Microglial p2y6r target inhibitors and uses thereof

Abstract

The present application relates to a kind of microglial cell P2Y6R target point inhibitor and its application, belong to biological medicine technical field.For the problems such as lack of effective treatment means for retinal pigment degeneration, abnormal activation of microglial cell accelerates course and lack of specific intervention target point, the application of inhibitor with P2Y6R as target point in preparation treatment retinal pigment degeneration drug is proposed, especially siRNA and shRNA for knocking down microglial cell P2ry6 gene are provided, and AAV vector containing microglial cell specific promoter is constructed, the specific silencing of P2ry6 in retina is realized.The present application can significantly inhibit abnormal activation of microglial cell and inflammatory response, reduce photoreceptor apoptosis, improve retina structure and visual function, and provide a new strategy for targeted treatment of retinal pigment degeneration.

Description

Technical Field

[0001] This invention belongs to the field of biomedical technology and relates to microglia P2Y6R target inhibitors and their applications. Background Technology

[0002] Blinding eye diseases have become the third leading cause of death and blindness in China, after cancer and cardiovascular disease. my country has the largest blind population in the world, making research on blinding eye diseases a significant economic and social need. Retinitis Pigmentosa (RP) is a difficult-to-treat, severe, hereditary blinding eye disease, causing nearly 200,000 cases of blindness in my country each year. Its common pathological change is the degeneration and death of retinal photoreceptors. The etiology of RP is complex, involving multiple gene mutations, and currently there is no effective treatment. Traditional research focuses on the gene mutations themselves, but single-gene therapy cannot cover all subtypes. Therefore, revealing the common downstream pathological mechanisms among different genetic subtypes has become a key direction for overcoming treatment bottlenecks.

[0003] Metabolic regulation, as a key hub in gene-environment interactions, may be a common pathological node across genetic heterogeneity. Studies have shown significant metabolic interactions among retinal cells. When photoreceptors degenerate due to genetic factors, it triggers a series of metabolic disorders, exacerbating photoreceptor damage. Furthermore, alterations in metabolic pathways, including glycolysis and nucleotide metabolism, may be crucial for maintaining photoreceptor survival and function; however, the dynamics of these changes and the molecular mechanisms driving degeneration remain unclear. Therefore, a comprehensive understanding of retinal metabolic abnormalities in the course of retinopathy of prematurity (RP) provides important clues to understanding how metabolic disorders participate in photoreceptor degeneration and offers new directions for screening intervention targets.

[0004] Microglia, as innate immune cells of the retina, maintain retinal microenvironment homeostasis. During the development of retinal degeneration, abnormal microglia activation can accelerate degeneration by phagocytizing surviving photoreceptors and releasing inflammatory factors. Inflammatory activation of microglia can promote the development of various neurodegenerative diseases, including retinopathy of prematurity (RP), so inhibiting microglia activation is beneficial for improving the progression of neurodegenerative diseases. Recent studies have shown that the interaction between the immune microenvironment and metabolic networks is an important mechanism in neurodegenerative diseases, but it has not been fully explored in RP. Under stress or injury, neurons release large amounts of nucleotides and nucleosides, triggering microglia activation, migration, and neuroinflammation via the nucleotide-P2 receptor pathway, leading to retinal degeneration. The mechanism by which abnormal metabolic environment in the retina regulates microglia function and mediates retinal degeneration is a potential target for drug intervention.

[0005] Previous studies have shown that abnormal microglial activation can exacerbate retinopathy of retinopathy (RP) progression by releasing inflammatory factors and phagocytizing healthy photoreceptors, while microglial clearance (using the CSF1R inhibitor PLX3397) can delay retinal degeneration. However, this only demonstrates that microglial activation is a downstream effect of RP progression, without elucidating the upstream signaling mechanisms driving its abnormal activation. Furthermore, no molecular targets that specifically regulate microglial phenotype have been identified, and systemic microglial clearance may disrupt its synaptic pruning and neuroprotective functions, thus limiting its clinical translation. Summary of the Invention

[0006] In view of this, the purpose of the present invention is to provide a microglial P2Y6R target inhibitor and its application.

[0007] To achieve the above objectives, the present invention provides the following technical solution: This invention provides a microglia P2Y6R target inhibitor, wherein the microglia P2Y6R target inhibitor is siRNA, and the sense strand nucleic acid sequence of the siRNA is shown in SEQ ID NO:1, and the antisense strand nucleic acid sequence is shown in SEQ ID NO:2; This invention provides a microglia P2Y6R target inhibitor, wherein the inhibitor is shRNA, and the nucleic acid sequence of the shRNA is shown in SEQ ID NO:13; Furthermore, the present invention provides a cell, characterized in that: the cell contains siRNA or shRNA of the microglia P2Y6R target inhibitor; Furthermore, the present invention provides a viral vector containing nucleic acid encoding siRNA or shRNA that is an inhibitor of the microglia P2Y6R target. Furthermore, the present invention provides a pharmaceutical composition for inhibiting the expression of the P2Y6R gene in microglia, the pharmaceutical composition comprising the microglia P2Y6R target inhibitor siRNA or shRNA and a pharmaceutically acceptable carrier. Furthermore, this invention provides a method for inhibiting the expression of the P2Y6R gene in microglia. The microglia P2Y6R target inhibitor siRNA or shRNA is introduced into target cells, and the introduction method is selected from any one of viral vector-mediated introduction, liposome transfection, electroporation or microinjection. Preferably, the cells are microglia of humans or non-human animals; Furthermore, the application of the microglia P2Y6R target inhibitor in the preparation of drugs that inhibit microglia P2Y6R gene expression.

[0008] Preferably, the microglia P2Y6R target inhibitor is used in the preparation of drugs for the prevention and / or treatment of retinitis pigmentosa-related diseases.

[0009] The beneficial effects of this invention are as follows: This invention reveals for the first time the upstream metabolic-immune signaling axis of abnormal microglial activation in RP: the metabolite uridine accumulates significantly in the retina of the RP model (rd10 mouse), and induces pro-inflammatory polarization and abnormal phagocytosis of surviving photoreceptors by activating the microglial purinergic receptor P2Y6R. Targeted inhibition of P2Y6R can reverse the above pathological process.

[0010] 1) This invention provides the application of substances targeting P2Y6R in the preparation of products for treating retinitis pigmentosa. At the same time, this invention has found through research that P2Y6R is upregulated in the retinal tissue of the rd10 mouse model of retinitis pigmentosa (abnormally high uridine accumulation), and is mainly expressed in microglia.

[0011] 2) This invention demonstrates through cell experiments that knocking down P2ry6 in BV2 microglia can alleviate the activation of BV2 cells caused by uridine treatment and reduce the expression of inflammatory factors.

[0012] 3) Animal experiments of this invention show that in vivo targeted knockout of microglia P2ry6 cells can significantly alleviate the retinal degeneration process in rd10 mice. By normalizing the function of microglia, reversing pro-inflammatory and abnormal phagocytic phenotypes, visual function can be improved and retinal structure can be salvaged.

[0013] Other advantages, objectives, and features of the invention will be set forth in part in the description which follows, and in part will be apparent to those skilled in the art from the following examination, or may be learned from practice of the invention. The objectives and other advantages of the invention can be realized and obtained through the following description. Attached Figure Description

[0014] To make the objectives, technical solutions, and advantages of the present invention clearer, the preferred embodiments of the present invention will be described in detail below with reference to the accompanying drawings, wherein: Figure 1 Hierarchical clustering heatmap of total differential metabolites between the rd10 group and the C57 group at three time points (P18, P25, P45); Figure 2A schematic diagram of the results of uridine-responsive microglia-mediated photoreceptor apoptosis in C57BL / 6J mice. (A) are representative images of retinal sections from the control group and the uridine-treated group, stained with Iba1 immunostaining (A1-A5, red), and cell nuclei stained with DAPI (blue). (B) is the total number of microglia in all retinal layers. (CE) is a quantitative analysis of the number of microglia in different retinal layers. Figure 3 The apoptotic trend of photoreceptors after intravitreal injection of uridine in normal C57 mice is shown. (A) is a representative image of TUNEL staining in retinal tissue (red = TUNEL, blue = DAPI). Figure 4 for P2ry6 Differential expression results in the retinas of rd10 mice and C57 mice injected intravitreal with uridine. Heatmaps (A, B) show differentially expressed genes (DEGs) of the P2Y receptor in the retinal transcriptome analysis of rd10 and C57 mice at p23 (A) and p40 (B). (C) shows the changes in P2ry6 gene expression in the retinas of uridine-treated and control mice at various observation time points analyzed by RT-qPCR. (D) is a UMAP plot of single-cell RNA-seq datasets from the retina of C57 and rd10 strain mice, colored according to labeled cell type. (E) shows… P2ry6 The expression levels of genes in the UMAP space, (F) represents the expression levels of genes in different cell types. P2ry6 A bubble plot of expression levels, where (G) represents the expression levels in each cell type. P2ry6 A violin illustration representing a level of skill; Figure 5 To investigate the mRNA levels of pro-inflammatory factors, phagocytic markers, and P2Y6R in BV2 cells after treatment with uridine alone or in combination with siRNA targeting P2Y6R, (AE) RT-qPCR was used to detect the mRNA levels of P2ry6, pro-inflammatory cytokines (Tnf-α, Il-6, Il-1β), and microglial activation marker (Cd68) in BV2 cells treated with increasing concentrations of uridine (0, 2, 4, 8 mM). (FJ) BV2 cells were transfected with siRNA-NC (si-NC) or siRNA-P2ry6 (si-P2ry6) and cultured in complete medium for 24 hours, followed by treatment with control medium (Ctrl) or uridine (Uri) for 24 hours. RT-qPCR was then used to detect the mRNA levels of P2ry6, Tnf-α, Il-6, Il-1β, and Cd68 in BV2 cells. Figure 6To demonstrate the specificity and knockdown efficiency of AAV-shRNA-targeted knockdown of retinal microglia in rd10 mice, (A) is a representative immunofluorescence image showing the co-localization of EGFP (green) and the specific microglia marker Iba1 (red) in the retina of rd10 mice after intravitreal injection of AAV; (B) is the quantitative analysis of the co-localization of EGFP and Iba1 in the retina of rd10 mice that received intravitreal injection of AAV-shCtrl or AAV-shP2ry6; (C) is the RT-qPCR analysis of P2ry6 expression in the retina of rd10 mice that received intravitreal injection of AAV-shCtrl or AAV-shP2ry6; and (D) is a representative confocal image of a retinal section from P28 rd10 mice. Figure 7 To demonstrate the results of resuscitation of retinal degeneration after AAV-shRNA-targeted knockdown of retinal microglia in rd10 mice, (A) shows representative dark-adapted electroretinograms (ERGs) of rd10 mice after intravitreal injection of AAV-shCtrl or AAV-shP2ry6. (B) shows the amplitudes of waves a and b in rd10 mice that received intravitreal injection of AAV-shCtrl or AAV-shP2ry6. (C) shows the measurement of ONL thickness under different AAV treatments. (D, E) show representative images of Iba1 (cyan, D) and TUNEL (red, E) immunofluorescence staining obtained by confocal microscopy. (F) shows the quantitative analysis of the total number of microglia in all retinal layers and the number of TUNEL-positive cells in the outer retinal layer (ONL). Figure 8 The image shows the interference vector pAAV-Cx3cr1 promoter-EGFP-3xFLAG-WPRE used in the experiment. Detailed Implementation

[0015] The following specific examples illustrate the implementation of the present invention. Those skilled in the art can easily understand other advantages and effects of the present invention from the content disclosed in this specification. The present invention can also be implemented or applied through other different specific embodiments, and various details in this specification can be modified or changed based on different viewpoints and applications without departing from the spirit of the present invention. It should be noted that the illustrations provided in the following embodiments are only schematic representations of the basic concept of the present invention. Unless otherwise specified, the following embodiments and features can be combined with each other.

[0016] The accompanying drawings are for illustrative purposes only and are schematic diagrams, not actual pictures. They should not be construed as limiting the invention. To better illustrate the embodiments of the invention, some parts in the drawings may be omitted, enlarged, or reduced, and do not represent the actual product dimensions. It is understandable to those skilled in the art that some well-known structures and their descriptions may be omitted in the drawings.

[0017] In the accompanying drawings of the embodiments of the present invention, the same or similar reference numerals correspond to the same or similar components. In the description of the present invention, it should be understood that if terms such as "upper," "lower," "left," "right," "front," and "rear" indicate the orientation or positional relationship based on the orientation or positional relationship shown in the drawings, they are only for the convenience of describing the present invention and simplifying the description, and do not indicate or imply that the device or element referred to must have a specific orientation, or be constructed and operated in a specific orientation. Therefore, the terms used to describe positional relationships in the drawings are only for illustrative purposes and should not be construed as limiting the present invention. For those skilled in the art, the specific meaning of the above terms can be understood according to the specific circumstances.

[0018] Example 1 In this embodiment, BV2 cells were treated with uridine alone or in combination with siRNA targeting P2Y6R. Real-time quantitative PCR analysis showed that uridine treatment significantly upregulated the transcriptional levels of pro-inflammatory factors, phagocytic markers (CD68), and P2Y6R in BV2 cells in a concentration-dependent manner. Figure 5 BV2 cells were transfected with either non-silencing control siRNA (si-NC) or P2ry6 siRNA (si-P2ry6) for 24 hours, followed by treatment with control medium (Ctrl) or uridine (Uri) for 24 hours, respectively. Results showed that si-P2ry6 transfection significantly reduced P2ry6 mRNA levels. Figure 5 F). In uridine-activated BV2 cells, knockdown of P2ry6 significantly reduced key pro-inflammatory cytokines (F). Figure 5 GI) and phagocytosis-related genes ( Figure 5 mRNA expression of J).

[0019] in, The sequence of P2ry6 siRNA (si-P2ry6) is as follows: S: 5' CAUUGCCCAGAUCUGCGCATT 3' (SEQ ID NO:1); AS: 5' UGCGCAGAUCUGGGCAAUGTT 3' (SEQ ID NO:2); The sequence of the non-silencing control siRNA (si-NC) is as follows: S: 5' UUCUCCGAACGUGUCACGUTT 3' (SEQ ID NO:3); AS: 5' ACGUGACACGUUCGGAGAATT 3' (SEQ ID NO:4); Tnf-α The specific primer sequences for mRNA level detection are as follows: F: 5' AGCCCACGTCGTAGCAAACCAC 3' (SEQ ID NO:5); R: 5' AGGTACAACCCATCGGCTGGCA 3' (SEQ ID NO:6); Il-6 The specific primer sequences for mRNA level detection are as follows: F: 5' TAGTCCTTCCTACCCCAATTTCC 3' (SEQ ID NO:7); R: 5' TTGGTCCTTAGCCACTCCTTC 3' (SEQ ID NO:8); Il-1β The specific primer sequences for mRNA level detection are as follows: F: 5' AGAGCATCCAGCTTCAAATC 3' (SEQ ID NO:9); R: 5' ATCATCCCATGAGTCACAGA 3' (SEQ ID NO:10); Cd68 The specific primer sequences for mRNA level detection are as follows: F: 5' CCATCCTTCACGATGACACCT 3' (SEQ ID NO:11); R: 5' GGCAGGGTTATGAGTGACAGTT 3' (SEQ ID NO:12).

[0020] Example 2 Adeno-associated viruses (AAVs) specifically targeting microglia were constructed using an experimental AAV vector plasmid: pAAV-Cx3cr1 promoter-EGFP-miR30-shRNA. P2ry6 -WPRE (AAV-shP2ry6), this plasmid encodes a target P2ry6 The short hairpin RNA (shRNA) nucleic acid sequence is shown in SEQ ID NO:13; and the pAAV-Cx3cr1 promoter-EGFP-miR30-shRNA(NC)-WPRE (AAV-shCtrl), which encodes a non-targeted control shRNA, has the nucleic acid sequence shown in SEQ ID NO:14. These plasmids contain a Cx3cr1 promoter to drive the specific expression of enhanced green fluorescent protein (EGFP) in microglia and embed miR30 shRNA to promote efficient RNA interference. Furthermore, the presence of the WPRE element enhances transcription efficiency. To enhance transduction efficiency in central nervous system (CNS) microglia (including the retina), both vector plasmids were packaged with an MG1.2 serotype capsid. The final titer assay showed that AAV-shCtrl was 8.17 × 10⁻⁶. 12 Vector genome / mL (vg / mL), AAV-shP2ry6 is 1.64 × 10⁻⁶. 13 vg / mL.

[0021] The vector used was pAAV-Cx3cr1 promoter-EGFP-3xFLAG-WPRE ( Figure 8 ).

[0022] The target sequence of shP2ry6 is as follows: CACTGAACATCTGCGTCATTG The target sequence of shNC is: GAAGTCGTGAGAAGTAGAA To verify the therapeutic potential of P2Y6R in retinal degeneration, we first injected rd10 mice at P7 days of age with intravitreal injections of cells carrying targeted microglia. P2ry6The specific adeno-associated virus (AAV) (AAV-shP2ry6) was used. Litterctomy mice received intravitreal injections of AAV expressing control shRNA (AAV-shCtrl) as a control. Three weeks after AAV injection, we analyzed the expression of EGFP and the microglia-specific marker Iba1 in the retinas of AAV-injected mice. In the retina, most microglia were observed to be labeled with the green fluorescence of EGFP (…). Figure 6 A). EGFP + Iba1 + Quantitative analysis of cells showed that both AAV-shCtrl and AAV-shP2ry6 exhibited high specificity for microglia. Figure 6 B). Furthermore, RT-qPCR analysis confirmed... P2ry6 It was effectively knocked down in the retinal tissue of rd10 mice. Figure 6 C). Compared with the AAV-shCtrl control group, rd10 mice treated with AAV-shP2ry6 showed a significant increase in the amplitude of both the a-wave and b-wave (C). Figure 7 A, B). In addition... P2ry6 After knockdown, the ONL thickness in rd10 mice was significantly restored. The ONL thickness in the AAV-shP2ry6 treatment group was significantly higher than that in the AAV-shCtrl treatment group. Figure 7 C). This indicates that AAV-shP2ry6 not only preserved the retinal structure of rd10 mice but also promoted its functional recovery. Compared with the control group, AAV-shP2ry6 rd10 mice showed a significant reduction in the number of microglia and a decrease in photoreceptor apoptosis. Figure 7 DF).

[0023] Example 3 This embodiment uses rd10 mice with retinal degeneration ( Pde6β The rd10 mutation was used as an animal model of retinitis pigmentosa (RP). To capture dynamic retinal metabolic changes associated with degenerative changes, a comprehensive non-targeted metabolomics analysis was performed on the retinas of rd10 mice and age-matched wild-type (WT) C57BL / 6J mice at three key pathological stages (early stage of retinal degeneration P18, peak of active degeneration P25, and near-complete terminal stage of degeneration P45). The results showed that uridine was the most dynamically changing major metabolite in the retinal degeneration process of rd10 mice. Figure 1 ).

[0024] 1. Intravitreal injection of uridine into normal C57 mice revealed that microglia were activated, leading to photoreceptor death and subsequent retinal degeneration.

[0025] Uridine was dissolved in PBS. Five-week-old C57BL / 6J mice were injected intravitreally in one eye with 2 μL of a 100 mM uridine solution. As a control, the contralateral eye was injected intravitreally with 2 μL of sterile PBS. Mice were sacrificed by cervical dislocation on days 1, 4, 7, and 14 following intravitreal injection of uridine or PBS. Eyeballs were harvested for subsequent experimental analysis.

[0026] We investigated the effect of uridine on retinal microglial cell activation. Following intravitreal injection of uridine, we observed a significant increase in microglial reactivity, with the number peaking on day 7 and then gradually declining. Figure 2 A1-5, B). This trend is consistent with photoreceptor apoptosis after treatment (A1-5, B). Figure 3 A). Following uridine injection, microglia actively infiltrate the damaged retinal area. Figure 2 (A1-5, CE). The strong temporal overlap between microglia activation and photoreceptor apoptosis suggests that microglia play a role in mediating photoreceptor death.

[0027] 2. Detection of retinal P2Y6R markers in rd10 mice and C57 mice injected intravitreal with uridine revealed elevated levels, primarily expressed on microglia. To investigate the molecular mechanism by which uridine induces microglial cell activation, this study performed a transcriptome analysis of the retina of rd10 mice. The analysis showed that during retinal degeneration, the P2Y receptor gene (especially...) is involved. P2ry2 , P2ry6 and P2ry13 ) showed a significant upward adjustment ( Figure 4 (A, B). Consistent with the results of the rd10 mouse study, we observed that uridine treatment in the retinas of C57 mice... P2ry6 The expression level was significantly increased at all time points. Figure 4 C). This trend is consistent with the microglial cell activation process ( Figure 2 B) suggests that the uridine-P2Y6R axis may be involved in the microglial cell activation process.

[0028] To investigate the characteristics of P2Y6R-positive microglia that may respond to uridine, we analyzed published scRNA-seq results (GSE183206) of single-cell RNA sequencing of the retina of rd10 and C57 mice at p21 days of age. Cell type annotation was performed using established marker genes. Figure 4 D), scRNA-seq showed that P2Y6R was mainly expressed in microglial cell clusters ( Figure 4 DG).

[0029] in, P2ry6 The specific primer sequences for mRNA level detection are as follows: F: 5' TGCTGCCCTTCATAGCCTTAC 3' (SEQ ID NO:15); R: 5' AGCCATACGAGCCGCCTTGC 3' (SEQ ID NO:16).

[0030] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention and are not intended to limit it. Although the present invention has been described in detail with reference to preferred embodiments, those skilled in the art should understand that modifications or equivalent substitutions can be made to the technical solutions of the present invention without departing from the spirit and scope of the present invention, and all such modifications or substitutions should be covered within the scope of the claims of the present invention.

Claims

1. A microglia P2Y6R target inhibitor, characterized in that: The microglia P2Y6R target inhibitor is siRNA, and the sense strand nucleic acid sequence of the siRNA is shown in SEQ ID NO:1, and the antisense strand nucleic acid sequence is shown in SEQ ID NO:

2.

2. A microglia P2Y6R target inhibitor, characterized in that: The microglia P2Y6R target inhibitor is shRNA, and the nucleic acid sequence of the shRNA is shown in SEQ ID NO:

13.

3. A cell, characterized in that: The cells contain the microglia P2Y6R target inhibitor as described in claim 1 or 2.

4. A viral vector, characterized in that: The viral vector contains nucleic acid encoding the microglia P2Y6R target inhibitor as described in claim 1 or 2.

5. A pharmaceutical composition for inhibiting the expression of the P2Y6R gene in microglia, characterized in that: The pharmaceutical composition comprises the microglia P2Y6R target inhibitor of claim 1 or 2 and a pharmaceutically acceptable carrier.

6. A method for inhibiting the expression of the P2Y6R gene in microglia, characterized in that: The microglia P2Y6R target inhibitor of claim 1 or 2 is introduced into target cells, wherein the introduction method is selected from any one of viral vector-mediated introduction, liposome transfection, electroporation or microinjection.

7. The method according to claim 6, characterized in that: The cells are microglia of humans or non-human animals.

8. The use of the microglia P2Y6R target inhibitor according to claim 1 or 2 in the preparation of a drug for inhibiting microglia P2Y6R gene expression.

9. The use of the microglia P2Y6R target inhibitor according to claim 1 or 2 in the preparation of a medicament for the prevention and / or treatment of retinitis pigmentosa-related diseases.

Images