

[0187] Method A: Column: XBridge C18, 2.1 mm x 50 mm, 1.7 μm particles; Mobile phase A: ACN / H2O (5:95) (containing 10 mM AA); Mobile phase B: ACN / H2O (95:5) (containing 10 mM AA); Temperature: 50ºC; Gradient: 0-100% B (0.0-3.0 min), 100% B (3.0-3.5 min); Flow rate: 1.0 mL / min; Detection: UV (220 nm) and MS (ESI+).

[0188] Method B: Column: XBridge C18, 2.1 mm x 50 mm, 1.7 μm particles; Mobile phase A: ACN / H2O (5:95) (containing 0.05% TFA); Mobile phase B: ACN / H2O (95:5) (containing 0.05% TFA); Temperature: 50ºC; Gradient: 0-100% B (0.0-3.0 min), 100% B (3.0-3.5 min); Flow rate: 1.0 mL / min; Detection: UV (220 nm) and MS (ESI+).

[0189] UHPLC Method D: Column: Waters Acquity BEH C18 2.1 x 50 mm 1.7 μm particles; Mobile phase A: 95:5 acetonitrile:water (containing 0.05% TFA); Mobile phase B: 95:5 acetonitrile:water (containing 0.05% TFA); Temperature: 50ºC; Gradient: 3.00 min 0% B to 100% B, then held at 100% B for 0.50 min; Flow rate: 1.0 mL / min; Detection: MS and UV (254 nm).

[0190] UHPLC Method E: Column: Waters Acquity BEH C18 2.1 x 50 mm 1.7 μm particles; Mobile phase A: 95:5 acetonitrile:water (containing 0.05% TFA); Mobile phase B: 95:5 acetonitrile:water (containing 0.05% TFA); Temperature: 50ºC; Gradient: 1.5 min from 0% B to 100% B, then held at 100% B for 0.50 min; Flow rate: 1.0 mL / min; Detection: MS and UV (254 nm).

[0191] Method Column 6: Column: Waters Acquity BEH C18 2.1 x 50 mm 1.7 μm particles; Mobile Phase A: 95:5 acetonitrile:water (containing 0.05% TFA); Mobile Phase B: 95:5 acetonitrile:water (containing 0.05% TFA); Temperature: 50ºC; Gradient: 1.00 min from 0% B to 100% B, then held at 100% B for 0.50 min; Flow Rate: 1.0 mL / min; Detection: MS and UV (254 nm). Analytical LC / MS methods

[0192] Method 1: Column: HALC 90A C18, 3.0 x 30 mm, 2.0 μm particles; Mobile phase A: water (containing 0.1% formic acid); Mobile phase B: acetonitrile (containing 0.1% formic acid); Temperature: 40ºC; Gradient: from 5% B to 95% B in 1.0 min, then held at 95% B for 0.40 min; Flow rate: 1.5 mL / min; Detection: MS and UV (254 / 220 nm).

[0193] Method 2: Column: Shim-pack Scepter C18-120, 3.0 mm x 33 mm, 3.0 μm particles; Mobile phase A: water containing 5 mM ammonium bicarbonate; Mobile phase B: acetonitrile; Temperature: 40ºC; Gradient: from 10% B to 95% B in 1.0 min, then held at 95% B for 0.40 min; Flow rate: 1.5 mL / min; Detection: MS and UV (254 / 220 nm).

[0194] Method 3: Column: Shim-pack Scepter C18-120, 3.0 mm x 33 mm, 3.0 μm particles; Mobile phase A: water containing 5 mM ammonium bicarbonate; Mobile phase B: acetonitrile; Temperature: 40ºC; Gradient: 1.7 min to 60% B, 0.6 min to 95% B, then held at 95% B for 0.50 min; Flow rate: 1.5 mL / min; Detection: MS and UV (254 / 220 nm).

[0195] Method 4: Column: Shim-pack Scepter C18-120, 3.0 mm x 33 mm, 3.0 μm particles; Mobile phase A: water containing 5 mM ammonium bicarbonate; Mobile phase B: acetonitrile; Temperature: 40ºC; Gradient: 30% B to 70% B over 1.7 min, 70% B to 95% B over 0.6 min, then held at 95% B for 0.50 min; Flow rate: 1.5 mL / min; Detection: MS and UV (254 / 220 nm).

[0196] Method 5: Column: HALC 90A C18, 3.0 x 30 mm, 2.0 μm particles; Mobile phase A: water (containing 0.1% formic acid); Mobile phase B: acetonitrile (containing 0.1% formic acid); Temperature: 40ºC; Gradient: 1.7 min 20% B to 60% B, 0.6 min 60% B to 100% B, then hold at 100% B for 0.50 min; Flow rate: 1.5 mL / min; Detection: MS and UV (254 / 220 nm).

[0197] Method 6: Column: HALC 90A C18, 3.0 x 30 mm, 2.0 μm particles; Mobile phase A: water (containing 0.1% formic acid); Mobile phase B: acetonitrile (containing 0.1% formic acid); Temperature: 40ºC; Gradient: from 5% B to 100% B in 1.2 min, then held at 100% B for 0.60 min; Flow rate: 1.5 mL / min; Detection: MS and UV (254 / 220 nm).

[0198] Method 7: Column: HALC 90A C18, 3.0 x 33 mm, 2.0 μm particles; Mobile phase A: water (containing 0.05% TFA); Mobile phase B: acetonitrile (containing 0.05% TFA); Temperature: 40ºC; Gradient: from 5% B to 100% B in 1.1 min, then held at 100% B for 0.30 min; Flow rate: 1.5 mL / min; Detection: MS and UV (254 / 220 nm).

[0199] Method 8: Column: HALC 90A C18, 3.0 x 30 mm, 2.0 μm particles; Mobile phase A: water (containing 0.05% TFA); Mobile phase B: acetonitrile (containing 0.05% TFA); Temperature: 40ºC; Gradient: from 5% B to 100% B in 1.2 min, then held at 100% B for 0.60 min; Flow rate: 1.5 mL / min; Detection: MS and UV (254 / 220 nm). Example 1. 6-(morpholin-4-yl)-4-{[(1s,4s)-4-[(4-methylpyrimidin-2-yl)amino]cyclohexyl]oxy}pyrazolo[1,5-a]pyridine-3-carboxynitrile (Compound 1) Step 1. Synthesis of tert-butyl cis-4-((6-bromo-3-cyanopyrazolo[1,5-a]pyridin-4-yl)oxy)cyclohexyl)carbamate.

[0200] Trans-4-((tert-butoxycarbonyl)amino)cyclohexyl methanesulfonate (1048 mg, 3.57 mmol) and 6-bromo-4-hydroxypyrazolo[1,5-a]pyridine-3-carboxynitrile (850 mg, 3.57 mmol) were stirred in dioxane (15 mL) at room temperature. Cs₂CO₃ (2443 mg, 7.50 mmol) was added. The reaction mixture was capped and heated at 105ºC for 20 h. The reaction was examined by LCMS, and only 50% conversion was observed. Another portion of trans-4-((tert-butoxycarbonyl)amino)cyclohexyl methanesulfonate (1048 mg, 3.57 mmol) was added, and the mixture was stirred again at 105ºC for 24 h. After cooling, the reaction mixture was filtered through diatomaceous earth and washed with EtOAc. The filtrate was concentrated and the residue was purified by ISCO (hexane / EtOAc). After vacuum drying, it yielded tert-butyl cis-4-((6-bromo-3-cyanopyrazolo[1,5-a]pyridin-4-yl)oxy)cyclohexyl)carbamate (900 mg, 57.9% yield) as a grayish-white foam. 1 ¹H NMR (400 MHz, chloroform-d) δ 8.33 (d, J=1.2 Hz, 1H), 8.15 (s, 1H), 6.77 (s, 1H), 4.78 - 4.59 (m, 2H), 3.67 - 3.41 (m, 1H), 3.02 (s, 1H), 2.22 - 2.09 (m, 2H), 1.91 - 1.72 (m, 4H), 1.45 (s, 9H), 1.38 - 1.19 (m, 2H). Analytical LCMS ESI m / z 336.7 [M-COOtBu] + RT = 2.14 min (UHPLC method D). Step 2. Synthesis of tert-butyl cis-4-((3-cyano-6-morpholinopyrazolo[1,5-a]pyridin-4-yl)oxy)cyclohexyl)carbamate.

[0201] A mixture of (cis-4-((6-bromo-3-cyanopyrazolo[1,5-a]pyridin-4-yl)oxy)cyclohexyl)tert-butyl carbamate (130 mg, 0.299 mmol), morpholine (39.0 mg, 0.448 mmol), BINAP (37.2 mg, 0.060 mmol), Pd2(dba)3 (27.3 mg, 0.030 mmol), and Cs2CO3 (243 mg, 0.747 mmol) in toluene (2 mL) was purged with nitrogen for 10 min. The mixture was capped and stirred at 100ºC for 24 h. The reaction mixture was cooled, filtered through diatomaceous earth, and washed with EtOAc. The filtrates were combined and concentrated. The residue was purified by ISCO (hexane / EtOAc) to give tert-butyl (cis-4-((3-cyano-6-morpholinopyrazolo[1,5-a]pyridin-4-yl)oxy)cyclohexyl)carbamate (70 mg, 0.159 mmol, 53.1% yield) as a light brown film. LCMS ESI m / z 464.0 [M+Na] + ; RT = 1.24 min (UHPLC method E). Step 3. Synthesis of 4-((cis-4-aminocyclohexyl)oxy)-6-morpholinopyrazolo[1,5-a]pyridine-3-carboxylonitrile

[0202] (cis-4-((3-cyano-6-morpholinopyrazolo[1,5-a]pyridin-4-yl)oxy)cyclohexyl)tert-butyl carbamate (70 mg, 0.159 mmol) was stirred at room temperature for 30 min in a mixture of DCM (2 mL) and TFA (1 mL). The mixture was concentrated and evaporated with DCM (3x) and dried under vacuum to give 4-((cis-4-aminocyclohexyl)oxy)-6-morpholinopyrazolo[1,5-a]pyridin-3-carboxynitrile as a TFA salt (62 mg, 0.136 mmol, 86% yield), which was used directly in the next step. 1¹H NMR (500 MHz, DMSO-d6) δ 8.43 (s, 1H), 7.93 (s, 1H), 7.85 (br s, 3H), 7.22 (s, 1H), 7.05 - 7.01 (m, 1H), 7.07 - 6.95 (m, 1H), 4.90 (br s, 1H), 3.82 - 3.73 (m, 4H overlaps with H₂O peak), 3.43 - 3.37 (m, 1H), 3.15 - 3.10 (m, 4H), 2.15 - 2.07 (m, 2H), 1.82 - 1.70 (m, 6H). LCMS ESI m / z 342.0 [M+H]⁺; RT = 0.85 min (UHPLC method E). Step 4. Synthesis of 6-(morpholino-4-yl)-4-{[cis-4-[(4-methylpyrimidin-2-yl)amino]cyclohexyl]oxy}pyrazolo[1,5-a]pyridine-3-carboxynitrile.

[0203] 2-Chloro-4-methylpyrimidine (16.94 mg, 0.132 mmol) and 4-((cis-4-aminocyclohexyl)oxy)-6-morpholinopyrazolo[1,5-a]pyridine-3-carboxynitrile (30 mg, 0.088 mmol) were added to 1,4-dioxane (1 mL), and nitrogen was bubbled into the solution for 5 min. Rockphos G3 (8 mg) was added, followed by sodium tert-butoxide (25.3 mg, 0.264 mmol). The reaction mixture was bubbled into nitrogen for another 3 min, then capped and heated at 70ºC for 3 h. LCMS showed a desired substance:starting material ratio of 2:1. The reaction mixture was stirred at room temperature for 72 h. The reaction mixture was concentrated, and the residue was dissolved in MeOH, filtered, and purified. 1¹H NMR (500 MHz, DMSO-d⁶) δ 8.43 (s, 1H), 8.24 - 8.20 (m, 1H), 7.93 (s, 1H), 7.08 (s, 1H), 6.62 (br d, J=4.1 Hz, 1H), 4.96 (br s, 1H), 3.90 (s, 1H), 3.76 (m, 3H overlaps with H₂O), 3.18 - 3.10 (m, 4H), 2.33 (br s, 3H), 2.10 - 2.02 (m, 2H), 1.85 - 1.71 (m, 7H). Analytical LCMS ESI m / z 434.2 [M+H]+; RT = 1.66 min, 99.4% (Method A); 434.1 [M+H]+, RT = 1.34 min, 100% (Method B).

[0204] Following a procedure similar to that of Example 1, but heating at 100ºC for 16-24 h instead of at 70ºC for 3 h in step D, Examples 2-6 were obtained. Example 2 N-methyl-2-{[cis-4-{[3-cyano-6-(morpholin-4-yl)pyrazolo[1,5-a]pyridin-4-yl]oxy}cyclohexyl]amino}pyrimidine-4-carboxamide (compound 2) Example 3 6-(morpholin-4-yl)-4-{[cis-4-[(6-methoxypyridazin-3-yl)amino]cyclohexyl]oxy}pyrazolo[1,5-a]pyridine-3-carboxynitrile (compound 3) Example 4 6-(morpholino-4-yl)-4-{[cis-4-[(5-methoxypyrimidin-2-yl)amino]cyclohexyl]oxy}pyrazolo[1,5-a]pyridine-3-carboxynitrile (compound 4) Example 5 6-(morpholin-4-yl)-4-{[cis-4-[(2-methylpyrimidin-4-yl)amino]cyclohexyl]oxy}pyrazolo[1,5-a]pyridine-3-carboxynitrile (compound 5) Example 6 6-(morpholin-4-yl)-4-{[cis-4-[(6-methylpyridazin-3-yl)amino]cyclohexyl]oxy}pyrazolo[1,5-a]pyridine-3-carboxynitrile (compound 6) Example 7 6-(morpholino-4-yl)-4-{[cis-4-[(pyrimidin-2-yl)amino]cyclohexyl]oxy}pyrazolo[1,5-a]pyridine-3-carboxynitrile (compound 7)

[0205] 4-((cis-4-aminocyclohexyl)oxy)-6-morpholinopyrazolo[1,5-a]pyridine-3-carboxylonitrile (6 mg, 0.018 mmol) and 2-chloropyrimidine (6.04 mg, 0.053 mmol) were stirred in 2-propanol (0.3 mL). DIEA (0.015 mL, 0.088 mmol) was added, and the reaction mixture was stirred at 100ºC–105ºC for 16 h. The reaction mixture was cooled and concentrated. It was dissolved in MeOH, filtered, and purified by RPHPLC to give the title compound (2 mg, 25.7%). Example 8 N-[cis-4-{[3-cyano-6-(3,6-dihydro-2H-pyran-4-yl)pyrazolo[1,5-a]pyridin-4-yl]oxy}cyclohexyl]tert-butyl carbamate (compound 8)

[0206] (cis-4-((6-bromo-3-cyanopyrazolo[1,5-a]pyridin-4-yl)oxy)cyclohexyl)tert-butyl carbamate (300 mg, 0.689 mmol) and 2-(3,6-dihydro-2H-pyran-4-yl)-4,4,5,5-tetramethyl-1,3,2-dioxane (232 mg, 1.103 mmol) were dissolved in 1,4-dioxane (3 mL). Nitrogen gas was bubbled into the solution. Na₂CO₃ (1.034 mL, 2.067 mmol) was added, followed by Pd(dppf)Cl₂ (60 mg). Bubbling with nitrogen gas continued for 3 min. The vial was capped and stirred at 100ºC–105ºC for 2 h. After cooling to room temperature, the reaction mixture was filtered and washed with EtOAc. The filtrate was concentrated and purified by silica gel chromatography (hexane / EtOAc) to give (cis-4-((3-cyano-6-(3,6-dihydro-2H-pyran-4-yl)pyrazolo[1,5-a]pyridin-4-yl)oxy)cyclohexyl)tert-butyl carbamate (280 mg, 0.638 mmol, 93% yield). Example 9 6-(3,6-dihydro-2H-pyran-4-yl)-4-{[cis-4-aminocyclohexyl]oxy}pyrazolo[1,5-a]pyridine-3-carboxynitrile (Compound 9)

[0207] (cis-4-((3-cyano-6-(3,6-dihydro-2H-pyran-4-yl)pyrazolo[1,5-a]pyridin-4-yl)oxy)cyclohexyl)tert-butyl carbamate (200 mg, 0.456 mmol) was stirred at room temperature for 30 min in a mixture of DCM (2 mL) and TFA (1 mL). The mixture was concentrated and evaporated with DCM (3x) and dried under vacuum to give 4-((cis-4-aminocyclohexyl)oxy)-6-(3,6-dihydro-2H-pyran-4-yl)pyrazolo[1,5-a]pyridin-3-carboxynitrile as a TFA salt (150 mg, 97% yield), which was used directly in the next step. Example 10 6-(3,6-dihydro-2H-pyran-4-yl)-4-{[cis-4-[(pyrimidin-2-yl)amino]cyclohexyl]oxy}pyrazolo[1,5-a]pyridine-3-carboxynitrile (Compound 10)

[0208] Example 10 (7.4 mg, 45.0% yield) was prepared following a procedure similar to that of Example 2.

[0209] Following a similar procedure to Example 1, Examples 11-16 were prepared, starting with Example 9. Example 11 6-(3,6-dihydro-2H-pyran-4-yl)-4-{[cis-4-[(2-methylpyrimidin-4-yl)amino]cyclohexyl]oxy}pyrazolo[1,5-a]pyridine-3-carboxynitrile (Compound 11) Example 12 6-(3,6-dihydro-2H-pyran-4-yl)-4-{[cis-4-[(6-methylpyridazin-3-yl)amino]cyclohexyl]oxy}pyrazolo[1,5-a]pyridine-3-carboxynitrile (Compound 12) Example 13 6-(3,6-dihydro-2H-pyran-4-yl)-4-{[cis-4-[(5-methoxypyrimidin-2-yl)amino]cyclohexyl]oxy}pyrazolo[1,5-a]pyridine-3-carboxynitrile (Compound 13) Example 14 6-(3,6-dihydro-2H-pyran-4-yl)-4-{[cis-4-[(6-methoxypyridazin-3-yl)amino]cyclohexyl]oxy}pyrazolo[1,5-a]pyridine-3-carboxynitrile (Compound 14) Example 15 N-Methyl-2-{[cis-4-{[3-cyano-6-(3,6-dihydro-2H-pyran-4-yl)pyrazolo[1,5-a]pyridin-4-yl]oxy}cyclohexyl]amino}pyrimidine-4-carboxamide (Compound 15) Example 16 6-(3,6-dihydro-2H-pyran-4-yl)-4-{[cis-4-[(4-methylpyrimidin-2-yl)amino]cyclohexyl]oxy}pyrazolo[1,5-a]pyridine-3-carboxynitrile (Compound 16) Example 17 6-(pyridin-4-yl)-4-{[cis-4-[(4-methylpyrimidin-2-yl)amino]cyclohexyl]oxy}pyrazolo[1,5-a]pyridin-3-carboxynitrile (Compound 17) Step 1. 6-Bromo-4-((cis-4-((4-methylpyrimidin-2-yl)amino)cyclohexyl)oxy)pyrazolo[1,5-a]pyridine-3-carboxynitrile.

[0210] Following a procedure similar to step 1 of Example 1, the title compound (230 mg, 0.538 mmol, 64.1% yield) was obtained from trans-4-((4-methylpyrimidin-2-yl)amino)cyclohexyl methanesulfonate (240 mg, 0.840 mmol) and 6-bromo-4-hydroxypyrazolo[1,5-a]pyridine-3-carboxynitrile (200 mg, 0.840 mmol) and Cs2CO3 (575 mg, 1.764 mmol) in dioxane (4 mL), which, after vacuum drying, formed a colorless film. ¹H NMR (400 MHz, chloroform-d) δ 8.31 (d, J=0.9 Hz, 1H), 8.14 - 8.07 (m, 2H), 6.74 (s, 1H), 6.34 (d, J=5.0 Hz, 1H), 5.21 (br d, J=8.5 Hz, 1H), 4.74 (br s, 1H), 3.98 (dt, J=8.9, 4.6 Hz, 1H), 2.27 (s, 3H), 2.23 - 2.11 (m, 2H), 2.02 - 1.76 (m, 7H). LCMS ESI m / z 426.8, 428.8 [M+H]+; RT = 1.45 min (UHPLC method D). Step 2.6-(pyridin-4-yl)-4-{[cis-4-[(4-methylpyrimidin-2-yl)amino]cyclohexyl]oxy}pyrazolo[1,5-a]pyridin-3-carboxynitrile.

[0211] The title compound (9 mg, 90% yield) was obtained using a procedure similar to that in Example 8. Example 18 6-{8-oxa-3-azabicyclo[3.2.1]oct-3-yl}-4-{[cis-4-[(4-methylpyrimidin-2-yl)amino]cyclohexyl]oxy}pyrazolo[1,5-a]pyridine-3-carboxynitrile (compound 18)

[0212] Nitrogen gas was bubbled into a solution of 6-bromo-4-((cis-4-((4-methylpyrimidin-2-yl)amino)cyclohexyl)oxy)pyrazolo[1,5-a]pyridine-3-carboxylonitrile (30 mg, 0.070 mmol) and 8-oxa-3-azabicyclo[3.2.1]octane (23.83 mg, 0.211 mmol) in 1,4-dioxane (1 mL) for 5 min. Ruphos (10 mg) was added, followed by Ruphos-G3 (16 mg) and then Cs2CO3 (160 mg, 0.491 mmol). The reaction mixture was bubbled with nitrogen gas for 1 min. It was capped and stirred at 100ºC for 3 h. It was concentrated and dissolved in MeOH, filtered, and purified by RPHPLC to give the title compound (13.3 mg, 40.6% yield).

[0213] Examples 19 and 20 were prepared following a procedure similar to that of Example 18. Example 19 6-(2-methylmorpholin-4-yl)-4-{[cis-4-[(4-methylpyrimidin-2-yl)amino]cyclohexyl]oxy}pyrazolo[1,5-a]pyridine-3-carboxynitrile (Compound 19) Example 20 6-[(2R)-2-methylmorpholin-4-yl]-4-{[cis-4-[(4-methylpyrimidin-2-yl)amino]cyclohexyl]oxy}pyrazolo[1,5-a]pyridine-3-carboxynitrile (Compound 20) Example 21 6-{3-oxadicyclo[4.1.0]hept-6-yl}-4-{[cis-4-[(4-methylpyrimidin-2-yl)amino]cyclohexyl]oxy}pyrazolo[1,5-a]pyridine-3-carboxynitrile (Compound 21)

[0214] 2-(3-oxabicyclo[4.1.0]hept-6-yl)-4,4,5,5-tetramethyl-1,3,2-dioxacyclopentaborane (8.39 mg, 0.037 mmol) and 6-bromo-4-(((1s,4s)-4-((4-methylpyrimidin-2-yl)amino)cyclohexyl)oxy)pyrazolo[1,5-a]pyridine-3-carboxynitrile (16 mg, 0.037 mmol) were dissolved in 1,4-dioxane (1 mL) and H2O (0.1 mL). Nitrogen was bubbled into the solution, and [1,1¿-bis(diphenylphosphino)ferrocene]palladium dichloride (5.48 mg, 7.49 µmol) was added, followed by tripotassium phosphate (39.7 mg, 0.187 mmol). The solution was bubbled with nitrogen for 3 min. The vial was capped and stirred at 80ºC-85ºC for 2 h, then stirred at 100ºC for 30 min. After cooling to room temperature, the reactants were concentrated and dissolved in MeOH, filtered, and purified to give the title compound (1 mg, 6% yield). Example 22 6-{3-oxadicyclo[4.1.0]hept-6-yl}-4-{[cis-4-[(4-methylpyrimidin-2-yl)amino]cyclohexyl]oxy}pyrazolo[1,5-a]pyridine-3-carboxynitrile (Compound 22) Step 1. Synthesis of 4-(8-fluoro-[1,2,4]triazolo[1,5-a]pyridin-6-yl)morpholine.

[0215] Cesium carbonate (977 mg, 3.0 mmol) was added to 6-bromo-8-fluoro-[1,2,4]triazolo[1,5-a]pyridine (216 mg, 1.0 mmol) and morpholine (0.13 mL, 1.5 mmol) in 1,4-dioxane (4 mL). Brettphosprecat G3 (84 mg, 0.1 mmol) was added, and the resulting suspension was stirred vigorously at 100ºC for 16 h. The mixture was cooled to room temperature and filtered, and the solid was washed with 10% MeOH in DCM solution. The crude product was purified by MPLC to give the desired product (115 mg, 51.7% yield) as a yellow solid. ¹H NMR (400 MHz, chloroform-d) δ 8.32 (s, ¹H), 7.98 - 7.95 (m, ¹H), 7.18 (dd, J=11.4, 1.9 Hz, ¹H), 3.95 - 3.91 (m, 4H), 3.19- 3.12 (m, 4H). LCMS ESI m / z 223.1 [M+H]+; RT = 0.85 min (method column 6). Step 2. Synthesis of tert-butyl cis-4-((6-morpholino-[1,2,4]triazolo[1,5-a]pyridin-8-yl)oxy)cyclohexyl)carbamate.

[0216] A solution of NaHMDS in THF (0.55 mL, 0.55 mmol) was added to a mixture of 4-(8-fluoro-[1,2,4]triazolo[1,5-a]pyridin-6-yl)morpholine (56 mg, 0.25 mmol) and (cis-4-hydroxycyclohexyl)carbamate tert-butyl ester (56 mg, 0.275 mmol) in THF (2.0 mL). The resulting suspension was heated to 22°C and stirred at the same temperature for 1 h. The mixture was quenched with water and extracted with EtOAc (3 x 5 mL). The combined organic layers were concentrated and purified by MPLC to give the desired product as an oil. LCMS ESI m / z 418.5 [M+H]+; RT = 1.55 min (method column 6). Step 3. Synthesis of cis-4-((6-morpholino-[1,2,4]triazolo[1,5-a]pyridin-8-yl)oxy)cyclohexyl-1-amine.

[0217] TFA (0.5 mL) was added to a solution of ((1s,4s)-4-((6-morpholino-[1,2,4]triazolo[1,5-a]pyridin-8-yl)oxy)cyclohexyl)tert-butyl carbamate (104 mg, 0.25 mmol) in DCM (1 mL), and the resulting solution was stirred at room temperature for 1 h. The mixture was concentrated to give an oily product, which was used directly in the next step. LCMSESI m / z 318.3 [M+H]+; RT = 0.87 min (method column 6). Step 4. Following a procedure similar to step D in Example 1, after RP-HPLC purification, we obtained Example 22 (3.6 mg, % yield).

[0218] Examples 23 and 24 were prepared following the same procedure as in Example 22. Example 23 6-{3-oxadicyclo[4.1.0]hept-6-yl}-4-{[cis-4-[(4-methylpyrimidin-2-yl)amino]cyclohexyl]oxy}pyrazolo[1,5-a]pyridine-3-carboxynitrile (Compound 23) Example 24 6-{3-oxadicyclo[4.1.0]hept-6-yl}-4-{[cis-4-[(4-methylpyrimidin-2-yl)amino]cyclohexyl]oxy}pyrazolo[1,5-a]pyridine-3-carboxynitrile (Compound 24)

[0219] Table 3. Characterization data of compounds 2-24 NA = Unavailable Example 25 6-(morpholino-4-yl)-4-{[cis-4-(pyrimidin-2-yloxy)cyclohexyl]oxy}pyrazolo[1,5-a]pyridine-3-carboxynitrile (compound 25)

[0220] Synthetic Example 25 General Reaction Scheme Step 1. Preparation of trans-4-((tert-butyldimethylsilyl)oxy)cyclohexyl-1-ol (25-2)

[0221] Imidazole (3.52 g, 51.65 mmol) and tert-butyldimethylchlorosilane (2.85 g, 18.94 mmol) were added to a solution of trans-1,4-cyclohexanediol (2 g, 17.22 mmol) in DCM (40 mL) at 0ºC. The resulting reaction mixture was heated to room temperature and stirred for 22 h. The reaction was monitored by TLC. The reaction mixture was quenched with water (40 mL). The product was extracted with DCM (3 x 40 mL). The combined organic layers were washed with brine and dried over anhydrous Na2SO4. After filtration, the filtrate was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluting with PE / EtOAc (4 / 1) to give trans-4-((tert-butyldimethylsilyl)oxy)cyclohexane-1-ol (1.42 g, 35.8% yield) as a grayish-white solid. Step 2. Preparation of 2-((trans-4-((tert-butyldimethylsilyl)oxy)cyclohexyl)oxy)pyrimidine (25-3)

[0222] NaH (183 mg, 4.56 mmol, 60% dispersion in mineral oil) was added to a solution of trans-4-[tert-butyl(dimethyl)silyl]oxycyclohexanol (500 mg, 2.17 mmol) in anhydrous DMF (10 mL) at 0ºC. The resulting mixture was stirred for 30 min. 2-Chloroprene (323 mg, 2.82 mmol) was added to the mixture at 0ºC. The final reaction mixture was heated to room temperature and stirred for another 24 h. The reaction was monitored by LCMS. After the reaction was complete, it was quenched with cold water (30 mL). The product was extracted with EtOAc (3 x 30 mL). The combined organic layers were washed with brine and dried over anhydrous Na2SO4. After filtration, the filtrate was concentrated under reduced pressure. The residue was purified by reversed-phase rapid chromatography under the following conditions: column, C18 silica gel; mobile phase A: water (0.05% TFA), mobile phase B: ACN; flow rate: 50 mL / min; gradient: 90% B to 95% B over 2 min; wavelength: 254 / 220 nm. The fractions were combined and concentrated under vacuum to give 2-((trans-4-((tert-butyldimethylsilyl)oxy)cyclohexyl)oxy)pyrimidine (440 mg, 51.2% yield) as a colorless oil. Analytical LC / MS (Method 1): observation mass: 309.15; RT = 1.104 min. Step 3. Preparation of trans-4-(pyrimidin-2-yloxy)cyclohexane-1-ol (25-4)

[0223] Add Et3N to a solution of 2-((trans-4-((tert-butyldimethylsilyl)oxy)cyclohexyl)oxy)pyrimidine (420 mg, 1.36 mmol) in THF (5 mL) and methanol (1 mL). . 3HF (570 mg, 3.54 mmol). The resulting solution was stirred at room temperature for 24 h. The reaction was monitored by LCMS. After the reaction was complete, the resulting mixture was cooled to 0ºC in an ice bath, and an aqueous solution of ammonium hydroxide (382 mg, 28% w / w, 3.27 mmol) was added, followed by water (30 mL). The product was extracted with EtOAc (3 x 30 mL). The combined organic layers were washed with brine and dried over anhydrous Na2SO4. After filtration, the filtrate was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluting with 65% PE in EtOAc, to give trans-4-pyrimidin-2-yloxycyclohexanol (240 mg, 90% yield) as a colorless oil. Analytical LC / MS: Purity (Method 2): 99.2%; Observation quality: 195.20; RT = 0.460 min. Step 4. Preparation of trans-4-(pyrimidin-2-yloxy)cyclohexyl methanesulfonate (25-5)

[0224] Et3N (328 mg, 3.24 mmol) was added to a solution of trans-4-pyrimidin-2-yloxycyclohexanol (210 mg, 1.08 mmol) in DCM (2.5 mL), and MsCl (0.1 mL, 1.35 mmol) in DCM (0.5 mL) was added dropwise at 0ºC. The resulting solution was stirred at room temperature for 1 h. The reaction was monitored by LCMS. After the reaction was complete, the resulting mixture was quenched by adding saturated sodium bicarbonate aqueous solution (15 mL). The product was extracted with dichloromethane (3 x 30 mL). The combined organic layers were dried over anhydrous Na2SO4. After filtration, the filtrate was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluting with PE / EtOAc (1 / 1) to give trans-4-(pyrimidin-2-yloxy)cyclohexyl methanesulfonate (245 mg, 80.2% yield) as a white solid. 1¹H NMR (400 MHz, CDCl₃) δ 8.53 (d, J = 4.8 Hz, 2H), 6.95 (t, J = 4.8 Hz, 1H), 5.24 – 5.12 (m, 1H), 4.95 – 4.84 (m, 1H), 3.06 (s, 3H), 2.29 – 2.11 (m, 4H), 1.94 – 1.79 (m, 4H). Analytical LC / MS (Method 2): Purity: 96.4%; Observational quality: 272.95; RT = 0.727 min. Step 5. Preparation of 6-bromo-4-((cis-4-(pyrimidin-2-yloxy)cyclohexyl)oxy)pyrazolo[1,5-a]pyridine-3-carboxylonitrile (25-6)

[0225] Cs₂CO₃ (539 mg, 1.65 mmol) and 6-bromo-4-hydroxy-pyrazolo[1,5-a]pyridine-3-carboxylonitrile (256 mg, 1.07 mmol) were added to a solution of trans-4-(pyrimidin-2-yloxy)cyclohexyl methanesulfonate (225 mg, 0.83 mmol) in 1,4-dioxane (1.5 mL) and DMF (1.5 mL). The resulting solution was stirred at 100ºC for 5 h. After cooling to room temperature, the reaction was monitored by LCMS. After the reaction was complete, the resulting mixture was diluted with water (40 mL). The aqueous layer was extracted with EtOAc (3 x 40 mL). The combined organic layers were washed with brine and dried over anhydrous Na₂SO₄. After filtration, the filtrate was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluting with PE / EtOAc (1 / 1) to give 6-bromo-4-((cis-4-(pyrimidin-2-yloxy)cyclohexyl)oxy)pyrazolo[1,5-a]pyridine-3-carboxylonitrile (210 mg, 48.4% yield) as a yellow solid. Analytical LC / MS (Method 1): observation mass: 414.20 / 416.20; RT = 0.793 min. Step 6. Preparation of 6-morpholino-4-((cis-4-(pyrimidin-2-yloxy)cyclohexyl)oxy)pyrazolo[1,5-a]pyridine-3-carboxylonitrile (26-6)

[0226] Morpholine (34 mg, 0.39 mmol), Cs₂CO₃ (188 mg, 0.58 mmol), Ruphos Pd G₃ (32 mg, 0.04 mmol), and Ruphos (18 mg, 0.04 mmol) were added to a solution of 6-bromo-4-((cis-4-(pyrimidin-2-yloxy)cyclohexyl)oxy)pyrazolo[1,5-a]pyridine-3-carboxynitrile (80 mg, 0.19 mmol) in 1,4-dioxane (2 mL). The resulting solution was degassed three times with nitrogen and stirred at 90ºC for 4 h under a nitrogen atmosphere. After cooling to room temperature, the reaction was monitored by LCMS. After the reaction was complete, the resulting mixture was diluted with water (20 mL) and extracted with EtOAc (3 x 20 mL). The combined organic layers were washed with brine and dried over anhydrous Na₂SO₄. After filtration, the filtrate was concentrated under reduced pressure. The residue was purified by preparative TLC (100% EA) to obtain the crude product. The crude product was further purified by preparative HPLC under the following conditions (column: XBridge Prep OBD C18 column, 30*150 mm, 5 μm; mobile phase A: water (10 mmol / L NH4HCO3), mobile phase B: ACN; flow rate: 60 mL / min; gradient: 27% B to 57% B over 7 min; wavelength: 254 nm / 220 nm; RT1 (min): 6.8). The purified fractions were combined and concentrated under vacuum to remove the organic solvent. The remaining aqueous solution was lyophilized to give the title compound as a white solid (29.4 mg, 36% yield). 1 ¹H NMR (400 MHz, DMSO-d⁶) δ 8.60 (d, J = 4.8 Hz, 2H), 8.43 (s, 1H), 7.92 (s, 1H), 7.10 (t, J = 4.8 Hz, 2H), 5.17 – 5.03 (m, 1H), 4.99 – 4.89 (m, 1H), 3.77 (t, J = 4.4 Hz, 4H), 3.14 (t, J = 4.4 Hz, 4H), 2.07 – 1.78 (m, 8H). Analytical LC / MS (Method 3): Purity: 99.6%; Observational quality: 421.30; RT = 1.573 min. Example 26 6-{6-oxa-3-azabicyclo[3.1.1]hept-3-yl}-4-{[cis-4-(pyrimidin-2-yloxy)cyclohexyl]oxy}pyrazolo[1,5-a]pyridine-3-carboxylonitrile (Compound 26)

[0227] To a solution of 6-bromo-4-((cis-4-(pyrimidin-2-yloxy)cyclohexyl)oxy)pyrazolo[1,5-a]pyridine-3-carboxynitrile (80 mg, 0.19 mmol) in 1,4-dioxane (10 mL), 6-oxa-3-azabicyclo[3.1.1]heptane-4-methylbenzenesulfonate (157 mg, 0.58 mmol), Cs₂CO₃ (315 mg, 0.97 mmol), Ruphos Pd G₃ (32 mg, 0.04 mmol), and Ruphos (18 mg, 0.04 mmol) were added. The resulting solution was degassed three times with nitrogen and stirred overnight at 90ºC under a nitrogen atmosphere. After cooling to room temperature, the reaction was monitored by LCMS. After the reaction was complete, the resulting mixture was diluted with water (40 mL). The product was extracted with EtOAc (3 x 40 mL). The combined organic layers were washed with brine and dried over anhydrous Na₂SO₄. After filtration, the filtrate was concentrated under reduced pressure. The residue was purified by preparative TLC (dichloromethane / MeOH = 16 / 1) to give the crude product. The crude product was further purified by preparative HPLC under the following conditions (column: XBridge PrepOBD C18 column, 30*150 mm, 5 μm; mobile phase A: water (10 mmol / L NH₄HCO₃), mobile phase B: ACN; flow rate: 60 mL / min; gradient: 26% B to 56% B over 7 min; wavelength: 254 nm / 220 nm; RT1 (min): 6.1). The purified fractions were combined and concentrated under vacuum to remove the organic solvent. The remaining aqueous solution was lyophilized to give the title compound as a grayish-white solid (15.6 mg, 18.6% yield). 1H NMR (400 MHz, DMSO-d6) δ 8.60 (d, J = 4.8 Hz,2H), 8.37 (s, 1H), 7.82 (s, 1H), 7.11 (t, J = 4.8 Hz, 1H), 6.90 (s, 1H), 5.18– 5.05 (m, 1H), 5.02 – 4.89 (m, 1H), 4.72 (d, J = 6.0 Hz, 2H), 3.64 (d, J =11.2 Hz, 2H), 3.44 (d, J = 11.2 Hz, 2H), 3.20 –3.08 (m, 1H), 2.14 – 2.04 (m,2H), 2.04 – 1.81 (m, 7H). Analytical LC / MS (Method 3): Purity: 99.8%; Observation quality: 433.35; RT = 1.520 min. Example 27 6-{8-oxa-3-azabicyclo[3.2.1]oct-3-yl}-4-{[cis-4-(pyrimidin-2-yloxy)cyclohexyl]oxy}pyrazolo[1,5-a]pyridine-3-carboxylonitrile (Compound 27)

[0228] To a solution of 6-bromo-4-((cis-4-(pyrimidin-2-yloxy)cyclohexyl)oxy)pyrazolo[1,5-a]pyridine-3-carboxylonitrile (80 mg, 0.19 mmol) in 1,4-dioxane (4 mL), 8-oxa-3-azabicyclo[3.2.1]octane hydrochloride (64 mg, 0.43 mmol), Cs₂CO₃ (252 mg, 0.77 mmol), Ruphos Pd G₃ (32 mg, 0.04 mmol), and Ruphos (18 mg, 0.04 mmol) were added. The resulting solution was degassed three times with nitrogen and stirred overnight at 90ºC under a nitrogen atmosphere. After cooling to room temperature, the reaction was monitored by LCMS. After the reaction was complete, the resulting mixture was diluted with water (40 mL). The product was extracted with EtOAc (3 x 40 mL). The combined organic layers were washed with brine and dried over anhydrous Na₂SO₄. After filtration, the filtrate was concentrated under reduced pressure. The residue was purified by preparative TLC (dichloromethane / MeOH = 18 / 1) to obtain the crude product. The crude product was further purified by preparative HPLC under the following conditions (column: XBridge Prep OBD C18 column, 30*150 mm, 5 μm; mobile phase A: water (10 mmol / L NH4HCO3), mobile phase B: ACN; flow rate: 60 mL / min; gradient: 31% B to 61% B over 10 min; wavelength: 254 nm / 220 nm; RT1 (min): 7.9). The purified fractions were combined and concentrated under vacuum to remove the organic solvent. The remaining aqueous solution was lyophilized to give the title compound as a white solid (9.5 mg, 11.0% yield). 1 ¹H NMR (400 MHz, DMSO-d⁶) δ 8.60 (d, J = 4.8 Hz, 2H), 8.40 (s, 1H), 7.81 (s, 1H), 7.11 (t, J = 4.8 Hz, 1H), 7.05 (s, 1H), 5.17 – 5.04 (m, 1H), 4.99 – 4.89 (m, 1H), 4.43 (s, 2H), 3.43 (d, J = 10.8 Hz, 2H), 2.83 (d, J = 11.2 Hz, 2H), 2.12 – 1.77 (m, 12H). Analytical LC / MS (Method 4): Purity: 99.9%; Observational quality: 447.25; RT = 1.160 min. Example 28 6-(2-methylmorpholino-4-yl)-4-{[cis-4-(pyrimidin-2-yloxy)cyclohexyl]oxy}pyrazolo[1,5-a]pyridine-3-carboxynitrile (compound 28)

[0229] To a solution of 6-bromo-4-((cis-4-(pyrimidin-2-yloxy)cyclohexyl)oxy)pyrazolo[1,5-a]pyridine-3-carboxynitrile (80 mg, 0.19 mmol) in 1,4-dioxane (2 mL), 2-methylmorpholine (39 mg, 0.39 mmol), Cs₂CO₃ (189 mg, 0.58 mmol), Ruphos Pd G₃ (32 mg, 0.04 mmol), and Ruphos (18 mg, 0.04 mmol) were added. The resulting solution was degassed three times with nitrogen and stirred at 90ºC for 5 h under a nitrogen atmosphere. After cooling to room temperature, the reaction was monitored by LCMS. After the reaction was complete, the resulting mixture was diluted with water (20 mL). The product was extracted with EtOAc (3 x 20 mL). The combined organic layers were washed with brine and dried over anhydrous Na₂SO₄. After filtration, the filtrate was concentrated under reduced pressure. The residue was purified by preparative TLC (dichloromethane / MeOH = 16 / 1) to give the crude product. The crude product was further purified by preparative HPLC under the following conditions (column: XBridge Prep OBD C18 column, 30*150 mm, 5 μm; mobile phase A: water (10 mmol / L NH4HCO3), mobile phase B: ACN; flow rate: 60 mL / min; gradient: 31% B to 61% B over 10 min; wavelength: 254 nm / 220 nm; RT1 (min): 7.95). The purified fractions were combined and concentrated under vacuum to remove the organic solvent. The remaining aqueous solution was lyophilized to give the title compound as a white solid (18.8 mg, 22.4% yield). 1HNMR (400 MHz, DMSO-d6) δ 8.60 (d, J = 4.8 Hz, 2H), 8.43 (s, 1H), 7.92 (s,1H), 7.11 (t, J = 4.8 Hz, 2H), 5.17 – 5.05 (m, 1H), 4.99 – 4.90 (m, 1H), 3.97– 3.87 (m, 1H), 3.75 – 3.57 (m, 3H), 3.51 (d, J = 11.6 Hz, 1H), 2.74 – 2.61(m, 1H), 2.35 (t, J = 11.2 Hz, 1H), 2.12 – 1.78 (m, 8H), 1.16 (d, J = 6.2 Hz, 3H). Analytical LC / MS (Method 4): Purity: 99.8%; Observation quality: 435.35; RT = 1.173 min. Example 29 6-(3,6-dihydro-2H-pyran-4-yl)-4-{[cis-4-(pyrimidin-2-yloxy)cyclohexyl]oxy}pyrazolo[1,5-a]pyridine-3-carboxynitrile (Compound 29)

[0230] Add 2-(3,6-dihydro-2H-pyran-4-yl)-4,4,5,5-tetramethyl-1,3,2-dioxane (40 mg, 0.19 mmol), Na2CO3 (15 mg, 0.14 mmol), and Pd(dppf)Cl2 to a solution of 6-bromo-4-((cis-4-(pyrimidin-2-yloxy)cyclohexyl)oxy)pyrazolo[1,5-a]pyridine-3-carboxynitrile (60 mg, 0.14 mmol), Na2CO3 (15 mg, 0.14 mmol), and Pd(dppf)Cl2 to the solution of 6-bromo-4-((cis-4-(pyrimidin-2-yloxy)cyclohexyl)oxy)pyrazolo[1,5-a]pyridine-3-carboxynitrile (60 mg, 0.14 mmol), Na2CO3 (15 mg, 0.14 mmol), and Pd(dppf)Cl2. .CH2Cl2 (12 mg, 0.01 mmol). The resulting solution was degassed three times with nitrogen and stirred at 90ºC for 4 hours under a nitrogen atmosphere. After cooling to room temperature, the reaction was monitored by LCMS. After the reaction was complete, the resulting mixture was diluted with water (20 mL). The product was extracted with EtOAc (3 x 20 mL). The combined organic layers were washed with brine and dried over anhydrous Na2SO4. After filtration, the filtrate was concentrated under reduced pressure. The residue was purified by preparative TLC (dichloromethane / MeOH = 16 / 1) to give the crude product. The crude product was further purified by preparative HPLC under the following conditions (column: XBridge Prep OBD C18 column, 30*150 mm, 5 μm; mobile phase A: water (10 mmol / L NH4HCO3), mobile phase B: ACN; flow rate: 60 mL / min; gradient: 31% B to 61% B over 10 min; wavelength: 254 nm / 220 nm; RT1 (min): 8.5). The purified fractions were combined and concentrated under vacuum to remove the organic solvent. The remaining aqueous solution was lyophilized to give the title compound as a grayish-white solid (33.6 mg, 55.4% yield). 1 H NMR (400 MHz, DMSO-d6) δ8.60 (d, J = 4.8 Hz, 2H), 8.57 (s, 1H), 8.48 (s, 1H), 7.28 (s, 1H), 7.11 (t,J = 4.8 Hz, 1H), 6.57 (s, 1H), 5.19 – 5.07 (m, 1H), 5.06 – 4.97 (m, 1H), 4.28 (d, J = 2.4 Hz, 2H), 3.84 (t, J = 5.6 Hz, 2H), 2.57 – 2.51 (m, 2H), 2.17 –1.74 (m, 8H). Analytical LC / MS (Method 4): Purity: 99.7%; Observation quality: 418.30; RT = 1.147 min.

[0231] Examples 30-33 were prepared following a similar procedure to that of Examples 25-29. Example 30 6-(2-methylmorpholin-4-yl)-4-{[cis-4-[(4-methylpyrimidin-2-yl)oxy]cyclohexyl]oxy}pyrazolo[1,5-a]pyridine-3-carboxynitrile (Compound 30) Example 31 6-{8-oxa-3-azabicyclo[3.2.1]oct-3-yl}-4-{[cis-4-[(4-methylpyrimidin-2-yl)oxy]cyclohexyl]oxy}pyrazolo[1,5-a]pyridine-3-carboxylonitrile (Compound 31) Example 32 6,6-(morpholin-4-yl)-4-{[cis-4-[(4-methylpyrimidin-2-yl)oxy]cyclohexyl]oxy}pyrazolo[1,5-a]pyridine-3-carboxynitrile (compound 32) Example 33 6-(morpholin-4-yl)-4-{[cis-4-[(5-methoxypyrimidin-2-yl)oxy]cyclohexyl]oxy}pyrazolo[1,5-a]pyridine-3-carboxynitrile (compound 33)

[0232] Table 4. Characterization data of compounds 30-33 Biological Examples DNA-PK biochemical assays were performed using a hotspot kinase assay protocol from reaction biology.

[0233] Reagents: Alkaline reaction buffer; 20 mM Hepes (pH 7.5), 10 mM MgCl2, 1 mM EGTA, 0.01% Brij35, 0.02 mg / ml BSA, 0.1 mM Na3VO4, 2 mM DTT, 1% DMSO. Add the required cofactors individually to each kinase reaction.

[0234] Reaction procedure: 1. Prepare the substrate in freshly prepared reaction buffer; 2. Add any desired cofactor to the substrate solution; 3. Add the kinase to the substrate solution and mix gently; 4. Add the compound in 100% DMSO to the kinase reaction mixture using an acoustic technique (Echo 550; nanoliter range) and incubate at room temperature for 20 min; 5. Add 33P-ATP to the reaction mixture to initiate the reaction; 6. Incubate at room temperature for 2 h; 7. Assess kinase activity using the P81 filter binding assay.

[0235] Evaluation of various compounds in DNA-PK biochemical assays.

[0236] Table 5. DNA-PK Biochemical Assay T cell cytotoxicity assay - CD3 Glo proliferation assay:

[0237] Frozen vials of CD3 T cells were thawed in assay medium (RPMI 1640, 5% HI FBS, 1x L / G, 1x NEAA, 1x sodium pyruvate, 1x P / S (Gibco, Waltham MA)) and viable cells were counted using a Moxi V cell counter (Orflo, Ketchum ID). Thawed T cells were collected by centrifugation at 1600 rpm for 10 min at room temperature. The T cell pellet was resuspended in 10 ml of assay medium in 50 ml conical tubes and incubated at 37ºC for 1 hour. The T cell suspension was removed from the 37ºC incubator and diluted to 5e5 cells / ml. T cells were then stimulated for 24 hours at 37ºC with an anti-CD3 / anti-CD28 stimulating agent at 4 μg / 1 million T cells, prepared using an oligostreptavidin mutant protein reagent as described in WO2018 / 197949 (see also Poltorak et al., Scientific Reports (2020)). The following day, compound plates were prepared by ten 3-fold serial dilutions at a maximum concentration of 3 mM in 100% DMSO. All compound dilutions were performed on Echo-qualified 384w plates (Beckman, Indianapolis IN), followed by 200 nanoliters acoustic transfer to Corning 384w tissue culture-treated plates (catalog #353988, Corning, Tewksbury MA) using an ECHO 650 acoustic liquid processor (Beckman, Indianapolis IN). To neutralize anti-CD3 / anti-CD28 stimulator-mediated T cell activation, 50 mM D-biotin was added at a 1:50 dilution to the anti-CD3 / anti-CD28 stimulator-activated T cell culture and incubated at 37ºC for 10 min. Using a Multidrop liquid processor (ThermoFisher, Waltham MA), 40 μL of neutralizing T cell culture or assay medium control was dispensed into each well of a corning assay plate pre-printed with 200 nanoliters of the compound in DMSO. The plates were incubated for 3 days, at which point 10 μL of Celltiter Glo reagent (Promega, Madison WI) was added to each well, incubated at room temperature for 10 min, and then read on an Envision plate reader (Perkin-Elmer, Waltham MA). The concentration of Celltiter Glo signal at which a 50% reduction occurred (CC) was calculated using a four-parameter logistic equation. 50 ). T cell culture medium and thawing

[0238] CD4+ and CD8+ T cells were isolated from healthy donor T cells and combined in serum-free T cell culture medium (TCM) containing the following recombinant cytokines at a CD4 to CD8 T cell ratio of 1:1: 100 IU / mL IL-2, 1500 IU / mL IL-7, and 19 IU / mL IL-15. T cell activation

[0239] For T cell stimulation, an anti-CD3 / anti-CD28 stimulator was prepared using an oligo-streptavidin mutant protein reagent as described in WO 2018 / 197949 (see also Poltorak et al., Scientific Reports (2020)). The oligo-streptavidin mutant protein reagent has an average hydrodynamic radius of 90–120 nm and contains an average of 2000–2800 streptavidin mutant protein tetramers (Strep-Tactin® m2, SEQ ID NO: 6). The oligo-streptavidin mutant protein reagent was mixed at room temperature with (i) an anti-CD3 Fab fragment fused separately to a streptavidin-binding peptide sequence (Twin-Strep-tag®, SEQ ID NO: 16) at the C-terminus of its heavy chain and (ii) an anti-CD28 Fab fragment also fused separately to a streptavidin-binding peptide sequence (Twin-Strep-tag®, SEQ ID NO: 16) at the C-terminus of its heavy chain. The recombinant generates a peptide-labeled Fab fragment (see International Patent Application Publications WO 2013 / 011011 and WO2013 / 124474). The anti-CD3 Fab fragment is derived from a CD3-binding monoclonal antibody produced from the hybridoma cell line OKT3 (ATCC® CRL-8001™; see also US Patent No. 4,361,549) and contains the heavy chain variable domain (SEQ ID NO: 31) and light chain variable domain (SEQ ID NO: 32) of the anti-CD3 antibody OKT3 described in Arakawa et al., J. Biochem. 120,657-662 (1996). The anti-CD28 Fab fragment was derived from antibody CD28.3 (deposited as a synthetic single-chain Fv construct in GenBank accession number AF451974.1; see also Vanhove et al., BLOOD, July 15, 2003, Vol. 102, No. 2, pp. 564-570) and contained the heavy chain variable domain (SEQ ID NO: 33) and light chain variable domain (SEQ ID NO: 34) of the anti-CD28 antibody CD28.3. To prepare the anti-CD3 / anti-CD28 stimulator, 0.3 mg of oligostreptavidin mutant protein reagent, 0.5 µg of peptide-labeled anti-CD3 Fab fragment, and 0.5 µg of peptide-labeled anti-CD28 Fab fragment were used.

[0240] The isolated T cells described above were divided into approximately 3 x 10⁻⁶ cells. 6Cells were suspended at a density of [number] cells / mL in medium supplemented with 100 IU / mL IL-2, 1500 IU / mL IL-7, and 19 IU / mL IL-15, with anti-CD3 / anti-CD28 stimulators added to the medium. Cells were cultured in 6-well plates (Corning 351146) and incubated at 37ºC for 48 hours. T-cell engineering

[0241] 48 hours after activation, T cells were counted and their values ​​were set at 5 x 10⁻⁶. 7 T cells were resuspended in buffer at a density of 100 cells / mL. To introduce genetic disruption at the endogenous TCRα constant region (TRAC) locus via CRISPR / Cas9-mediated gene editing, a ribonucleoprotein (RNP) consisting of the Cas9 protein (Aldevron) and a single guide RNA (sgRNA) targeting the TRAC with the targeting domain sequence GAGAAUCAAAAUCGGUGAAU (SEQ ID NO:28; targeting exon 1 of the endogenous TRAC gene) was added to the resuspended T cells to achieve a final concentration of 2 µM RNP. The T cell / RNP solution was transferred to electroporation cuvettes, 100 µL / cuvette (Lonza P3 Primary Cell 4D-Nucleofector X Kit LV4XP-3024), and electroporation was performed using Lonza 4D-Nucleofector X units (Lonza) with pulse code DN-100 / P3. Immediately after electroporation, 600 µL of TCM was added to each electroporation cuvette, and the cells were incubated at 37ºC for 15 min. The electroporated cells were pooled and transferred to a 96-well flat-bottom recovery plate (Corning 351172) containing an AAV (MOI of 5 x 10⁻⁶) encoding an exemplary homology-directed repair template for inserting an exemplary anti-BCMA CAR into a TRAC locus. 3 The cells were incubated with a specified concentration of a DNA-PK inhibitor, 1 mM d-biotin, 100 IU / mL IL-2, 1500 IU / mL IL-7, and 19 IU / mL IL-15, with a final volume of 210 µL TCM / well and a final cell density (based on pre-electroporation counts) of 5 x 10⁻⁶ cells / well. 5T cells / well. The anti-BCMA CAR is described in WO2019 / 090003. An exemplary anti-BCMA CAR (SEQ ID NO: 198, encoded by SEQ ID NO: 197) comprises a human IgG-κ signaling sequence, a human anti-BCMA scFv (Table 6); a modified IgG4-hinge CH2-CH3 (SEQ ID NO: 184, encoded by SEQ ID NO: 183) spacer (which may be referred to as “LS” in some cases); a human CD28 transmembrane domain (SEQ ID NO: 186, encoded by SEQ ID NO: 185); an intracellular co-signaling sequence derived from human 4-1BB (SEQ ID NO: 188, encoded by SEQ ID NO: 187); and an intracellular signaling domain derived from human CD3-ζ (SEQ ID NO: 190, encoded by SEQ ID NO: 189).

[0242] An exemplary human anti-BCMA scFv contains an scFv having the following sequence:

[0243] The general structure of an exemplary homology-directed repair template polynucleotide is as follows: [5' homology arm (SEQ ID NO: 191)] - [promoter (SEQ ID NO: 187)] - [transgenic sequence encoding anti-BCMA CAR (SEQ ID NO: 193)] - [3' homology arm (SEQ ID NO: 192)]. The homology arm comprises an approximately 600 bp nucleic acid sequence homologous to the sequence surrounding the target integration site in exon 1 of the human TCRα constant region (TRAC) gene. The sequence of the entire homology-directed repair template polynucleotide used is given in SEQ ID NO: 194.

[0244] The control samples were engineered as described above, with the DNA-PK inhibitor treatment (untreated) or AAV (TRAC KO only) omitted in the corresponding wells of the recovery plate. T cell expansion

[0245] Twenty-four hours after electroporation, T cells were transferred at a final volume of 3 mL TCM / well to 24-well GREX plates (Wilson Wolf 80192M) supplemented with 100 IU / mL IL-2, 1500 IU / mL IL-7, and 19 IU / mL IL-15. Cells were expanded in GREX plates for a total of 5 days after electroporation, supplemented with cytokines every 2–3 days (final volume 4 mL / well on day 5 post-electroporation). On day 5 post-electroporation, cell viability and count were measured using AOPI staining (Nexcelom CS2-0106) and a CellaMX automated cell counter (Nexcelom Bioscience). CAR knock-in efficiency was measured by flow cytometry as described below. Flow cytometry

[0246] Following T cell engineering and 5-day expansion, TRAC knockout and CAR knock-in were characterized by flow cytometry. Briefly, 2–5 x 10⁵ cells / well were transferred to 96-well U-shaped plates (Corning 351177) for staining with live / dead fixable near-IR (ThermoFisher L34993) according to the manufacturer’s protocol, followed by incubation at 4ºC for 30 min with a mixture of antibodies targeting CD3 (BioLegend, UCHT1), CD4 (BioLegend, OKT4), and CD8 (BD Horizon, RPA-T8) and anti-idiotype antibodies (which bind to the extracellular portion of the exemplary anti-BCMA CAR; see WO 2021 / 113776) diluted in cell staining buffer (BioLegend D5RE-01386-1). After staining, cells were washed, resuspended in 100 μL of cell staining buffer per well, and analyzed using a FACSymphony A5 cell counter (BD Biosciences) with a high-throughput plate reader to collect 20,000 viable cells per well. Data analysis was performed using FlowJo 10.8.1 (BD Biosciences) and JMP 15.2.0 (SAS Institute Inc.). Total CAR+ T cells were calculated by multiplying the CAR+% by the total cell count, and then normalized to the untreated condition by dividing the total CAR+ T cells of the DNA PK inhibitor-treated condition by the average of the three untreated conditions, subtracting 1, and multiplying by 100 to obtain the total CAR+ cell yield as a percentage change relative to the untreated control.

[0247] Figure 1The effects of 0.25 mM, 1.25 mM, and 2.5 mM DNA-PK inhibitor compounds (e.g., compound 18 of Example 18) on cell viability at 5 days after electroporation are shown, using two donors (donor 1 is shown in dark gray and donor 2 in light gray). Viable cells are shown as a percentage of total cells.

[0248] Figure 2 The effect of a DNA-PK inhibitor compound (e.g., compound 18 of Example 18) on T cell proliferation was shown 5 days after electroporation. Total viable cell count (x10e6) is shown.

[0249] Figure 3 The effect of a DNA-PK inhibitor compound (e.g., compound 18 of Example 18) on CAR insertion into the TRAC locus was shown 5 days after electroporation. The frequency of CAR+ T cells is shown as a percentage of total viable cells.

[0250] Figure 4 The effect of a DNA-PK inhibitor compound (e.g., compound 18 of Example 18) on CAR insertion into the TRAC locus was shown 5 days after electroporation. KI efficiency is shown as a percentage change relative to the untreated control condition (calculated by dividing the DNA-PKi-treated CAR+% by the untreated CAR, subtracting 1, and multiplying by 100).

[0251] Figure 5 The effect of a DNA-PK inhibitor compound (e.g., compound 18 of Example 18) on total CAR+ cell yield was shown 5 days after electroporation. Relative CAR+ yield is shown as a percentage change relative to the untreated control condition (calculated by dividing the number of CAR+ cells in the DNA-PKi-treated condition by the untreated condition, subtracting 1, and multiplying by 100).

[0252] Table 7. Sequence List equivalent

[0253] Details of one or more embodiments of this disclosure are set forth in the accompanying description above. While any methods and materials similar to or equivalent to those described and used herein may be used in the practice or testing of this disclosure, preferred methods and materials are now described. Other features, objectives, and advantages of this disclosure will become clear from the specification and the claims. In the specification and appended claims, the singular form includes the plural referent unless the context clearly specifies otherwise. Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure pertains. All patents and publications referenced in this specification are incorporated herein by reference.

[0254] The foregoing description is presented for illustrative purposes only and is not intended to limit this disclosure to the precise form disclosed, but is subject to the appended claims. List of implementation plans Listed implementation scheme 1. A compound of formula I: (I), Or its pharmaceutically acceptable salt, stereoisomer, solvate, prodrug, or tautomer. in: A is arbitrarily defined by one or more R. 3 Substituted 6- to 8-membered cycloalkyl groups; X 1 Is it N or CR? 4 ; X 2 It is O, S, CH-OH, NH or N (C1-C4 alkyl); R 1 It is H or a 6- to 8-membered heterocyclic alkyl or heteroaryl group containing at least one heteroatom selected from N and O, wherein the heterocyclic alkyl or heteroaryl group is optionally surrounded by one or more R groups. 5 replace; R 2 It is H, -COO (C1-C4 alkyl), -C(O)O- (aryl or heteroaryl), or a heteroaryl group containing at least one heteroatom selected from N, O, and S, wherein the aryl or heteroaryl group is optionally surrounded by one or more R atoms. 6 replace; Each R 3 Independently selected from halogens, C1-C4 alkyl groups, and C1-C4 alkoxy groups; R 4 Selected from -CN, halogen, C1-C4 alkyl, C1-C4 alkoxy, CO (C1-C4 alkyl) and CHO; Each R 5 Independently selected from halogens and C1-C4 alkyl groups; and Each R 6 Independently selected from hydrogen, halogen, -CN, C1-C4 alkyl, C1-C4 haloalkyl, C1-C4 alkoxy, C1-C4 haloalkoxy, CONH (C1-C4 alkyl), COO (C1-C4 alkyl), COO (C3-C8 cycloalkyl), and NH2; or two R atoms connected to adjacent atoms of the heteroaryl ring. 6 The group forms a fused 5- or 6-membered ring containing 0-3 heteroatoms selected from O, N, and S. Scheme 2 listed. The compound according to Scheme 1 listed, wherein R 2 yes Where X 3 X 4 X 5 and X 6 Each of them is independently selected from N and C(R) 6 ), where X 3 X 4 X 5 and X 6 At least one of them is C(R) 6 ). Scheme 3. The compound according to Scheme 1, wherein R 2 yes Where X 3 X 4 X 5 and X 6 Each of these elements is independently selected from N, NH, O, S, and C(R). 6 ), where X 3 X 4 X 5 and X 6 At most one of them is O or S. Scheme 4. The compound according to Scheme 1, wherein A is selected from: , , , , , , , , and , Where p is 0, 1, 2 or 3. Listed Scheme 5. The compound according to Listed Scheme 1, wherein R 1Selected from: , , , , , , , , , , , , , , , , and , Where n is 0, 1, 2 or 3. Listed Scheme 6. The compound according to Listed Scheme 1, wherein R 2 Selected from: , , , , , , , , , , , , , , , , and , Where m is 0, 1, 2 or 3. 7. A compound according to any one of the foregoing listed embodiments, wherein the compound has the formula (Ia-1): (Ia-1). 8. A compound according to any one of the foregoing listed embodiments, wherein the compound has formula (Ia-2): (Ia-2). 9. A compound according to any one of the foregoing listed embodiments, wherein the compound has formula (Ia-3): (Ia-3). 10. A compound according to any one of the foregoing listed embodiments, wherein the compound has formula (Ia-4): (Ia-4). 11. A compound according to any one of the foregoing listed embodiments, wherein the compound has the formula (Ib-1): (Ib-1). 12. A compound according to any one of the foregoing listed embodiments, wherein the compound has the formula (Ib-2): (Ib-2). 13. A compound according to any one of the foregoing listed embodiments, wherein the compound has the formula (Ib-3): (Ib-3). 14. The compound according to any one of the foregoing listed embodiments, wherein the compound has the formula (Ib-4): (Ib-4). 15. A compound according to any one of the foregoing listed embodiments, wherein the compound has the formula (Ib-5): (Ib-5). 16. A compound according to any one of the foregoing listed embodiments, wherein the compound has the formula (Ib-6): (Ib-6). 17. The compound according to any one of the foregoing listed embodiments, wherein the compound is selected from: , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , and , Or a pharmaceutically acceptable salt, stereoisomer, solvate, prodrug, or tautomer thereof. 18. The compound according to any one of the foregoing listed embodiments, wherein the compound is selected from: , , , , , , , , , , , , , , , , , , , , and Or a pharmaceutically acceptable salt, stereoisomer, solvate, prodrug, or tautomer thereof. Example 19. The compound according to Example 1, wherein the compound is selected from the compounds provided in Table 1, or pharmaceutically acceptable salts, stereoisomers, solvates, prodrugs or tautomers thereof. Example 20. The compound according to Example 1, wherein the compound is selected from the compounds provided in Table 2, or pharmaceutically acceptable salts, stereoisomers, solvates, prodrugs or tautomers thereof. Example 21. A pharmaceutically acceptable composition comprising a compound according to any one of examples 1-20 and a pharmaceutically acceptable carrier. Example 22. A composition comprising: a) DNA protein kinase inhibitors (DNA-PKI); and b) DNA cutting agent; The DNA-PKI mentioned therein is a compound according to any one of the listed embodiments 1-20. Example 23. The composition according to example 22, wherein the composition further comprises cells. Example 24. The composition according to example 22 or example 23, wherein the composition further comprises donor DNA. Example 25. The composition according to any one of Examples 22 to 24, wherein the concentration of the DNA-PKI in the composition is about 10 μM or less. Example 26. The composition according to any one of Examples 22 to 24, wherein the concentration of the DNA-PKI in the composition is about 0.1-10 μM. Example 27. The composition according to example 26, wherein the concentration of the DNA-PKI in the composition is about 0.25-5 μM. Example 28. The composition according to any one of the examples 23 to 27, wherein the cell is a eukaryotic cell. Example 29. The composition according to any one of the examples 23 to 27, wherein the cells are available for adoptive cell therapy (ACT). Example 30. The composition according to example 29, wherein the cell is a stem cell. Example 31. The composition according to example 30, wherein the stem cell is a hematopoietic stem cell (HSC) or an induced pluripotent stem cell (iPSC). 32. The composition according to any one of the listed embodiments 29 to 31, wherein the cells are immune cells. Example 33. The composition according to example 32, wherein the immune cells are leukocytes or lymphocytes. Example 34. The composition according to example 33, wherein the immune cells are lymphocytes. Example 35. The composition according to example 34, wherein the lymphocytes are T cells, B cells or NK cells. Example 36. The composition according to example 34, wherein the lymphocytes are T cells. Example 37. The composition according to example 36, wherein the T cells are primary T cells. Example 38. The composition according to example 36, wherein the T cells are regulatory T cells. Example 39. The composition according to any one of the examples 36 to 38, wherein the lymphocytes are activated T cells. Example 40. The composition according to any one of the examples 36-38, wherein the lymphocytes are inactive T cells. 41. The composition according to any one of the listed embodiments 23 to 40, wherein the cell is a human cell. Example 42. The composition according to any one of Examples 22 to 41, wherein the DNA cutting agent comprises a CRISPR / Cas nuclease component and an optional guide RNA component. Example 43. The composition according to any one of Examples 22-42, wherein the DNA cleaving agent comprises a CRISPR / Cas nuclease that produces double-strand DNA breaks or single-strand DNA breaks. Example 44. The composition according to any one of Examples 22 to 41, wherein the DNA cleaving agent is selected from zinc finger nucleases, TALE effector domain nucleases (TALEN), CRISPR / Cas nuclease components, and combinations thereof. Example 45. The composition according to example 42, wherein the DNA cleavage agent is a CRISPR / Cas nuclease component and a guide RNA component. Example 46. The composition according to example 45, wherein the CRISPR / Cas nuclease component comprises a Cas nuclease or mRNA encoding the Cas nuclease. Example 47. The composition according to example 45, wherein the CRISPR / Cas nuclease component comprises the Cas nuclease. Example 48. The composition according to example 46 or example 47, wherein the Cas nuclease is a type II Cas nuclease. Example 49. The composition according to example 48, wherein the Cas nuclease is a Cas9 nuclease. Example 50. The composition according to example 49, wherein the Cas nuclease is Streptococcus pyogenes Cas9 nuclease. Example 51. The composition according to example 46 or example 47, wherein the Cas nuclease is a type 2 V Cas nuclease. Example 52. The composition according to example 46 or example 47, wherein the Cas nuclease is a Cas12a nuclease. Example 53. The composition according to example 52, wherein the Cas nuclease is an aminococcal Cas12a nuclease. 54. The composition according to any one of the listed embodiments 46-53, wherein the Cas nuclease produces single-strand DNA breaks. 55. The composition according to any one of the listed embodiments 22-54, wherein the composition comprises modified RNA. 56. The composition according to any one of the listed embodiments 42-55, wherein the guide RNA component is a guide RNA nucleic acid. Example 57. The composition according to example 56, wherein the guide RNA nucleic acid is guide RNA (gRNA). Example 58. The composition according to example 56 or example 57, wherein the guide RNA nucleic acid is or encodes a dual guide RNA (dgRNA) consisting of crRNA and tracrRNA. Example 59. The composition according to example 56 or example 57, wherein the guide RNA nucleic acid is or encodes a single guide RNA (sgRNA). Example 60. The composition according to any one of the examples 57-59, wherein the gRNA is a modified gRNA. Example 61. The composition according to Example 60, wherein the cleavage agent is Cas9, and the modified gRNA contains a modification at one or more nucleotides in the first five nucleotides of the 5' end. Example 62. The composition according to example 60, wherein the cleavage agent is Cas12a and the modified gRNA comprises a DNA / RNA hybrid molecule. Example 63. The composition according to examples 60-62, wherein the modified gRNA contains a modification at one or more of the last five nucleotides at the 3' end. Example 64. The composition according to any one of Examples 22 to 63, wherein the composition comprises a guide RNA nucleic acid and a type II or type V Cas nuclease; and the molar ratio of the guide RNA to the Cas nuclease is about 4:1 to 1:4. Example 65. The composition according to any one of Examples 24 to 64, wherein the donor DNA comprises a template comprising a sequence encoding a protein, a regulatory sequence, or a sequence encoding a structural RNA. 66. The composition according to any one of the listed embodiments 22-65, wherein the composition further comprises a carrier. Example 67. The composition according to example 66, wherein the vector encodes the donor DNA. Example 68. The composition according to example 66 or example 67, wherein the vector is a viral vector. Example 69. The composition according to example 66 or example 67, wherein the carrier is a non-viral carrier. Example 70. The composition according to example 68, wherein the carrier is AAV. Example 71. The composition according to example 23, wherein the cells are not cancer cells. Example 72. The composition according to any one of Examples 22 to 71, further comprising an inhibitor of the microhomology-mediated terminal junction (MMEJ) pathway. Example 73. A method for targeted genome editing in cells, the method comprising contacting the cells with a DNA cutting agent and a DNA-PKI, wherein the DNA-PKI is a compound according to any one of Examples 1-20. Example 74. A method for repairing double-stranded DNA breaks in a cell genome, the method comprising contacting the cell with a DNA cutting agent and a DNA-PKI, wherein the DNA-PKI is a compound according to any one of Examples 1-20. Example 75. A method for inhibiting or blocking the repair of DNA breaks in cells via the non-homologous end joining (NHEJ) pathway, the method comprising contacting the cells with a DNA cutting agent and a DNA-PKI, wherein the DNA-PKI is a compound according to any one of Examples 1-20. Example 76. The method according to example 75, further comprising contacting the cell with an inhibitor of the microhomology-mediated terminal junction (MMEJ) pathway. Example 77. A method for targeted insertion of donor DNA into the genome of a cell, the method comprising contacting the cell with a DNA cutting agent, the donor DNA and a DNA-PKI, wherein the DNA-PKI is a compound according to any one of Examples 1-20. Example 78. The method according to any one of Examples 73 to 77, the method comprising growing the cells in a cell culture medium free of the DNA-PKI and adding the DNA-PKI to the cell culture medium. Example 79. The method according to any one of Examples 73 to 78, wherein the method comprises contacting the cell with the DNA cutting agent prior to contacting the cell with the DNA-PKI. Example 80. The method according to example 79, wherein the method includes contacting the cells with the DNA-PKI within approximately six hours of contacting the cells with the DNA cutting agent. Example 81. The method according to example 80, wherein the method comprises contacting the cells with the DNA-PKI within approximately three hours of contacting the cells with the DNA cutting agent. 82. The method according to any one of the listed embodiments 73-78, the method comprising contacting the cells and the DNA cutting agent simultaneously with the DNA-PKI. Example 83. The method according to any one of Examples 73-78, the method comprising contacting the cells with the DNA-PKI after contacting the cells with the DNA-PKI. 84. The method according to any one of the listed embodiments 73-83, wherein contacting the cells with the DNA cutting agent includes electroporation. Example 85. The method according to example 83 or example 84, wherein the method comprises contacting the cells with the DNA cutting agent within approximately three hours of contacting the cells with the DNA-PKI. Example 86. The method according to any one of Examples 83 to 85, the method comprising growing the cells in a cell culture medium containing the DNA-PKI. Example 87. The method according to any one of Examples 83 to 86, wherein the cells are contacted with the DNA cutting agent and the DNA-PKI for at least about one day. Example 88. The method according to example 87, wherein the cells are contacted with the DNA cutting agent and the DNA-PKI for about one day to about two weeks. Example 89. The method according to example 87, wherein the cells are contacted with the DNA cutting agent and the DNA-PKI for approximately two weeks. Example 90. The method according to any one of Examples 73 to 89, wherein the cells are contacted with the DNA-PKI in a cell culture medium, wherein the concentration of the DNA-PKI in the cell culture medium is about 10 μM or lower. Example 91. The method according to any one of Examples 73 to 90, wherein the cells are contacted with the DNA-PKI in a cell culture medium, wherein the concentration of the DNA-PKI in the cell culture medium is about 0.1-10 μM. Example 92. The method according to example 91, wherein the concentration of the DNA-PKI in the cell culture medium is about 0.25-5 μM. Scheme 93. The method according to any one of the listed schemes 73 to 92, wherein the cell is a eukaryotic cell. Listed Embodiment 94. The method according to any one of the listed embodiments 73-93, wherein the cells are used in adoptive cell therapy (ACT). Listed implementation scheme 95. The method according to listed implementation scheme 94, wherein the cells are used in autologous cell therapy. Listed implementation scheme 96. The method according to listed implementation scheme 94, wherein the cells are used in allogeneic cell therapy. 97. The method according to any one of the listed embodiments 73-93, wherein the cell is a stem cell. Example 98. The method according to example 97, wherein the stem cell is a hematopoietic stem cell (HSC). Listed Implementation Scheme 99. The method according to listed implementation scheme 97, wherein the cell is an induced pluripotent stem cell (iPSC). Example 100. The method according to example 94 or example 95, wherein the cell is an immune cell. Example 101. The method according to example 100, wherein the immune cells are leukocytes or lymphocytes. Example 102. The method according to example 101, wherein the immune cell is a lymphocyte. Example 103. The method according to example 102, wherein the lymphocytes are T cells, B cells or NK cells. Example 104. The method according to example 103, wherein the lymphocytes are T cells. Example 105. The method described according to example 104, wherein the T cells are primary T cells. Example 106. The method described according to example 104, wherein the T cells are regulatory T cells. 107. The method according to any one of the listed embodiments 103-106, wherein the lymphocytes are activated T cells. 108. The method according to any one of the listed embodiments 103-106, wherein the lymphocytes are inactive T cells. 109. The method according to any one of the listed embodiments 73 to 108, wherein the cell is a human cell. Example 110. The method according to any one of Examples 73 to 109, wherein the DNA cutting agent is selected from zinc finger nucleases, TALE effector domain nucleases (TALENs), CRISPR / Cas nuclease components, and combinations thereof. Example 111. The method according to example 110, wherein the DNA cutting agent is a CRISPR / Cas nuclease component. Example 112. The method according to example 111, wherein the CRISPR / Cas nuclease component comprises a Cas nuclease or mRNA encoding the Cas nuclease. Example 113. The method according to example 112, wherein the CRISPR / Cas nuclease component comprises mRNA encoding the Cas nuclease. Scheme 114. The method according to Scheme 112 or Scheme 113, wherein the Cas nuclease is a type II Cas nuclease. 115. The method according to 112 or 113, wherein the Cas nuclease is a type 2 V Cas nuclease. Example 116. The method according to example 114, wherein the Cas nuclease is a Cas9 nuclease. Example 117. The method according to example 116, wherein the Cas nuclease is Streptococcus pyogenes Cas9 nuclease. Example 118. The method according to example 115, wherein the Cas nuclease is a Cas12a nuclease. 119. The method according to any one of the listed embodiments 73 to 118, the method further comprising contacting the cell with modified RNA. The method according to any one of the listed embodiments 73-119, further comprising contacting the cell with the guide RNA nucleic acid. Example 121. The method according to example 120, wherein the guide RNA nucleic acid is gRNA. Example 122. The method according to example 120 or example 121, wherein the guide RNA nucleic acid is or encodes a dual guide RNA (dgRNA). Example 123. The method according to example 120 or example 121, wherein the guide RNA nucleic acid is or encodes a single guide RNA (sgRNA). 124. The method according to any one of the listed embodiments 121-123, wherein the gRNA is a modified gRNA. Example 125. The method according to example 124, wherein the modified gRNA contains a modification at one or more nucleotides in the first five nucleotides of the 5' end. Example 126. The method according to example 124 or example 125, wherein the modified gRNA contains a modification at one or more nucleotides of the last five nucleotides at the 3' end. Example 127. The method according to any one of Examples 120-126, wherein the DNA cleavage agent is a type II Cas nuclease or a type V Cas nuclease mRNA; and the ratio of the guide RNA nucleic acid to the Cas nuclease is about 4:1 to 1:4 in molar ratio. 128. The method according to any one of the listed embodiments 73-127, the method further comprising contacting the cell with donor DNA. Example 129. The method according to example 128, the method comprising contacting the cell with a vector containing the donor DNA. Example 130. The method according to example 128 or example 129, wherein the donor DNA comprises a template, the template comprising a sequence encoding a protein, a regulatory sequence or a sequence encoding a structural RNA. Example 131. The method according to example 130, wherein the template sequence is integrated into the genome of the cell via homology-directed repair (HDR). 132. The method according to any one of the listed embodiments 73-131, the method further comprising contacting the cells with a carrier. Example 133. The method according to example 132, wherein the vector encodes the DNA cleavage agent. Example 134. The method according to example 132 or example 133, wherein the vector encodes donor DNA. 135. The method according to any one of the listed embodiments 132-134, wherein the vector is a viral vector. Scheme 136. The method according to any one of the listed schemes 132 to 134, wherein the vector is a non-viral vector. Example 137. The method according to example 135, wherein the carrier is AAV. Example 138. The method according to any one of Examples 73 to 137, wherein the DNA cleaving agent interacts with a target sequence within the genome of the cell, resulting in double-stranded DNA breaks (DSBs). Scheme 139. The method according to any one of the listed schemes 73 to 138, wherein the method results in gene knockout. 140. The method according to any one of the listed embodiments 73-139, wherein the method results in gene correction. The method of any one of the listed embodiments 73 to 140, wherein the method results in gene insertion. 142. The method according to any one of the listed embodiments 130-141, wherein the donor DNA comprises a template, the template comprising a foreign nucleic acid encoding a protein. Example 143. The method according to example 142, wherein the protein is selected from cytokines, immunosuppressants, antibodies, receptors and enzymes. Example 144. The method according to example 143, wherein the protein is a receptor. Example 145. The method according to example 143 or example 144, wherein the receptor is selected from immune receptors, T-cell receptors (TCRs) and chimeric antigen receptors. Example 146. The method according to example 145, wherein the receptor is an immune receptor. Example 147. The method according to example 145, wherein the receptor is a TCR. Example 148. The method according to example 142, wherein the exogenous nucleic acid encodes a TCR α chain and / or a TCR β chain. Example 149. The method according to example 145, wherein the receptor is a chimeric antigen receptor. Example 150. The method according to any one of examples 130-149, wherein the DNA cleaving agent interacts with a target sequence within the TRAC gene of the T cell. Example 151. The method according to example 150, the method comprising contacting the cell with at least two different DNA cutting agents targeting different gene loci. Scheme 152. The method according to any one of the listed embodiments 142-151, wherein the template comprises a first homologous arm and a second homologous arm that are complementary to sequences located upstream and downstream of the cleavage site, respectively.

Claims

1. A compound of formula I: (I)， Or its pharmaceutically acceptable salt, stereoisomer, solvate, prodrug, or tautomer. in: A is arbitrarily defined by one or more R. 3 Substituted 6- to 8-membered cycloalkyl groups; X 1 Is it N or CR? 4 ; X 2 It is O, S, CH-OH, NH or N (C1-C4 alkyl); R 1 It is H or a 6- to 8-membered heterocyclic alkyl or heteroaryl group containing at least one heteroatom selected from N and O, wherein the heterocyclic alkyl or heteroaryl group is optionally surrounded by one or more R groups. 5 replace; R 2 It is H, -COO (C1-C4 alkyl), -C(O)O- (aryl or heteroaryl), or a heteroaryl group containing at least one heteroatom selected from N, O, and S, wherein the aryl or heteroaryl group is optionally surrounded by one or more R atoms. 6 replace; Each R 3 Independently selected from halogens, C1-C4 alkyl groups, and C1-C4 alkoxy groups; R 4 Selected from -CN, halogen, C1-C4 alkyl, C1-C4 alkoxy, CO (C1-C4 alkyl) and CHO; Each R 5 Independently selected from halogens and C1-C4 alkyl groups; and Each R 6 Independently selected from hydrogen, halogen, -CN, C1-C4 alkyl, C1-C4 haloalkyl, C1-C4 alkoxy, C1-C4 haloalkoxy, CONH (C1-C4 alkyl), COO (C1-C4 alkyl), COO (C3-C8 cycloalkyl), and NH2; or two R atoms connected to adjacent atoms of the heteroaryl ring. 6 The group forms a fused 5- or 6-membered ring containing 0-3 heteroatoms selected from O, N, and S.

2. The compound according to claim 1, wherein R 2 yes Where X 3 X 4 X 5 and X 6 Each of them is independently selected from N and C(R) 6 ), where X 3 X 4 X 5 and X 6 At least one of them is C(R) 6 ).

3. The compound according to claim 1, wherein R 2 yes Where X 3 X 4 X 5 and X 6 Each of these elements is independently selected from N, NH, O, S, and C(R). 6 ), where X 3 X 4 X 5 and X 6 At most one of them is O or S.

4. The compound according to claim 1, wherein A is selected from: , , , , , , , , and , Where p is 0, 1, 2 or 3.

5. The compound according to claim 1, wherein R 1 Selected from: , , , , , , , , , , , , , , , , and , Where n is 0, 1, 2 or 3.

6. The compound according to claim 1, wherein R 2 Selected from: , , , , , , , , , , , , , , , , and , Where m is 0, 1, 2 or 3.

7. The compound according to any one of the preceding claims, wherein the compound has the formula (Ia-1), (Ia-2), (Ia-3), or (Ia-4): (Ia-1), (Ia-2), (Ia-3), or (Ia-4), Or a pharmaceutically acceptable salt, stereoisomer, solvate, prodrug, or tautomer thereof.

8. The compound according to any one of the preceding claims, wherein the compound has the formula (Ib-1), (Ib-2), (Ib-3), (Ib-4), (Ib-5), or (Ib-6): (Ib-1), (Ib-2), (Ib-3), (Ib-4), (Ib-5), or (Ib-6), or its pharmaceutically acceptable salt, stereoisomer, solvate, prodrug, or tautomer.

9. The compound according to any one of the preceding claims, wherein the compound is selected from: 、 、 、 、 、 、 、 、 、 、 、 、 、 、 、 、 、 、 、 、 、 、 、 、 、 、 、 、 、 、 、 、 、 、 、 、 、 、 、 、 、 、 、 、 、 、 、 、 、 、 、 、 、 、 、 、 、 、 、 、 、 、 、 、 、 、 、 、 、 、 , , , , , , , , , , , , , , , , and , Or a pharmaceutically acceptable salt, stereoisomer, solvate, prodrug, or tautomer thereof.

10. The compound according to any one of the preceding claims, wherein the compound is selected from: , , , , , , , , , , , , , , , , , , , , and , Or a pharmaceutically acceptable salt, stereoisomer, solvate, prodrug, or tautomer thereof.

11. A composition comprising: a) DNA protein kinase inhibitors (DNA-PKI); and b) DNA cutting agent; The DNA-PKI mentioned therein is a compound according to any one of claims 1-10.

12. The composition according to claim 11, wherein the composition further comprises cells.

13. The composition according to claim 11 or 12, wherein the composition further comprises donor DNA.

14. The composition according to any one of claims 11-13, wherein the DNA cutting agent comprises a CRISPR / Cas nuclease component and optionally a guide RNA component.

15. The composition according to any one of claims 11-14, wherein the composition further comprises a carrier.

16. The composition according to any one of claims 11-15, wherein the composition further comprises an inhibitor of the microhomology-mediated terminal junction (MMEJ) pathway.

17. A method for performing targeted genome editing in cells, the method comprising contacting the cells with a DNA cutting agent and a DNA-PKI, wherein the DNA-PKI is a compound according to any one of claims 1-10.

18. A method for repairing double-stranded DNA breaks in a cell genome, the method comprising contacting the cell with a DNA cutting agent and a DNA-PKI, wherein the DNA-PKI is a compound according to any one of claims 1-10.

19. A method for inhibiting or blocking the repair of DNA breaks in cells via the non-homologous end joining (NHEJ) pathway, the method comprising contacting the cells with a DNA cutting agent and a DNA-PKI, wherein the DNA-PKI is a compound according to any one of claims 1-10.

20. A method for targeted insertion of donor DNA into the genome of a cell, the method comprising contacting the cell with a DNA cutting agent, the donor DNA, and a DNA-PKI, wherein the DNA-PKI is a compound according to any one of claims 1-10.

Images