Anti-tetanus toxin neutralizing antibodies and uses thereof

By developing a fully human anti-tetanus toxin neutralizing antibody, the problems of adverse reactions and high costs of existing preparations have been solved, providing a safe and effective passive tetanus immunization agent that is suitable for a wide range of people and can be industrially produced.

CN122103330APending Publication Date: 2026-05-29SINOVAC RES & DEV CO LTD
View PDF 1 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
SINOVAC RES & DEV CO LTD
Filing Date
2024-11-19
Publication Date
2026-05-29

AI Technical Summary

Technical Problem

Existing passive tetanus immunization agents, such as tetanus antitoxin and human tetanus immunoglobulin, have adverse reactions, high costs, and risks of exogenous viral contamination, making it difficult to meet the needs of all populations.

Method used

A fully human anti-tetanus toxin neutralizing antibody has been developed, which has high affinity and high specificity, avoids the adverse reactions of animal-derived monoclonal antibodies, and can be prepared in large quantities in mammalian cells.

Benefits of technology

This invention provides a safer and lower-cost passive tetanus immunization agent with high affinity and high specificity, avoiding adverse reactions, suitable for a wide range of people, and industrially producible.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure BDA0005299321610000061
    Figure BDA0005299321610000061
  • Figure BDA0005299321610000071
    Figure BDA0005299321610000071
  • Figure BDA0005299321610000081
    Figure BDA0005299321610000081
Patent Text Reader

Abstract

The present disclosure provides an anti-tetanus toxin neutralizing antibody as a new generation of tetanus passive immunization preparation. The antibody can be fully human, which can specifically bind to full-length tetanus toxin and its AB fragment, has high affinity, high specificity, small toxic side effects, avoids the problems of large adverse reactions and short half-life of animal-derived monoclonal antibodies, and is prepared in large quantities by mammalian cells, and has clear and stable components.
Need to check novelty before this filing date? Find Prior Art

Description

[0001] This application is a divisional application of Chinese patent application filed on November 19, 2024, with application number 202411649086.0 and invention title "Antitetracycline Toxin Neutralizing Antibody and Its Application". Technical Field

[0002] This disclosure pertains to the fields of immunology and genetic engineering, specifically relating to anti-tetanus toxin neutralizing antibodies and their applications. Background Technology

[0003] Tetanus is a potentially fatal disease caused by Clostridium tetani, a bacterial infection. Clostridium tetani is widespread in the natural environment. It enters the body through breaks in the skin or mucous membranes, multiplies in an anaerobic environment, and produces exotoxins, causing an acute, toxic disease characterized by persistent, tonic contractions and paroxysmal spasms of skeletal muscles throughout the body. Severe cases can lead to laryngospasm, asphyxia, lung infection, and organ failure. Without medical intervention, the mortality rate for severely ill patients is close to 100%, and even with aggressive comprehensive treatment, the global mortality rate remains between 30% and 50%.

[0004] Currently, the main passive immunization agents used clinically for the prevention and treatment of tetanus include tetanus antitoxin (TAT), equine tetanus immunoglobulin F(ab')2, and human tetanus immunoglobulin (HTIG). However, these passive immunization agents have significant drawbacks: due to differences in individual constitution and tolerance to equine serum TAT, many people experience adverse reactions such as allergic reactions, anaphylactic shock, or serum sickness. Therefore, equine serum TAT is not suitable for everyone. HTIG can overcome the adverse reactions associated with the clinical use of equine serum TAT, but due to the difficulty and high cost of obtaining human blood, as well as the risk of exogenous viral contamination, the industrial production and clinical application of HTIG are greatly limited. There is an urgent clinical need for a tetanus passive immunization agent that is safer, lower in cost, and can be industrially produced. Summary of the Invention

[0005] To address at least one of the above-mentioned problems, this disclosure provides an anti-tetanus toxin neutralizing antibody and its application. The neutralizing antibody provided by this disclosure has the advantages of high affinity, high specificity, and low toxicity, while avoiding the drawbacks of large adverse reactions associated with animal-derived monoclonal antibodies.

[0006] According to one aspect of this disclosure, a tetanus toxin neutralizing antibody or an antigen-binding fragment thereof is provided, the antibody or antigen-binding fragment comprising: (1) three heavy chain variable region complementarity-determining regions (HCDRs): HCDR1 having the amino acid sequence of HCDR1 contained in the heavy chain variable region as shown in any one of SEQ ID NO: 6, 13, 20, 27, 34, or having an amino acid sequence with one or more amino acid substitutions, deletions, or additions compared to the amino acid sequence of HCDR1 contained in the heavy chain variable region; HCDR2 having the amino acid sequence of HCDR2 contained in the heavy chain variable region as shown in any one of SEQ ID NO: 6, 13, 20, 27, 34, or having an amino acid sequence with one or more amino acid substitutions, deletions, or additions compared to the amino acid sequence of HCDR2 contained in the heavy chain variable region; HCDR3 having the amino acid sequence of HCDR1 contained in the heavy chain variable region as shown in ...; HCDR3 having the amino acid sequence of HCDR1 contained in the heavy chain variable region as shown in SEQ ID NO: 6, 13, 20, 27, 34; HCDR2 having the amino acid sequence of HCDR1 contained in the heavy chain variable region; HCDR3 having an amino acid sequence with one or more amino acid substitutions, deletions, or additions compared to the amino acid sequence of HCDR2 contained in the heavy chain variable region; HCDR3 having an amino acid sequence with one or more amino acid substitutions, deletion The amino acid sequence of HCDR3 contained in the heavy chain variable region as shown in any one of SEQ ID NO: 6, 13, 20, 27, 34, or an amino acid sequence having one or more amino acid substitutions, deletions, or additions compared to the amino acid sequence of HCDR3 contained in the heavy chain variable region; and / or (2) the following three light chain variable region complementarity-determining regions (LCDRs): LCDR1, having the amino acid sequence of LCDR1 contained in the light chain variable region as shown in any one of SEQ ID NO: 7, 14, 21, 28, 35, or an amino acid sequence having one or more amino acid substitutions, deletions, or additions compared to the amino acid sequence of LCDR1 contained in the light chain variable region; LCDR2, having the amino acid sequence of LCDR2 contained in the light chain variable region as shown in any one of SEQ ID NO: 7, 14, 21, 28, 35, or an amino acid sequence having one or more amino acid substitutions, deletions, or additions compared to the amino acid sequence of LCDR2 contained in the light chain variable region; LCDR3, having the amino acid sequence of LCDR2 contained in the light chain variable region as shown in SEQ ID NO: 6, 13, 20, 27, 34 ... The amino acid sequence of LCDR3 contained in the light chain variable region shown in any one of NO:7, 14, 21, 28, 35, or an amino acid sequence having one or more amino acid substitutions, deletions, or additions compared to the amino acid sequence of LCDR3 contained in the light chain variable region.

[0007] In some implementations, each CDR is defined by any numbering system commonly used by those skilled in the art. Exemplary numbering systems include, but are not limited to, Kabat, AbM, Chothia, Contact, IMGT, or combinations thereof.

[0008] In some embodiments, the antibody or its antigen-binding fragment comprises: three HCDRs contained in the heavy chain variable region as shown in SEQ ID NO:6, or an amino acid sequence having one or more amino acid substitutions, deletions, or additions compared to the amino acid sequence of the three HCDRs contained in the heavy chain variable region, or an amino acid sequence having at least 80%, 85%, 88%, 90%, 92%, 95%, 97%, 98%, or 99% sequence identity with them; and three LCDRs contained in the light chain variable region as shown in SEQ ID NO:7, or an amino acid sequence having one or more amino acid substitutions, deletions, or additions compared to the amino acid sequence of the three LCDRs contained in the light chain variable region, or an amino acid sequence having at least 80%, 85%, 88%, 90%, 92%, 95%, 97%, 98%, or 99% sequence identity with them.

[0009] In some embodiments, the antibody or its antigen-binding fragment comprises: three HCDRs contained in the heavy chain variable region as shown in SEQ ID NO:13, or an amino acid sequence having one or more amino acid substitutions, deletions, or additions compared to the amino acid sequence of the three HCDRs contained in the heavy chain variable region, or an amino acid sequence having at least 80%, 85%, 88%, 90%, 92%, 95%, 97%, 98%, or 99% sequence identity with them; and three LCDRs contained in the light chain variable region as shown in SEQ ID NO:14, or an amino acid sequence having one or more amino acid substitutions, deletions, or additions compared to the amino acid sequence of the three LCDRs contained in the light chain variable region, or an amino acid sequence having at least 80%, 85%, 88%, 90%, 92%, 95%, 97%, 98%, or 99% sequence identity with them.

[0010] In some embodiments, the antibody or its antigen-binding fragment comprises: three HCDRs contained in the heavy chain variable region as shown in SEQ ID NO:20, or an amino acid sequence having one or more amino acid substitutions, deletions, or additions compared to the amino acid sequence of the three HCDRs contained in the heavy chain variable region, or an amino acid sequence having at least 80%, 85%, 88%, 90%, 92%, 95%, 97%, 98%, or 99% sequence identity with them; and three LCDRs contained in the light chain variable region as shown in SEQ ID NO:21, or an amino acid sequence having one or more amino acid substitutions, deletions, or additions compared to the amino acid sequence of the three LCDRs contained in the light chain variable region, or an amino acid sequence having at least 80%, 85%, 88%, 90%, 92%, 95%, 97%, 98%, or 99% sequence identity with them.

[0011] In some embodiments, the antibody or its antigen-binding fragment comprises: three HCDRs contained in the heavy chain variable region as shown in SEQ ID NO:27, or an amino acid sequence having one or more amino acid substitutions, deletions, or additions compared to the amino acid sequence of the three HCDRs contained in the heavy chain variable region, or an amino acid sequence having at least 80%, 85%, 88%, 90%, 92%, 95%, 97%, 98%, or 99% sequence identity with them; and three LCDRs contained in the light chain variable region as shown in SEQ ID NO:28, or an amino acid sequence having one or more amino acid substitutions, deletions, or additions compared to the amino acid sequence of the three LCDRs contained in the light chain variable region, or an amino acid sequence having at least 80%, 85%, 88%, 90%, 92%, 95%, 97%, 98%, or 99% sequence identity with them.

[0012] In some embodiments, the antibody or its antigen-binding fragment comprises: three HCDRs contained in the heavy chain variable region as shown in SEQ ID NO:34, or an amino acid sequence having one or more amino acid substitutions, deletions, or additions compared to the amino acid sequence of the three HCDRs contained in the heavy chain variable region, or an amino acid sequence having at least 80%, 85%, 88%, 90%, 92%, 95%, 97%, 98%, or 99% sequence identity with them; and three LCDRs contained in the light chain variable region as shown in SEQ ID NO:35, or an amino acid sequence having one or more amino acid substitutions, deletions, or additions compared to the amino acid sequence of the three LCDRs contained in the light chain variable region, or an amino acid sequence having at least 80%, 85%, 88%, 90%, 92%, 95%, 97%, 98%, or 99% sequence identity with them.

[0013] In some embodiments, the antibody or its antigen-binding fragment comprises: (1) the following three heavy chain variable region complementarity-determining regions (HCDRs): HCDR1 having an amino acid sequence as shown in general formula (1), such as X1X2X3X4X5X6X7X8YX9X 10 As shown, X1 is selected from G, X2 is selected from F or G, X3 is selected from S or T, X4 is selected from F, I or M, X5 is selected from G, S or T, X6 is selected from T, S or D, X7 is selected from Q, D, Y or H, X8 is selected from S, D, Y or R, X9 does not exist or is selected from Y, X 10 It is absent or selected from Y;HCDR2, which has an amino acid sequence as shown in general formula (2), such as X1IX2X3YX4GX5X6X7X8YX9X 10 X 11As shown, X1 is selected from I, X2 is selected from S, H or F, X3 is selected from SYH, X4 is selected from TLS, X5 is selected from S, E or G, X6 is selected from S or T, X7 is selected from Y, T or R, X8 does not exist or is selected from G or I, X9 does not exist or is selected from T, X 10 Does not exist or selected from I, X 11 It is absent or selected from I; HCDR3, which has an amino acid sequence as shown in general formula (3), such as X1X2X3X4X5X6X7X8X9X 10 X 11 X 12 X13X 14 X 15 X 16 X 17 X 18 X 19 X 20 X 21 X 22 X 23 As shown, X1 is selected from A or T, X2 is selected from T or R, X3 is selected from LGFT, X4 is selected from P, S, Y, I or N, X5 is selected from G, T or Y, X6 is selected from G, V, D, L or N, X7 is selected from F, H, S, D or W, X8 is selected from I, P, F, K or does not exist, X9 is selected from T, W, A or does not exist, X 10 Selected from F, L, G or not present, X 11 Selected from F, D, R or not present, X 12 Selected from G, L, W or not present, X 13 Selected from E, F, or not present, X 14 Selected from V or not present, X 15 Selected from L or not present, X 16 Selected from P or not present, X 17 Selected from R or not present, X 18 Selected from L, G, or not present, X 19 Selected from G, P, or not present, X 20 Selected from W or not present, X 21 Selected from L or not present, X 22 Selected from D or not present, X 23 Selected from P or not present; and / or, (2) the following three light chain variable region complementarity-determining regions (LCDRs): LCDR1, having an amino acid sequence as shown in general formula (4), such as X1X2X3X4X5X6X7X8X9X 10 X 11 LX 12As shown, X1 is selected from Q, X2 is selected from S, E, or T, X3 is selected from I or V, X4 is selected from S, T, V, or L, X5 is selected from K, N, R, S, or H, X6 is selected from Y, F, N, or S, X7 is selected from Y, S, or does not exist, X8 is selected from D, X9 is selected from N, or does not exist, X 10 Selected from K or not present, X 11 Selected from N or not present, X 12 Selected from Y or not present; LCDR2, having an amino acid sequence as shown in general formula (5), such as X1X2X3, wherein X1 is selected from E, H, A, G or W, X2 is selected from T or A, and X3 is selected from S; LCDR3, having an amino acid sequence as shown in general formula (6), such as X1X2X3YX4X5SX6X7X8TX9X 10 X 11 As shown, X1 is selected from Q or H, X2 is selected from Q, X3 is selected from N, Y or G, X4 is selected from F, D, L or Y, X5 is selected from S, T or F, X6 is selected from P, L, V, S or T, X7 is selected from P, H or R, X8 is selected from R, L, H, T or Y, and X9 is selected from T or does not exist.

[0014] In these implementations, HCDR1-3 and LCDR1-3 are defined by the IMGT system.

[0015] In some embodiments, the antibody or its antigen-binding fragment comprises: HCDR1 having an amino acid sequence as shown in any one of SEQ ID NO: 1, 8, 15, 22 or 29, an amino acid sequence having one or more amino acid substitutions, deletions or additions compared to the antibody, or an amino acid sequence having at least 80%, 85%, 88%, 90%, 92%, 95%, 97%, 98%, or 99% sequence identity; and / or, HCDR2 having an amino acid sequence as shown in any one of SEQ ID NO: 2, 9, 16, 23 or 30, an amino acid sequence having one or more amino acid substitutions, deletions or additions compared to the HCDR2, or an amino acid sequence having at least 80%, 85%, 88%, 90%, 92%, 95%, 97%, 98%, or 99% sequence identity; and / or, HCDR3 having an amino acid sequence as shown in SEQ ID NO: 1, 8, 15, 22 or 29 ... The amino acid sequence shown in any one of SEQ ID NO:3, 10, 17, 24, or 31, an amino acid sequence having one or more amino acid substitutions, deletions, or additions compared to it, or an amino acid sequence having at least 80%, 85%, 88%, 90%, 92%, 95%, 97%, 98%, or 99% sequence identity with it; and / or, LCDR1, which has the amino acid sequence shown in any one of SEQ ID NO:4, 11, 18, 25, or 32, an amino acid sequence having one or more amino acid substitutions, deletions, or additions compared to it, or an amino acid sequence having at least 80%, 85%, 88%, 90%, 92%, 95%, 97%, 98%, or 99% sequence identity with it; and / or, LCDR2, which has the amino acid sequence shown in SEQ ID NO:3, 10, 17, 24, or 31, an amino acid sequence having one or more amino acid substitutions, deletions, or additions compared to it, or an amino acid sequence having at least 80%, 85%, 88%, 90%, 92%, 95%, 97%, 98%, or 99% sequence identity with it; and / or, LCDR2, which has the amino acid sequence shown in SEQ ID NO:3, 10, 17, 24, or 32 ... NO: An amino acid sequence represented by any one of ETS, HAS, AAS, GAS, or WAS, or an amino acid sequence having at least 80%, 85%, 88%, 90%, 92%, 95%, 97%, 98%, or 99% of the amino acid sequence having one amino acid substitution, deletion, or addition compared to it; and / or LCDR3, which has an amino acid sequence represented by any one of 5, 12, 19, 26, or 33, an amino acid sequence having one or more amino acid substitutions, deletions, or additions compared to it, or an amino acid sequence having at least 80%, 85%, 88%, 90%, 92%, 95%, 97%, 98%, or 99% sequence identity with it.

[0016] In some embodiments, the antibody or its antigen-binding fragment comprises: HCDR1, HCDR2, and HCDR3 as shown in SEQ ID NO:1, SEQ ID NO:2, and SEQ ID NO:3, or amino acid sequences having one or more amino acid substitutions, deletions, or additions compared to the amino acid sequences of HCDR1, HCDR2, and HCDR3, or amino acid sequences having at least 80%, 85%, 88%, 90%, 92%, 95%, 97%, 98%, or 99% sequence identity with them, and / or LCDR1, LCDR2, and LCDR3 as shown in SEQ ID NO:4, with amino acid sequences of ETS, and SEQ ID NO:5, or amino acid sequences having one or more amino acid substitutions, deletions, or additions compared to the amino acid sequences of LCDR1, LCDR2, and LCDR3, or amino acid sequences having at least 80%, 85%, 88%, 90%, 92%, 95%, 97%, 98%, or 99% sequence identity with them.

[0017] In some embodiments, the antibody or its antigen-binding fragment comprises: HCDR1, HCDR2, and HCDR3 as shown in SEQ ID NO:8, SEQ ID NO:9, and SEQ ID NO:10, or amino acid sequences having one or more amino acid substitutions, deletions, or additions compared to the amino acid sequences of HCDR1, HCDR2, and HCDR3, or amino acid sequences having at least 80%, 85%, 88%, 90%, 92%, 95%, 97%, 98%, or 99% sequence identity with them, and / or LCDR1, LCDR2, and LCDR3 as shown in SEQ ID NO:11, with amino acid sequences of HAS, and SEQ ID NO:12, or amino acid sequences having one or more amino acid substitutions, deletions, or additions compared to the amino acid sequences of LCDR1, LCDR2, and LCDR3, or amino acid sequences having at least 80%, 85%, 88%, 90%, 92%, 95%, 97%, 98%, or 99% sequence identity with them.

[0018] In some embodiments, the antibody or its antigen-binding fragment comprises: HCDR1, HCDR2, and HCDR3 as shown in SEQ ID NO:15, SEQ ID NO:16, and SEQ ID NO:17, or amino acid sequences having one or more amino acid substitutions, deletions, or additions compared to the amino acid sequences of HCDR1, HCDR2, and HCDR3, or amino acid sequences having at least 80%, 85%, 88%, 90%, 92%, 95%, 97%, 98%, or 99% sequence identity with them, and / or LCDR1, LCDR2, and LCDR3 as shown in SEQ ID NO:18, with amino acid sequences AAS, and SEQ ID NO:19, or amino acid sequences having one or more amino acid substitutions, deletions, or additions compared to the amino acid sequences of LCDR1, LCDR2, and LCDR3, or amino acid sequences having at least 80%, 85%, 88%, 90%, 92%, 95%, 97%, 98%, or 99% sequence identity with them.

[0019] In some embodiments, the antibody or its antigen-binding fragment comprises: HCDR1, HCDR2, and HCDR3 as shown in SEQ ID NO:22, SEQ ID NO:23, and SEQ ID NO:24, or amino acid sequences having one or more amino acid substitutions, deletions, or additions compared to the amino acid sequences of HCDR1, HCDR2, and HCDR3, or amino acid sequences having at least 80%, 85%, 88%, 90%, 92%, 95%, 97%, 98%, or 99% sequence identity with them, and / or LCDR1, LCDR2, and LCDR3 as shown in SEQ ID NO:25, with amino acid sequences GAS, and SEQ ID NO:26, or amino acid sequences having one or more amino acid substitutions, deletions, or additions compared to the amino acid sequences of LCDR1, LCDR2, and LCDR3, or amino acid sequences having at least 80%, 85%, 88%, 90%, 92%, 95%, 97%, 98%, or 99% sequence identity with them.

[0020] In some embodiments, the antibody or its antigen-binding fragment comprises: HCDR1, HCDR2, and HCDR3 as shown in SEQ ID NO:29, SEQ ID NO:30, and SEQ ID NO:31, or amino acid sequences having one or more amino acid substitutions, deletions, or additions compared to the amino acid sequences of HCDR1, HCDR2, and HCDR3, or amino acid sequences having at least 80%, 85%, 88%, 90%, 92%, 95%, 97%, 98%, or 99% sequence identity with them; and / or LCDR1, LCDR2, and LCDR3 as shown in SEQ ID NO:32, with amino acid sequences of WAS, and SEQ ID NO:33, or amino acid sequences having one or more amino acid substitutions, deletions, or additions compared to the amino acid sequences of LCDR1, LCDR2, and LCDR3, or amino acid sequences having at least 80%, 85%, 88%, 90%, 92%, 95%, 97%, 98%, or 99% sequence identity with them.

[0021] In some embodiments, the antibody or its antigen-binding fragment comprises: a heavy chain variable region comprising an amino acid sequence as shown in SEQ ID NO: 6, 13, 20, 27, 34, an amino acid sequence having one or more amino acid substitutions, deletions, or additions compared to the heavy chain, or an amino acid sequence having at least 80%, 85%, 88%, 90%, 92%, 95%, 97%, 98%, or 99% sequence identity with the heavy chain variable region; and / or a light chain variable region comprising an amino acid sequence as shown in SEQ ID NO: 7, 14, 21, 28, 35, an amino acid sequence having one or more amino acid substitutions, deletions, or additions compared to the light chain variable region, or an amino acid sequence having at least 80%, 85%, 88%, 90%, 92%, 95%, 97%, 98%, or 99% sequence identity with the light chain variable region.

[0022] In some embodiments, the antibody or its antigen-binding fragment comprises: a heavy chain variable region comprising an amino acid sequence as shown in SEQ ID NO: 6, an amino acid sequence having one or more amino acid substitutions, deletions, or additions compared to the heavy chain, or an amino acid sequence having at least 80%, 85%, 88%, 90%, 92%, 95%, 97%, 98%, or 99% sequence identity with the heavy chain variable region; and a light chain variable region comprising an amino acid sequence as shown in SEQ ID NO: 7, an amino acid sequence having one or more amino acid substitutions, deletions, or additions compared to the light chain variable region, or an amino acid sequence having at least 80%, 85%, 88%, 90%, 92%, 95%, 97%, 98%, or 99% sequence identity with the light chain variable region.

[0023] In some embodiments, the antibody or its antigen-binding fragment comprises: a heavy chain variable region comprising an amino acid sequence as shown in SEQ ID NO: 13, an amino acid sequence having one or more amino acid substitutions, deletions, or additions compared to the heavy chain, or an amino acid sequence having at least 80%, 85%, 88%, 90%, 92%, 95%, 97%, 98%, or 99% sequence identity with the heavy chain variable region; and a light chain variable region comprising an amino acid sequence as shown in SEQ ID NO: 14, an amino acid sequence having one or more amino acid substitutions, deletions, or additions compared to the light chain variable region, or an amino acid sequence having at least 80%, 85%, 88%, 90%, 92%, 95%, 97%, 98%, or 99% sequence identity with the light chain variable region.

[0024] In some embodiments, the antibody or its antigen-binding fragment comprises: a heavy chain variable region comprising an amino acid sequence as shown in SEQ ID NO: 20, an amino acid sequence having one or more amino acid substitutions, deletions, or additions compared to the heavy chain, or an amino acid sequence having at least 80%, 85%, 88%, 90%, 92%, 95%, 97%, 98%, or 99% sequence identity with the heavy chain variable region; and a light chain variable region comprising an amino acid sequence as shown in SEQ ID NO: 21, an amino acid sequence having one or more amino acid substitutions, deletions, or additions compared to the light chain variable region, or an amino acid sequence having at least 80%, 85%, 88%, 90%, 92%, 95%, 97%, 98%, or 99% sequence identity with the light chain variable region.

[0025] In some embodiments, the antibody or its antigen-binding fragment comprises: a heavy chain variable region comprising an amino acid sequence as shown in SEQ ID NO: 27, an amino acid sequence having one or more amino acid substitutions, deletions, or additions compared to the heavy chain, or an amino acid sequence having at least 80%, 85%, 88%, 90%, 92%, 95%, 97%, 98%, or 99% sequence identity with the heavy chain variable region; and a light chain variable region comprising an amino acid sequence as shown in SEQ ID NO: 28, an amino acid sequence having one or more amino acid substitutions, deletions, or additions compared to the light chain variable region, or an amino acid sequence having at least 80%, 85%, 88%, 90%, 92%, 95%, 97%, 98%, or 99% sequence identity with the light chain variable region.

[0026] In some embodiments, the antibody or its antigen-binding fragment comprises: a heavy chain variable region comprising an amino acid sequence as shown in SEQ ID NO: 34, an amino acid sequence having one or more amino acid substitutions, deletions, or additions compared to the heavy chain, or an amino acid sequence having at least 80%, 85%, 88%, 90%, 92%, 95%, 97%, 98%, or 99% sequence identity with the heavy chain variable region; and a light chain variable region comprising an amino acid sequence as shown in SEQ ID NO: 35, an amino acid sequence having one or more amino acid substitutions, deletions, or additions compared to the light chain variable region, or an amino acid sequence having at least 80%, 85%, 88%, 90%, 92%, 95%, 97%, 98%, or 99% sequence identity with the light chain variable region.

[0027] In some embodiments, the antibody or antigen-binding fragment may be, but is not limited to, IgA, IgD, IgE, IgG, or IgM.

[0028] In some embodiments, the light chain of the antibody or antigen-binding fragment includes a κ light chain or a λ light chain.

[0029] In some embodiments, the antibody or antigen-binding fragment may be of the IgG type, such as IgG1, IgG2, IgG3 or IgG4.

[0030] In some embodiments, the antibody or antigen-binding fragment includes, but is not limited to, scFv, Fab, Fab', (Fab')2, Fv fragment, dsFv, linear antibody, bispecific antibody, and multispecific antibody;

[0031] In some embodiments, the antibody or antigen-binding fragment includes, but is not limited to, murine antibodies, chimeric antibodies, humanized antibodies, or fully human antibodies.

[0032] According to another aspect of this disclosure, a nucleic acid molecule is provided that encodes the antibody or an antigen-binding fragment thereof.

[0033] In some embodiments, the nucleic acid molecule has a nucleotide sequence as shown in SEQ ID NO: 36 or a nucleotide sequence having at least 65%, 70%, 75%, 80%, 85%, 88%, 90%, 92%, 95%, 97%, 98%, or 99% sequence identity with it, and / or a nucleotide sequence as shown in SEQ ID NO: 37 or a nucleotide sequence having at least 65%, 70%, 75%, 80%, 85%, 88%, 90%, 92%, 95%, 97%, 98%, or 99% sequence identity with it.

[0034] In some embodiments, the nucleic acid molecule has a nucleotide sequence as shown in SEQ ID NO: 38 or a nucleotide sequence having at least 65%, 70%, 75%, 80%, 85%, 88%, 90%, 92%, 95%, 97%, 98%, or 99% sequence identity with it, and / or a nucleotide sequence as shown in SEQ ID NO: 39 or a nucleotide sequence having at least 65%, 70%, 75%, 80%, 85%, 88%, 90%, 92%, 95%, 97%, 98%, or 99% sequence identity with it.

[0035] In some embodiments, the nucleic acid molecule has a nucleotide sequence as shown in SEQ ID NO: 40 or a nucleotide sequence having at least 65%, 70%, 75%, 80%, 85%, 88%, 90%, 92%, 95%, 97%, 98%, or 99% sequence identity with it, and / or a nucleotide sequence as shown in SEQ ID NO: 41 or a nucleotide sequence having at least 65%, 70%, 75%, 80%, 85%, 88%, 90%, 92%, 95%, 97%, 98%, or 99% sequence identity with it.

[0036] In some embodiments, the nucleic acid molecule has a nucleotide sequence as shown in SEQ ID NO: 42 or a nucleotide sequence having at least 65%, 70%, 75%, 80%, 85%, 88%, 90%, 92%, 95%, 97%, 98%, or 99% sequence identity with it, and / or a nucleotide sequence as shown in SEQ ID NO: 43 or a nucleotide sequence having at least 65%, 70%, 75%, 80%, 85%, 88%, 90%, 92%, 95%, 97%, 98%, or 99% sequence identity with it.

[0037] In some embodiments, the nucleic acid molecule has a nucleotide sequence as shown in SEQ ID NO: 44 or a nucleotide sequence having at least 65%, 70%, 75%, 80%, 85%, 88%, 90%, 92%, 95%, 97%, 98%, or 99% sequence identity with it, and / or a nucleotide sequence as shown in SEQ ID NO: 45 or a nucleotide sequence having at least 65%, 70%, 75%, 80%, 85%, 88%, 90%, 92%, 95%, 97%, 98%, or 99% sequence identity with it.

[0038] According to another aspect of this disclosure, an expression vector is provided that contains the nucleic acid molecule.

[0039] In some embodiments, the expression vector includes prokaryotic expression vectors and eukaryotic expression vectors.

[0040] In some embodiments, the eukaryotic expression vector includes yeast expression vectors, mammalian expression vectors, insect expression vectors, etc.

[0041] According to another aspect of this disclosure, a host cell is provided that contains the nucleic acid molecule and / or the expression vector.

[0042] In some embodiments, the host cell is selected from prokaryotic cells and eukaryotic cells.

[0043] In some embodiments, the prokaryotic cells include bacterial cells, Escherichia coli, and Streptomyces.

[0044] In some embodiments, the eukaryotic cells include yeast cells, mammalian cells, insect cells, etc.

[0045] In some embodiments, the mammal is selected from humans, monkeys, mice, rats, hamsters, goats, sheep, cattle, pigs, dogs, or cats.

[0046] In some embodiments, the mammalian cells include CHO cells, 293 cells, Vero cells, BHK cells, NSO cells, SP2 / 0 cells, YO myeloma cells, P3X63 mouse myeloma cells, PER cells, PER.C6 cells, or hybridoma cells.

[0047] According to another aspect of this disclosure, a chimeric antigen receptor is provided, comprising an extracellular antigen-binding domain, a transmembrane domain, and an intracellular signal transduction domain, wherein the extracellular antigen-binding domain comprises an antibody or an antigen-binding fragment thereof as described in this disclosure.

[0048] According to another aspect of this disclosure, an antibody-drug conjugate is provided, comprising: an antibody or an antigen-binding fragment thereof as described in this disclosure; and a drug covalently linked to the antibody or the antigen-binding fragment thereof. According to yet another aspect of this disclosure, a detection kit is provided, the kit comprising the antibody or the antigen-binding fragment thereof.

[0049] According to another aspect of this disclosure, a drug molecule is provided, the drug molecule comprising the antibody or an antigen-binding fragment thereof, the drug molecule being in the form of a chimeric antigen receptor, an antibody-drug conjugate, or a multispecific antibody containing the antibody or an antigen-binding fragment thereof.

[0050] According to another aspect of this disclosure, a composition is provided comprising the antibody or an antigen-binding fragment thereof, the nucleic acid molecule, or the pharmaceutical molecule.

[0051] In some embodiments, the composition further includes one or more other drugs.

[0052] In some embodiments, the drug includes drugs for the prevention and / or treatment of Clostridium tetani infection.

[0053] In some embodiments, the composition may be in the form of a chimeric antigen receptor, comprising an extracellular antigen-binding domain, a transmembrane domain, and an intracellular signal transduction domain, wherein the extracellular antigen-binding domain comprises the antibody or an antigen-binding fragment thereof as described in this disclosure.

[0054] In some embodiments, a modified immune cell is provided that includes the chimeric antigen receptor.

[0055] In some embodiments, the composition may be in the form of an antibody-drug conjugate comprising the antibody or an antigen-binding fragment thereof; and a drug covalently linked to the antibody or the antigen-binding fragment thereof.

[0056] In some embodiments, the composition may be in the form of a multispecific antibody, which is formed by coupling a first antibody or a fragment thereof with other antibodies or fragments thereof or antibody analogs, wherein the first antibody or a fragment thereof is the antibody or antigen-binding fragment thereof described in this disclosure.

[0057] In some embodiments, the multispecific antibody is a bispecific antibody, a trispecific antibody, or a tetraspecific antibody, and each antibody or its fragment or antibody analogue retains its original binding specificity.

[0058] In some embodiments, the composition further includes a pharmaceutically acceptable carrier and / or excipient.

[0059] According to another aspect of this disclosure, the use of the antibody or its antigen-binding fragment, the nucleic acid molecule, the expression vector, the host cell, the detection kit, the drug molecule, and / or the drug composition in the preparation of products for detecting, preventing, and / or treating Clostridium tetani infection is provided.

[0060] According to another aspect of this disclosure, a method for detecting tetanus toxin is provided, the method comprising the step of using the said antibody or an antigen-binding fragment thereof for detection.

[0061] According to another aspect of this disclosure, a method for preventing and / or treating Clostridium tetani infection is provided, comprising administering to a subject a therapeutically effective amount of the antibody or its antigen-binding fragment or the pharmaceutical composition.

[0062] Beneficial effects:

[0063] This disclosure provides a tetanus toxin neutralizing antibody as a next-generation passive tetanus immunization agent. The antibody can be fully human, possessing high affinity, high specificity, and low toxicity, while avoiding the problems of severe adverse reactions and short half-life associated with animal-derived monoclonal antibodies. Furthermore, it can be mass-produced using mammalian cells, resulting in a well-defined and stable composition. Based on clinical needs, the fully human tetanus toxin neutralizing antibody, as a next-generation passive tetanus immunization agent, has significant medical value. Attached Figure Description

[0064] Figure 1 The binding curves of the antibody to the full-length tetanus toxin and the AB fragment of tetanus toxin are shown.

[0065] Figure 2 The results of the mouse challenge protection experiment are shown. Detailed Implementation

[0066] Tetanus toxin (TeNT) is a neurotoxin with extremely high toxicity, second only to botulinum toxin (BoNT). This toxin has a special affinity for the central nervous system, preventing the release of inhibitory neurotransmitters from inhibitory synaptic terminals. This causes an imbalance between excitation and inhibition in muscle activity, resulting in simultaneous and strong contractions of extensor and flexor muscles, leading to muscle rigidity and spasms, and the characteristic symptoms of tetanus such as trismus and opisthotonus. TeNT is a polypeptide chain with a molecular weight of 150 kDa. After translation by bacterial or host proteases, it is cleaved into an active double-chain form linked by a single disulfide bond: a light chain (fragment A) and a heavy chain (fragments B and C), with molecular weights of 50 kDa and 100 kDa, respectively. Fragment A is a zinc metalloproteinase that cleaves the membrane proteins on nerve cell membranes that transmit neurotransmitters, inhibiting neurotransmitter release and ensuring continuous transmission of excitation. Fragment B encodes a translocation domain, mediating the entry of the active site of the toxin into the cell. Fragment C is a receptor-binding domain, enabling retrograde axonal transport into the central nervous system. Numerous studies have shown that antibodies targeting the AB fragment are highly likely to have neutralizing activity.

[0067] This disclosure describes the isolation of peripheral blood mononuclear cells (PBMCs) from the blood of volunteers who were immunized with commercially available tetanus vaccine and developed protective antibodies. Monoclonal antibodies that can specifically bind to the full length of tetanus toxin and its AB fragment were screened, and five candidate antibodies were further screened, the sequences of which are shown in Table 1.

[0068] Table 1. CDR and variable region sequences of the five antibodies

[0069]

[0070]

[0071]

[0072]

[0073] The fully human anti-tetanus toxin neutralizing antibodies disclosed herein can specifically bind to tetanus toxin, exhibiting strong neutralizing activity and high affinity. In mouse neutralization protection experiments, the anti-tetanus toxin neutralizing antibodies disclosed herein completely protect mice from tetanus toxin challenge. Furthermore, the anti-tetanus toxin neutralizing antibodies disclosed herein are free from allergen and exogenous viral contamination, demonstrating high safety and applicability to a wide range of populations.

[0074] definition

[0075] Unless otherwise defined, all technical and scientific terms used in this disclosure have the same meaning as commonly used in the field to which this disclosure pertains. For purposes of interpreting this specification, the following definitions will apply, and where appropriate, terms used in the singular will also include the plural form, and vice versa.

[0076] Unless the context clearly indicates otherwise, the terms “a” and “an” as used herein include plural references.

[0077] The term "about" as used herein is as understood by one of ordinary skill in the art and varies within a certain range depending on the context in which it is used. If one of ordinary skill in the art is unfamiliar with the use of this term in the context in which it is used, "about" will mean a particular value plus or minus 10%.

[0078] As used herein, the term "specific binding" refers to binding selectivity for an antigen, which can be distinguished from unwanted or nonspecific binding. The ability of an antigen-binding molecule to bind to a specific antigen can be measured by enzyme-linked immunosorbent assay (ELISA) or other techniques familiar to those skilled in the art, such as surface plasmon resonance (SPR) techniques and conventional binding assays.

[0079] As used herein, the term "affinity" or "binding affinity" refers to the strength of the non-covalent interaction between a single binding site of a molecule (e.g., an antibody) and its binding ligand (e.g., an antigen). Binding affinity is typically expressed as an affinity constant (KD), which is the ratio of the dissociation rate constant (kd) to the binding rate constant (ka). Therefore, equivalent affinity can include different rate constants, as long as the ratio of the rate constants remains the same. Affinity can be measured using conventional methods known in the art, such as surface plasmon resonance (SPR). In some embodiments, when using a tetanus toxin C fragment as the analyte and an antibody as the ligand, the antibody has an affinity of approximately less than 10... -6M, such as approximately less than 10 -7 M, 10 -8 M, 10 -9 M or 10 -10 M or even lower equilibrium dissociation constant (KD) binding, and the affinity to the predetermined antigen is at least twice that to nonspecific antigens (e.g., BSA, casein) other than the predetermined antigen or closely related antigens.

[0080] As used herein, the term "antibody" encompasses a wide range of antibody structures, including but not limited to monoclonal antibodies, polyclonal antibodies, monospecific and multispecific antibodies (e.g., bispecific or trispecific antibodies), single-chain molecules, and antibody fragments, as long as they exhibit the desired antigen-binding activity. Within the light and heavy chains of an antibody, variable and constant regions are linked by a "J" region of approximately 12 or more amino acids, and the heavy chain also contains a "D" region of approximately 3 or more amino acids. Each heavy chain consists of a heavy chain variable region (VH) and a heavy chain constant region (CH). The heavy chain constant region consists of three domains (CH1, CH2, and CH3). Each light chain consists of a light chain variable region (VL) and a light chain constant region (CL). The light chain constant region consists of one domain, CL. The constant regions of an antibody mediate the binding of immunoglobulins to host tissues or factors, including various cells of the immune system (e.g., effector cells) and the first component (C1q) of the classical complement system.

[0081] Unless otherwise stated, the terms "antibody active fragment," "antibody fragment," "target-binding fragment," and "antigen-binding fragment" are used interchangeably in the context of this invention and refer to antibody fragments that specifically bind to antigens, such as fragments that retain one or more CDR regions. Examples of antigen-binding fragments include, but are not limited to, Fab, Fab', F(ab')2, and Fv fragments; bispecific antibodies; linear antibodies; single-chain antibody molecules, such as single-chain Fv (ScFv); nanobodies and multispecific antibodies formed from antibody fragments.

[0082] As used herein, the term "variable region" or "variable domain" refers to a domain of the antibody heavy or light chain involved in the binding of an antigen-binding molecule to an antigen. The variable domains (VH and VL, respectively) of the heavy and light chains of natural antibodies typically have similar structures, with each domain containing four conserved frame regions (FRs) and three hypervariable regions (HVRs). A single VH or VL domain is sufficient to confer antigen-binding specificity. The term "variable" in this invention refers to the fact that certain segments of the variable domain are generally sequence-differentiated between antibodies. The V domain mediates antigen binding and defines the specificity of a particular antibody for its specific antigen. However, variability is not uniformly distributed throughout the variable domain. Instead, it is concentrated in three segments within the variable domains of both the light and heavy chains, called hypervariable regions (HVRs). The more highly conserved portions of the variable domain are called frame regions (FRs). The variable domains of the natural heavy and light chains each contain four FRs, mostly in a β-sheet configuration, linked by three HVRs that form loops and, in some cases, form part of a β-sheet structure. The HVRs in each chain are tightly held together by the FR regions and, together with the HVRs of other chains, contribute to the formation of the antibody's antigen-binding site. The constant domain does not directly participate in antibody-antigen binding but has other effector functions, such as participating in antibody-dependent cytotoxicity.

[0083] As used herein, the term "hypervariant region" or "HVR" refers to a region in the variable domain region of an antibody that is highly variable in sequence and / or forms a structurally defined loop ("hypervariant loop"). Typically, a natural tetrachain antibody contains six HVRs: three in the VH (H1, H2, H3) and three in the VL (L1, L2, L3). HVRs typically contain amino acid residues from the hypervariant loop and / or from the "complementarity-determining region (CDR)," which has the highest sequence variability and / or participates in antigen recognition. Those skilled in the art will understand that, unless otherwise specified, the "CDR" and "complementarity-determining region" of a given antibody or its regions (e.g., variable regions) should be understood to encompass "CDR" and "complementarity-determining region" as defined by any of the methods known in the art. It is well known to those skilled in the art that antibody CDRs can be defined using various methods, such as the Kabat definition rule based on sequence variability, the Chothia definition rule based on the location of structural loop regions, the Martin definition rule based on sequence and frame regions, the IMGT definition rule based on germline V gene amino acid sequence alignment, and reference tools for antibody humanization design based on CDR transplantation. Those skilled in the art should understand that, unless otherwise specified, the terms "CDR" and "complementarity-determining region" for a given antibody or its region (e.g., variable region) should be understood to encompass any of the known schemes described above, and the amino acid sequences corresponding to the defined CDR rules should also fall within the scope of protection of this invention.

[0084] As used in this article, the term "chimeric antibody" refers to an antibody that combines antibody fragments from different species. Specifically, for example, a monoclonal antibody from one species (e.g., mouse) whose Fc constant region is replaced by an Fc constant region from another species (e.g., human) via DNA recombination technology.

[0085] As used herein, the term "humanized antibody" refers to an antibody that contains the human immunoglobulin framework region and one or more core-residue junctions (CDRs) derived from non-human (e.g., mouse, rat, rabbit, or synthetic) immunoglobulins. Except for the CDRs, all other parts of a humanized antibody are substantially identical to the corresponding parts of the native human immunoglobulin sequence.

[0086] As used herein, the term "fully human antibody" is intended to include antibodies possessing variable and constant regions derived from human immunoglobulin sequences. As used herein, the term "fully human antibody" refers to an antibody whose protein molecule is virtually non-immunogenic in humans, with only minor sequence variations or alterations relative to human natural immunoglobulins, encompassing almost all parts of the protein molecule (e.g., CDR, FR, CL, HC domains (e.g., CH1, CH2, CH3), hinges, VL, VH). Therefore, fully human antibodies differ from chimeric or humanized antibodies. It should be noted that fully human antibodies can be produced by human cells, non-human animals, or prokaryotic or eukaryotic cells capable of expressing functionally rearranged human immunoglobulin (e.g., heavy chain and / or light chain) genes.

[0087] As used in this article, the term "nucleic acid molecule" refers to any one or more nucleic acid segments present in a polynucleotide, such as DNA or RNA fragments.

[0088] As used herein, "percentage homology," "% homology," or "% sequence identity" describes the degree of similarity between two nucleotide sequences or two amino acid sequences and has the same meaning as "percentage identity." The percentage homology of two sequences can be calculated by dividing the number of identical residue positions by the total length of the aligned sequences and then multiplying by 100%. Methods and tools for aligning two amino acid or nucleotide sequences are well known in the art, such as the BLAST kit available on the NCBI website. The phrase "at least 80% sequence identity" as used herein refers to having at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity with that sequence.

[0089] As used herein, the terms "vector" or "expression vector" and "expression construct" are used interchangeably. A vector is a DNA molecule to which a specific gene, operably linked, is introduced into a target cell and directed for expression. The vector includes a vector as a self-replicating nucleic acid structure and a vector incorporated into the genome of the host cell into which it has been introduced. The expression vector of the present invention comprises an expression cassette. The expression vector can perform transcription of a large amount of stable mRNA. Once the expression vector is in the target cell, the cellular transcription and / or translation mechanisms generate a ribonucleic acid molecule or protein encoded by the gene.

[0090] The term "host cell" as used herein is used interchangeably and refers to a cell in which exogenous nucleic acids have been introduced, including the progeny of such cells. Host cells include "transformants" and "transformed cells," including primary transformed cells and their derived progeny. The nucleic acids of the progeny may not be completely identical to those of the parent cells and may contain mutations. Host cells include cultured cells, such as cultured mammalian cells, such as CHO cells, 293 cells, Vero cells, BHK cells, NS0 cells, SP2 / 0 cells, YO myeloma cells, P3X63 mouse myeloma cells, PER cells, PER.C6 cells, or hybridoma cells, yeast cells, insect cells, and plant cells. The host cells disclosed herein also include cells contained within transgenic animals, transgenic plants, or cultured plant or animal tissues.

[0091] As used herein, the term "pharmaceutical composition" includes the monoclonal antibodies of this disclosure as well as pharmaceutically acceptable carriers. Pharmaceutical compositions can be in various oral or parenteral formulations. Pharmaceutical compositions are formulated using conventional diluents or excipients, including fillers, fillers, binders, wetting agents, disintegrants, and surfactants. Solid oral formulations include tablets, pills, powders, granules, capsules, etc. These solid formulations can be prepared by mixing at least one compound with one or more excipients, such as starch, calcium carbonate, sucrose, lactose, gelatin, etc. In addition to simple excipients, lubricants such as magnesium stearate or talc may also be used. Furthermore, liquid oral formulations include suspensions, solutions, emulsions, and syrups, etc. In addition to water and liquid paraffin, which are commonly used as simple diluents, various excipients may be included, such as wetting agents, sweeteners, flavorings, preservatives, etc. Parenteral formulations include sterile aqueous solutions, non-aqueous solvents, suspensions, emulsions, lyophilized formulations, suppositories, etc. Propylene glycol, polyethylene glycol, vegetable oils such as olive oil, and injectable esters such as ethyl oleate can be used as non-aqueous solvents and suspending agents. The main components of suppositories may include semi-synthetic fatty acid esters, polyethylene glycol, Tween 61, cocoa butter, lauryl acetate, glycerin gelatin, etc.

[0092] The pharmaceutical composition may have any one of the following formulations selected from the group consisting of: tablets, pills, powders, granules, capsules, suspensions, solutions, emulsions, syrups, sterile aqueous solutions, non-aqueous solutions, suspensions, emulsions, lyophilized formulations, and suppositories.

[0093] The pharmaceutical compositions of this disclosure can be administered in pharmaceutically effective amounts. "Pharmaceutically effective amount" refers to an amount sufficient to treat a disease and a reasonable benefit / risk ratio suitable for any medical treatment. The effective dose level of the composition can be determined based on the subject's type, disease severity, age and sex, drug activity, drug sensitivity, time of administration, route of administration, excretion rate, duration of treatment, drugs used in combination with the composition, and other known factors in the medical field. The pharmaceutical compositions of this disclosure can be used alone or in combination with other therapeutic agents, and can be administered sequentially or simultaneously with conventional therapeutic agents. The compositions can be administered in one or more dosage forms. Considering all the above factors, it is crucial to administer the composition at the minimum amount that will produce the maximum effect without causing side effects, which can be readily determined by those skilled in the art.

[0094] As used herein, the term "pharmaceutically acceptable carrier" refers to a carrier or diluent that does not cause significant irritation to an organism and does not eliminate the biological activity and properties of the applied compound. Pharmaceutically acceptable carriers that can be used to formulate the compositions of this disclosure into liquid solutions include physiological saline, sterile water, Ringer's solution, buffered salt solutions, glucose solutions, maltodextrin solutions, glycerol, ethanol, and mixtures of two or more of these. If desired, the compositions of this disclosure may also contain other conventional additives, such as antioxidants, buffers, and antibacterial agents. Furthermore, the compositions of this disclosure may also contain diluents, dispersants, surfactants, binders, and lubricants to formulate them into injectable formulations, such as aqueous solutions, suspensions and emulsions, pills, capsules, granules, and tablets.

[0095] As used herein, the term "treatment" for a subject's disease or "treatment" for a subject who has or is suspected of having a disease refers to administering medication to a subject, such as one or more agents, to reduce or prevent the exacerbation of at least one symptom of the disease. Therefore, in one embodiment, "treatment" specifically refers to delaying progression, accelerating remission, inducing remission, increasing remission, accelerating recovery, increasing the efficacy of alternative therapies, or reducing resistance to alternative therapies, or combinations thereof.

[0096] As used in this article, the terms "diagnosis" or "testing" include determining the presence of tetanus toxin in a subject or a sample to be tested. This corresponds to determining whether the subject or the subject from whom the sample was obtained is infected with Clostridium tetani.

[0097] The term "prevention" as used herein is recognized in the art and is well known in the art when used in connection with conditions such as local recurrence, and includes administration that reduces or delays the onset of medical symptoms in a subject relative to a subject who has not received the composition. The compositions of the present invention can be administered as food, such as a nutritional supplement. Generally, the compositions of the present invention are intended for the treatment of humans, although they can be used for the treatment of animals such as poultry, pigs, cats, dogs, horses, or rabbits. If administered to animals, oral feeding may be used.

[0098] The following embodiments and accompanying drawings are provided to aid in understanding this disclosure. However, it should be understood that these embodiments and drawings are for illustrative purposes only and do not constitute any limitation. The actual scope of protection of this disclosure is set forth in the claims. It should be noted that any modifications and improvements made by those skilled in the art based on this inventive concept are within the scope of protection of this disclosure. The reagents and / or kits used in the following embodiments are commercially available or can be synthesized by known methods.

[0099] Example

[0100] Example 1: Flow cytometry sorting of B cells and screening and purification of anti-tetanus toxin neutralizing antibodies

[0101] Includes the following steps:

[0102] 1. PBMC isolation and memory B cell sorting

[0103] Ten mL of venous blood was collected from volunteers who had been immunized with a commercially available tetanus vaccine (from Chengdu Oulin Biotechnology Co., Ltd.) and developed protective antibodies. The blood was placed in an anticoagulant tube containing sodium citrate. Peripheral blood mononuclear cells (PBMCs) were isolated from the 10 mL blood sample using Ficoll (sucrose). After counting the PBMCs, single antigen-specific memory B cells were sorted from the PBMCs using a SONY SH800 flow cytometer and transferred to 96-well PCR (Polymerase Chain Reaction) plates, ensuring each well contained one B cell. The 96-well plates containing B cells were stored at -80°C for later use.

[0104] 2. Single-cell PCR amplification of fully human monoclonal antibodies

[0105] 1) Reverse transcription PCR: Add all IgG1 subtype-specific primers targeting the heavy chain and κ light chain, along with Maxima H Minus reverse transcriptase (Thermo), to a 96-well PCR plate containing a single B cell. Reverse transcription is performed at 50°C for 30 min, followed by inactivation of the reverse transcriptase at 85°C for 5 min. The obtained cDNA product is then stored at -80°C.

[0106] 2) Nested PCR:

[0107] First round of reaction: Using 2 μL of cDNA product as a template, add hot-start ultra-high fidelity DNA polymerase for rapid PCR. FastPfu DNA polymerase (from TransGen Biotech), dNTPs, and nested PCR primers. Reaction conditions: pre-denaturation at 98℃ for 5 min, followed by 40 PCR cycles, each cycle being: 98℃ × 30 s, 55℃ (heavy chain V... H , κ light chain (Vκ)×1min, 72℃×1min, and finally extended at 72℃ for 5min.

[0108] Second round reaction: Using the PCR products from the first round reaction as a template, add hot-start ultra-high-fidelity DNA polymerase for rapid PCR. FastPfu DNA polymerase (from TransGen Biotech), dNTPs, and nested PCR primers. Reaction conditions: pre-denaturation at 98℃ for 5 min, followed by 35 PCR cycles, each cycle being: 98℃ × 30 s, 58℃ (heavy chain V) H ) / 60℃ (κ light chain Vκ)×1min, 72℃×1min, and finally extended at 72℃ for 5min to obtain nested PCR amplification products containing heavy chain and light chain variable region sequences.

[0109] The sequences of the IgG1 subtype-specific primers targeting the heavy chain and κ light chain, as well as the sequences of the nested PCR primers, can be found in Liao HX et al., High-throughput isolation of immunoglobulin genes from single human B cells and expression as monoclonal antibodies. J VirolMethods. 2009 Jun; 158(1-2):171-9.

[0110] 3) Agarose gel electrophoresis

[0111] 5 μL of nested PCR amplification product was detected by 1.5% agarose gel electrophoresis. Paired positive clones were sequenced to obtain the antibody variable region sequence, and a linear expression cassette was constructed based on this sequence.

[0112] 3. Constructing a linear expression cassette for recombinant antibodies to express antibodies.

[0113] Using the expression vector constructed with pcDNA3.4 as the backbone as a template, the enhancer sequence, promoter sequence and antibody leader peptide fragment were obtained by PCR amplification using CMV primer-F: GGCTTGACCGACAATTGCATGAAGAATC (SEQ ID NO: 46) and CMV primer-R: GGCCCTCACCCCAGTCAG (SEQ ID NO: 47).

[0114] Using heavy chain constant region primer-F:GTCAAGGACTACTTCCCCGAAC (SEQ ID NO: 48) and constant region primer-R:AGCCCTGGGCCTTCACCCGAACTTG (SEQ ID NO: 49) as primers, PCR amplification was performed to obtain the heavy chain constant region sequence, WPRE and Poly(A) fragment.

[0115] Using primers F (TGCCTCTGTTGTGTGCCTGC, SEQ ID NO: 50) and R (AGCCCTGGGCCTTCACCCGAACTTG, SEQ ID NO: 51) for the κ light chain constant region, PCR amplification was performed to obtain the κ light chain constant region sequence, WPRE, and Poly(A) fragments. All amplified fragments were purified using magnetic beads. Nested PCR amplification products containing the heavy and light chain variable region sequences were then used with the aforementioned expression elements (enhancer + promoter + leader peptide), constant regions (heavy chain, κ light chain), WPRE, and Poly(A) fragments to construct linear expression cassettes using overlap PCR. After completion, 5 μL of the linear expression cassette amplification product was analyzed by 1% agarose gel electrophoresis and sequenced to confirm the correct construction of the antibody linear expression cassette.

[0116] The correctly constructed and purified linear expression cassettes for the heavy and light chains were co-transfected into 293 cells using the PEI transfection reagent. Cells were incubated at 37°C for 72 h in a 5% CO2 incubator, and the cell supernatant was collected for analysis.

[0117] 4. ELISA screening for candidate antibodies with binding activity

[0118] Tetanus toxoid or tetanus AB fragment (Wuhan Huamei Biotechnology Co., Ltd.) was used as the antigen. The antigen was diluted to 2 μg / mL with coating buffer and coated onto 96-well ELISA plates. Each well contained 100 μL of overnight coating at 4°C. Blocking buffer was applied at 37°C for 2 h. The supernatant containing antibodies was collected and incubated with the primary antibody at 37°C for 1 h. Goat anti-human IgG-HRP (1:20000 dilution) was used as the secondary antibody and incubated at 37°C for 1 h. Substrate was added, and the plate was incubated at room temperature in the dark for 10 min. The reaction was stopped with 2M sulfuric acid, and the results were analyzed at 450 nm. The results showed that at least 100 monoclonal antibodies specifically bound to tetanus toxoid (full-length TT) or tetanus AB fragment.

[0119] 5. Expression plasmid construction and antibody preparation

[0120] After sequence alignment and elimination of repetitive and similar sequences, five candidate antibodies, Ab017, Ab024, Ab043, Ab051, and Ab095, were selected for further study. Their CDR and variable region sequences are shown in Table 1.

[0121] Expression plasmids were constructed for the five candidate antibodies, and antibody preparation was performed. The specific method is as follows: Using a One Step Seamless Cloning Mix kit (Novizan), the linear expression cassettes containing the heavy and light chains of the five antibodies (obtained in step 3 above) were amplified and then mixed with PCR-amplified H-3.4 and L-κ-3.4 (H-3.4 and L-κ-3.4 were synthesized by Bio-Tech Co., Ltd.)

[0122] The expression vector framework ligation and the amplification primers for the vector framework are as follows:

[0123] H-3.4-F: GGCCCTCACCCCAGTCAG (SEQ ID NO: 47), and heavy chain reverse primer 3.4-R: GTCAAGGACTACTTCCCCGAAC (SEQ ID NO: 48) (H-3.4 vector framework);

[0124] L-κ-3.4-F: GGCCCTCACCCCAGTCAG (SEQ ID NO: 47) and κ light chain reverse primer 3.4-R: TGCCTCTGTTGTGTGCCTGC (SEQ ID NO: 50) (L-κ-3.4 vector framework);

[0125] The amplification template vector sequences of H-3.4 and L-κ-3.4 are identical to the amplification template vector sequences (SEQ ID NO: 54 and SEQ ID NO: 55) in Chinese patent application No. 202411314277.1.

[0126] Take 5 μL of the vector framework and 1 μL of the linear expression cassette fragment, add 5 μL of 2× cloning premix ligase, and add water to a final volume of 10 μL. Reaction conditions: PCR at 50℃ for 15 min. After the reaction, cool the reaction mixture on ice and transform DH5α competent cells to obtain the expression plasmid. Add PEI transfection reagent to the plasmid DNA tube diluted with OPM-293CD05 medium, mix well, and incubate the complex at room temperature for 20 min, then culture at 37℃, 120 rpm, and 6% CO2 for 5-7 days. Centrifuge at 300g for 5 min to collect the supernatant, filter through a 0.2 μm filter, purify using protein A affinity, replace the collected antibody with PBS, and determine the antibody concentration.

[0127] Example 2: ELISA detection of antibody binding activity

[0128] 1. Experimental Procedure

[0129] Using tetanus toxoid or tetanus toxoid AB fragment as antigen, the antigen was diluted to 2 μg / mL with coating buffer and coated onto 96-well ELISA plates at a volume of 100 μL per well. Coating was carried out overnight at 2–8°C, followed by blocking with blocking buffer at 37°C for 2 h. The purified antibodies Ab017, Ab024, Ab043, Ab051, and Ab095 were serially diluted and added to the blocked ELISA plates as test samples. The plates were incubated at 37°C for 1 h, washed, and then incubated with goat anti-human IgG-HRP (1:20000 dilution) at 37°C for 1 h. After adding the substrate chromogenic solution, the plates were incubated at room temperature in the dark for 10 min. The reaction was stopped with 2M sulfuric acid, and the samples were detected and analyzed at wavelengths of 450 / 630 nm. The tetanus toxoid was obtained by Sinovac Biotech using Clostridium tetani CMCC 64008 through fermentation culture, purification and detoxification, and it has the same immunogenicity as tetanus toxin; the tetanus toxin AB fragment (GenBank: AAK72964.2) was synthesized and expressed by Wuhan Huamei Biotechnology Co., Ltd.

[0130] 2. Results

[0131] The results are as follows Figure 1 As shown, the purified antibody, when diluted to a concentration of approximately 0.0012 μg / mL, can still bind to tetanus toxoid or tetanus AB fragment. Therefore, all five candidate antibodies provided in this embodiment of the present disclosure have extremely strong binding activity.

[0132] Example 3: Affinity constant and affinity kinetics analysis of SPR-detected antibodies

[0133] 1. Capture method test

[0134] Antibody affinity assays were performed using the capture method. Using a Biacore T200 biomolecular interaction system, five antibodies (Ab017, Ab024, Ab043, Ab051, and Ab095) were diluted to a concentration of 2 μg / mL with 1×HBS-EP buffer (Biacore) and injected into the Protein A capture chip experimental channel (Fc2) (Biacore) at a flow rate of 10 μl / min. Capture was performed for 15 s to achieve a capture level of approximately 70 RU. The reference channel (Fc1) did not require ligand capture. Tetanus toxin analytes were sequentially passed through the chip at gradually increasing concentrations (0.977–125 nM for all antibodies except Ab024, which ranged from 0.0781–10 nm). Signal curves were obtained for each concentration. Each concentration constituted one cycle. After one cycle, the chip was regenerated with regeneration buffer to return to the original, uncaptured antibody state. The regeneration time was 60 s. The obtained signal curves were analyzed using the BiaCore T-200 system software to obtain the affinity activity detection results of the neutralizing antibody and tetanus toxoid provided in this embodiment of the present disclosure.

[0135] 2. Results

[0136] As shown in Table 2, the affinity of each neutralizing antibody for tetanus toxoid reached 10. -9 The mol level indicates that the antibody provided in this disclosure has high affinity activity and the antibody-binding / complex exhibits good stability.

[0137] Table 2: Affinity activity test results of antibody T048 with tetanus toxoid

[0138]

[0139] Example 4: Determination of neutralizing protective efficacy in mice

[0140] 1. Tetanus toxin L+ determination

[0141] One vial of tetanus toxin (from the National Institutes for Food and Drug Control, China) was diluted with an equal volume of sterile glycerol and borate buffer (from Shanghai Shangbao Biotechnology Co., Ltd.) to prepare a toxin storage solution. Before use, an appropriate amount of borate buffer was added to a brown bottle, followed by an appropriate amount of the toxin storage solution, to prepare a toxin application solution. Each test dose had a solution volume of 1 mL. Homologous tetanus immunoglobulin (hTIG) standard (from the National Institutes for Food and Drug Control, China) was diluted to 0.5 IU / mL with borate buffer. 1 mL of this standard was added to each brown bottle containing the toxin application solution, mixed thoroughly, sealed, and incubated at 37°C for 1 hour. Immediately, the toxin was subcutaneously injected into the abdomen of NIH mice. Three mice were injected with each test dose, with each mouse receiving 0.4 mL. Observation was conducted for 5 days, twice daily (morning and afternoon). The minimum toxin dose that resulted in total mortality within 72 to 120 hours was defined as the test dose (1 / 10 L+).

[0142] 2. In vivo neutralization protection experiment

[0143] The experiment consisted of three groups: a negative control group, an hTIG group (0.5 IU / mL), and five antibody groups (20 μg / mL). For each group, 1 mL of the toxin application solution was diluted to contain five experimental doses (1 / 10 L+) and an equal volume of borate buffer. The solutions were mixed thoroughly, incubated at 37°C for 1 hour, and immediately injected subcutaneously into the abdomen of mice. Six mice were injected into each group. In the hTIG group, each mouse received 0.2 mL of toxin + 0.2 mL of hTIG; in the antibody groups, each mouse received 0.2 mL of toxin + 0.2 mL of antibody; and in the negative control group, each mouse received 0.2 mL of toxin + 0.2 mL of borate buffer.

[0144] 3. Results

[0145] The results are as follows Figure 2 As shown, under the same conditions, all mice in the negative control group died within 48 hours after tetanus toxin challenge, while all mice in the hTIG group (0.5 IU / ml) and each antibody group (20 μg / mL) survived within 14 days. This indicates that the antibodies provided in this disclosure can effectively protect animals from lethal doses of tetanus toxin challenge at 4 μg, with an effect comparable to 0.1 IU hTIG. Therefore, this demonstrates that the neutralizing antibodies provided in this disclosure can effectively neutralize tetanus toxin challenge and protect mice.

[0146] The technical solutions disclosed herein are not limited to the specific embodiments described above. Any technical modifications made based on the technical solutions disclosed herein shall fall within the protection scope of this disclosure.

Claims

1. A tetanus toxin neutralizing antibody or an antigen-binding fragment thereof, said antibody or antigen-binding fragment comprising: (1) The following three heavy chain variable region complementarity-determining regions (HCDRs): HCDR1, having the amino acid sequence of HCDR1 contained in the heavy chain variable region as shown in any one of SEQ ID NO:13, 20, 27, 34, or having an amino acid sequence with one or more amino acid substitutions, deletions or additions compared to the amino acid sequence of HCDR1 contained in the heavy chain variable region. HCDR2, having the amino acid sequence of HCDR2 contained in the heavy chain variable region as shown in any one of SEQ ID NO:13, 20, 27, 34, or having one or more amino acid substitutions, deletions, or additions compared to the amino acid sequence of HCDR2 contained in the heavy chain variable region. HCDR3, having the amino acid sequence of HCDR3 contained in the heavy chain variable region as shown in any one of SEQ ID NO:13, 20, 27, 34, or having an amino acid sequence with one or more amino acid substitutions, deletions or additions compared to the amino acid sequence of HCDR3 contained in the heavy chain variable region. and / or (2) The following three light chain variable region complementarity-determining regions (LCDRs): LCDR1, having the amino acid sequence of LCDR1 contained in the light chain variable region as shown in any one of SEQ ID NO:14, 21, 28, 35, or having an amino acid sequence with one or more amino acid substitutions, deletions or additions compared to the amino acid sequence of LCDR1 contained in the light chain variable region. LCDR2, having an amino acid sequence of LCDR2 contained in the light chain variable region as shown in any one of SEQ ID NO:14, 21, 28, 35, or having an amino acid sequence with one or more amino acid substitutions, deletions or additions compared to the amino acid sequence of LCDR2 contained in the light chain variable region. LCDR3 having an amino acid sequence of LCDR3 contained in the light chain variable region as shown in any one of SEQ ID NO:14, 21, 28, 35, or having an amino acid sequence with one or more amino acid substitutions, deletions, or additions compared to the amino acid sequence of LCDR3 contained in the light chain variable region.

2. The antibody or its antigen-binding fragment according to claim 1, characterized in that, The antibody or its antigen-binding fragment comprises: The three HCDRs contained in the heavy chain variable region as shown in SEQ ID NO:13, or amino acid sequences having one or more amino acid substitutions, deletions, or additions compared to the amino acid sequences of the three HCDRs contained in the heavy chain variable region, or amino acid sequences having at least 80% sequence identity with them; and the three LCDRs contained in the light chain variable region as shown in SEQ ID NO:14, or amino acid sequences having one or more amino acid substitutions, deletions, or additions compared to the amino acid sequences of the three LCDRs contained in the light chain variable region, or amino acid sequences having at least 80% sequence identity with them; or The three HCDRs contained in the heavy chain variable region as shown in SEQ ID NO:20, or amino acid sequences having one or more amino acid substitutions, deletions, or additions compared to the amino acid sequences of the three HCDRs contained in the heavy chain variable region, or amino acid sequences having at least 80% sequence identity with them; and the three LCDRs contained in the light chain variable region as shown in SEQ ID NO:21, or amino acid sequences having one or more amino acid substitutions, deletions, or additions compared to the amino acid sequences of the three LCDRs contained in the light chain variable region, or amino acid sequences having at least 80% sequence identity with them; or The three HCDRs contained in the heavy chain variable region as shown in SEQ ID NO:27, or amino acid sequences having one or more amino acid substitutions, deletions, or additions compared to the amino acid sequences of the three HCDRs contained in the heavy chain variable region, or amino acid sequences having at least 80% sequence identity with them; and the three LCDRs contained in the light chain variable region as shown in SEQ ID NO:28, or amino acid sequences having one or more amino acid substitutions, deletions, or additions compared to the amino acid sequences of the three LCDRs contained in the light chain variable region, or amino acid sequences having at least 80% sequence identity with them; or The three HCDRs contained in the heavy chain variable region as shown in SEQ ID NO:34, or amino acid sequences having one or more amino acid substitutions, deletions, or additions compared to the amino acid sequences of the three HCDRs contained in the heavy chain variable region, or amino acid sequences having at least 80% sequence identity with them; and the three LCDRs contained in the light chain variable region as shown in SEQ ID NO:35, or amino acid sequences having one or more amino acid substitutions, deletions, or additions compared to the amino acid sequences of the three LCDRs contained in the light chain variable region, or amino acid sequences having at least 80% sequence identity with them.

3. The antibody or its antigen-binding fragment according to claim 1, characterized in that, The antibody or its antigen-binding fragment comprises: HCDR1, having an amino acid sequence as shown in any one of SEQ ID NO:8, 15, 22 or 29, an amino acid sequence having one or more amino acid substitutions, deletions or additions compared to it, or an amino acid sequence having at least 80% sequence identity with it; and / or HCDR2, having an amino acid sequence as shown in any one of SEQ ID NO: 9, 16, 23 or 30, an amino acid sequence having one or more amino acid substitutions, deletions or additions compared to it, or an amino acid sequence having at least 80% sequence identity with it; and / or HCDR3, having an amino acid sequence as shown in any one of SEQ ID NO: 10, 17, 24 or 31, an amino acid sequence having one or more amino acid substitutions, deletions or additions compared to the HCDR3, or an amino acid sequence having at least 80% sequence identity with the HCDR3; and / or LCDR1, having an amino acid sequence as shown in any one of SEQ ID NO: 11, 18, 25 or 32, an amino acid sequence having one or more amino acid substitutions, deletions or additions compared to the LCDR1, or an amino acid sequence having at least 80% sequence identity with the LCDR1; and / or LCDR2, having an amino acid sequence such as HAS, AAS, GAS, or WAS, or having an amino acid sequence with a substitution, deletion, or addition of one amino acid compared to it; and / or LCDR3, having an amino acid sequence as shown in any one of SEQ ID NO:12, 19, 26 or 33, an amino acid sequence having one or more amino acid substitutions, deletions or additions compared to the LCDR3, or an amino acid sequence having at least 80% sequence identity with the LCDR3.

4. The antibody or its antigen-binding fragment according to claim 1, characterized in that, The antibody or its antigen-binding fragment comprises: As shown in SEQ ID NO:8, SEQ ID NO:9, and SEQ ID NO:10, HCDR1, HCDR2, and HCDR3, or amino acid sequences having one or more amino acid substitutions, deletions, or additions compared to the amino acid sequences of HCDR1, HCDR2, and HCDR3, or amino acid sequences having at least 80% sequence identity with them; and / or, as shown in SEQ ID NO:11, with amino acid sequences of HAS, and SEQ ID NO:12, LCDR1, LCDR2, and LCDR3, or amino acid sequences having one or more amino acid substitutions, deletions, or additions compared to the amino acid sequences of LCDR1, LCDR2, and LCDR3, or amino acid sequences having at least 80% sequence identity with them; or, HCDR1, HCDR2, and HCDR3 as shown in SEQ ID NO:15, SEQ ID NO:16, and SEQ ID NO:17, or amino acid sequences having one or more amino acid substitutions, deletions, or additions compared to the amino acid sequences of HCDR1, HCDR2, and HCDR3, or amino acid sequences having at least 80% sequence identity with them; and / or LCDR1, LCDR2, and LCDR3 as shown in SEQ ID NO:18, with amino acid sequences AAS, and SEQ ID NO:19, or amino acid sequences having one or more amino acid substitutions, deletions, or additions compared to the amino acid sequences of LCDR1, LCDR2, and LCDR3, or amino acid sequences having at least 80% sequence identity with them; or, HCDR1, HCDR2, and HCDR3 as shown in SEQ ID NO:22, SEQ ID NO:23, and SEQ ID NO:24, or amino acid sequences having one or more amino acid substitutions, deletions, or additions compared to the amino acid sequences of HCDR1, HCDR2, and HCDR3, or amino acid sequences having at least 80% sequence identity with them; and / or LCDR1, LCDR2, and LCDR3 as shown in SEQ ID NO:25, with amino acid sequences GAS, and SEQ ID NO:26, or amino acid sequences having one or more amino acid substitutions, deletions, or additions compared to the amino acid sequences of LCDR1, LCDR2, and LCDR3, or amino acid sequences having at least 80% sequence identity with them; or, HCDR1, HCDR2, and HCDR3 as shown in SEQ ID NO:29, SEQ ID NO:30, and SEQ ID NO:31, or amino acid sequences having one or more amino acid substitutions, deletions, or additions compared to the amino acid sequences of HCDR1, HCDR2, and HCDR3, or amino acid sequences having at least 80% sequence identity with them, and / or LCDR1, LCDR2, and LCDR3 as shown in SEQ ID NO:32, with amino acid sequences WAS, and SEQ ID NO:33, or amino acid sequences having one or more amino acid substitutions, deletions, or additions compared to the amino acid sequences of LCDR1, LCDR2, and LCDR3, or amino acid sequences having at least 80% sequence identity with them.

5. The antibody or its antigen-binding fragment according to claim 1, characterized in that, The antibody or its antigen-binding fragment comprises: The heavy chain variable region comprises an amino acid sequence as shown in SEQ ID NO: 13, 20, 27, 34, an amino acid sequence having one or more amino acid substitutions, deletions, or additions compared to it, or an amino acid sequence having at least 80% sequence identity with it; and / or The light chain variable region contains amino acid sequences as shown in SEQ ID NO: 14, 21, 28, 35, amino acid sequences having one or more amino acid substitutions, deletions or additions compared to them, or amino acid sequences having at least 80% sequence identity with them. Preferably, the antibody or its antigen-binding fragment comprises: The heavy chain variable region comprises an amino acid sequence as shown in SEQ ID NO: 13, an amino acid sequence having one or more amino acid substitutions, deletions, or additions compared to it, or an amino acid sequence having at least 80% sequence identity with it; and the light chain variable region comprises an amino acid sequence as shown in SEQ ID NO: 14, an amino acid sequence having one or more amino acid substitutions, deletions, or additions compared to it, or an amino acid sequence having at least 80% sequence identity with it; and / or The heavy chain variable region comprises an amino acid sequence as shown in SEQ ID NO: 20, an amino acid sequence having one or more amino acid substitutions, deletions, or additions compared to it, or an amino acid sequence having at least 80% sequence identity with it; and the light chain variable region comprises an amino acid sequence as shown in SEQ ID NO: 21, an amino acid sequence having one or more amino acid substitutions, deletions, or additions compared to it, or an amino acid sequence having at least 80% sequence identity with it; and / or The heavy chain variable region comprises an amino acid sequence as shown in SEQ ID NO: 27, an amino acid sequence having one or more amino acid substitutions, deletions, or additions compared to it, or an amino acid sequence having at least 80% sequence identity with it; and the light chain variable region comprises an amino acid sequence as shown in SEQ ID NO: 28, an amino acid sequence having one or more amino acid substitutions, deletions, or additions compared to it, or an amino acid sequence having at least 80% sequence identity with it; and / or The heavy chain variable region comprises an amino acid sequence as shown in SEQ ID NO: 34, an amino acid sequence having one or more amino acid substitutions, deletions or additions compared to it, or an amino acid sequence having at least 80% sequence identity with it; and the light chain variable region comprises an amino acid sequence as shown in SEQ ID NO: 35, an amino acid sequence having one or more amino acid substitutions, deletions or additions compared to it, or an amino acid sequence having at least 80% sequence identity with it.

6. The antibody or its antigen-binding fragment according to claim 1, characterized in that, The antibodies include IgA, IgD, IgE, IgG, or IgM types; Alternatively, the antigen-binding fragments include scFv, Fab, Fab', (Fab')2, Fv fragments, dsFv, bispecific antibodies, and multispecific antibodies; Alternatively, the antibody or antigen-binding fragment may include murine antibodies, chimeric antibodies, humanized antibodies, or fully human antibodies.

7. A nucleic acid molecule encoding the antibody or antigen-binding fragment thereof as described in any one of claims 1 to 6.

8. A drug molecule comprising the antibody or antigen-binding fragment thereof as described in any one of claims 1 to 6, wherein the drug molecule is in the form of a chimeric antigen receptor, an antibody-drug conjugate, or a multispecific antibody containing the antibody or antigen-binding fragment thereof as described in any one of claims 1 to 6.

9. A composition comprising: The antibody or its antigen-binding fragment according to any one of claims 1-6, the nucleic acid molecule according to claim 7, or the drug molecule according to claim 8. Alternatively, the composition may further include one or more other drugs for the prevention and / or treatment of Clostridium tetani infection. Alternatively, the composition may further include a pharmaceutically acceptable carrier and / or excipient.

10. The use of the antibody or antigen-binding fragment thereof of any one of claims 1 to 6, the nucleic acid molecule of claim 7, the pharmaceutical molecule of claim 8, or the composition of claim 9 in the preparation of products for the detection, prevention, and / or treatment of Clostridium tetani infection.

Citation Information

Patent Citations

  • Anti-tetanus toxin antibody and application thereof

    CN118812707A