A method of co-differentiating pluripotent stem cells to generate vascularized heart organoids

By introducing Tet 3G and ETV2 genes into iPSCs and inducing ETV2 expression with doxycycline to promote endothelial cell network formation, the problem of expensive growth factor dependence in existing cardiac organoid construction is solved, realizing a simple and reproducible vascularization method for cardiac organoids and improving the physiological relevance and functionality of organoids.

CN122104565APending Publication Date: 2026-05-29SUZHOU INST OF NANO TECH & NANO BIONICS CHINESE ACEDEMY OF SCI
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202610330585.6
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2026-03-18
Publication Date
2026-05-29

AI Technical Summary

Technical Problem

In existing methods for constructing cardiac organoids, the co-development of endothelial cells and cardiomyocytes depends on the expensive growth factor VEGF-A, which is complex to operate and not applicable to various construction methods. There is also a lack of simple and reproducible vascularization methods.

Method used

Using a pluripotent stem cell co-differentiation method, exogenous genes Tet 3G and ETV2 were introduced into iPSCs. Doxycycline was used to induce ETV2 expression, which promoted the formation of endothelial cell networks and replaced the role of VEGF-A, thereby achieving vascularization of cardiac organoids.

Benefits of technology

It enables the co-development of endothelial cells and cardiomyocytes, avoids the use of expensive growth factors, simplifies the operation process, is applicable to various cardiac organoid construction methods, and improves the physiological relevance and functional maturity of organoids.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122104565A_ABST
    Figure CN122104565A_ABST
Patent Text Reader

Abstract

The present application relates to a kind of pluripotent stem cell co-differentiation method for generating vascularized heart organoids, the method comprises: (1) in iPSCs, obtain iEC-iPSCs by transferring exogenous gene Tet 3G and ETV2;(2) the iEC-iPSCs in step (1) are mixed with iPSCs, add culture medium I, prepare blastula after culture;(3) the blastula in step (2) is induced by using the heart organoid differentiation method combined with doxycycline, and vascularized heart organoids are prepared after differentiation culture.The present application uses Tet-on 3G inducible expression system, promotes the differentiation of part of cells in heart organoids to endothelial cell lineage by regulating the expression of ETV2 gene in part of iPSCs in blastula, and then forms vascularized heart organoids.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of organoid culture technology, and in particular to a method for generating vascularized cardiac organoids through co-differentiation of pluripotent stem cells. Background Technology

[0002] Human heart organoids are derived from human pluripotent stem cells, including embryonic stem cells (ESCs) and induced pluripotent stem cells (iPSCs). They are multicellular mixtures cultured in vitro in 3D and are powerful tools for studying heart development, disease, and regeneration. The construction methods of heart organoids can be divided into four categories: (1) Self-assembled heart organoids: iPSC cell differentiation is regulated by small molecules, growth factors, and morphogens to simulate the embryonic heart development process; (2) Heart micro-tissues: Various types of heart cells are mixed and cultured in a certain proportion; (3) Engineered heart tissues: Various types of heart cells are combined in an extracellular matrix such as matrix gel or hydrogel in a mold; (4) 3D bioprinted hearts: Various types of heart cells, biomaterials, and bioinks are precisely mixed and formed into specific shapes and structures using 3D printing instruments.

[0003] Currently obtained cardiac organoids possess important cardiac characteristics such as contractility, chamber structure, and electrophysiological properties. However, cardiac organoids still have the following problems: lack of specificity of cell type components; heterogeneity in size and shape; lack of appropriate vascular, immune, and neural components, as well as organ-specific morphological characteristics.

[0004] Blood vessels are crucial for organoid culture, facilitating oxygen transport, nutrient transport, and the removal of metabolic waste. As 3D models simulating cardiac development, disease, and drug responses in vitro, the functionality and application value of cardiac organoids highly depend on the complexity of their structure. Vascularization of cardiac organoids is a key step in improving their physiological relevance and functional maturity.

[0005] Currently reported methods for vascularizing cardiac organoids mainly include self-assembly organoid co-differentiation: promoting endothelial cell formation by adding vascular endothelial growth factor (VEGF-A); co-culturing vascular organoids with cardiomyocytes: requiring pre-differentiated vascular organoids and cardiomyocytes before co-culturing to promote the formation of endothelial networks within the organoids; and utilizing the tube-forming ability of endothelial cells in conjunction with microfluidic chips. However, these methods are complex to operate, and more importantly, in the reported methods, the formation and maintenance of vascular endothelium both depend on the addition of VEGF-A.

[0006] Therefore, there is an urgent need to develop a vascularized heart organoid method that is simple to operate, highly reproducible, allows endothelial cells and other cardiac cell types to develop together, is widely applicable to various existing methods of constructing heart organoids, and does not require continuous use of expensive growth factors. Summary of the Invention

[0007] To address the aforementioned technical problems, this invention provides a method for generating vascularized cardiac organoids through co-differentiation of pluripotent stem cells. This method aims to solve the problem that the co-development of endothelial cells and cardiomyocytes during the construction of self-assembled vascularized cardiac organoids depends on expensive growth factors, thereby providing an efficient and stable source of organoids for the use of cardiac organoids in in vitro disease simulation and drug screening.

[0008] To achieve this objective, the present invention adopts the following technical solution: In a first aspect, the present invention provides a method for generating vascularized cardiac organoids through co-differentiation of pluripotent stem cells, the method comprising: (1) iEC-iPSCs cells were obtained by transfecting exogenous genes Tet 3G and ETV2 into iPSCs; (2) Mix the iEC-iPSCs from step (1) with iPSCs, add culture medium I, and culture to obtain embryoid bodies; (3) The embryoids in step (2) were induced by cardiac organoid differentiation combined with doxycycline, and after differentiation culture, vascularized cardiac organoids with endothelial cell networks were obtained.

[0009] In this invention, cells are infected with a lentivirus containing the Tet-on 3G system. Tet 3G is constitutively expressed. When doxycycline (Dox) is present in the culture medium, Dox enters the cell, binds to Tet 3G, and recognizes the TRE3G promoter in the genome, initiating ETV2 expression. ETV2 protein is a variant of ETS transcription factor 2, a key regulator of endothelial cell differentiation and development. It drives cell differentiation towards endothelial cell fate by promoting the transcriptional activation of endothelial-related genes. Simultaneously, ETV2 promotes vascular network construction by regulating endothelial cell proliferation, migration, and lumen formation. This invention, by regulating its expression in iPSCs, promotes iPSC differentiation into endothelial cells and facilitates the formation of vascular endothelial networks during cardiac organoid differentiation, thereby replacing the role of endothelial growth factor VEGF-A in organoid vascularization.

[0010] Preferably, the nucleic acid sequence of the Tet 3G includes the sequence shown in SEQ ID NO.1.

[0011] SEQ ID NO.1: ATGTCTAGACTGGACAAGAGCAAAGTCATAAACTCTGCTCTGGAATTACTCAATGGAGTCGGTATCGAAGGCCTGACGACAAGGAAACTCGCTCAAAAGCTGGGAGTTGAGCAGCCTACCCTGTACTGGCACGTGAAGAACAAGCGGGCCCTGCTCGATGCCCTGCCAATCGAGATGCTGGACAGGCATCATACCCACTCCTGCCCCCTGGAAGGCGAGTCATGGCAAGACTTTCTGCGGAACAACGCCAAGTCATACCGCTGTGCTCTCCTCTCACATCGCGACGGGGCTAAAGTGCATCTCGGCACCCGCCCAACAGAGAAACAGTACGAAACCCTGGAAAATCAGCTCGCGTTCCTGTGTCAGCAAGGCTTCTCCCTGGAGAACGCACTGTACGCTCTGTCCGCCGTGGGCCACTTTACACTGGGCTGCGTATTGGAGGAACAGGAGCATCAAGTAGCAAAAGAGGAAAGAGAGACACCTACCACCGATTCTATGCCCCCACTTCTGAAACAAGCAATTGAGCTGTTCGACCGGCAGGGAGCCGAACCTGCCTTCCTTTTCGGCCTGGAACTAATCATATGTGGCCTGGAGAAACAGCTAAAGTGCGAAAGCGGCGGGCCGACCGACGCCCTTGACGATTTTGACTTAGACATGCTCCCAGCCGATGCCCTTGACGACTTTGACCTTGATATGCTGCCTGCTGACGCTCTTGACGATTTTGACCTTGACATGCTCCCCGGGTAA。

[0012] Preferably, the nucleic acid sequence of ETV2 comprises the sequence shown in SEQ ID NO.2.

[0013] SEQ ID NO.2:

[0014] Preferably, in step (1), the method of introducing the exogenous gene includes lentiviral infection.

[0015] Preferably, the vector for introducing the exogenous gene includes pLV-EF1a and pLVX-TRE3G-mCherry.

[0016] Preferably, in step (1), the method further includes screening of iEC-iPSCs.

[0017] Preferably, the screening reagents include genimycin and puromycin.

[0018] Preferably, in step (2), the ratio of iEC-iPSCs cells to iPSCs cells is 1:(3-5). The (3-5) can be, for example, 3, 3.5, 4, 4.5, or 5.

[0019] Preferably, in step (2), the culture temperature is 35℃-40℃ and the time is 36-60 h. The 35℃-40℃ can be, for example, 35℃, 36℃, 37℃, 38℃, 39℃, or 40℃. The 36-60 h can be, for example, 36 h, 38 h, 40 h, 42 h, 44 h, 46 h, 48 h, 50 h, 52 h, 54 h, 56 h, 58 h, or 60 h.

[0020] Preferably, in step (2), the culture medium I includes 5-15 μM Rock inhibitor and human pluripotent stem cell culture medium.

[0021] Preferably, the Rock inhibitor comprises Y-27632.

[0022] Preferably, the human pluripotent stem cell culture medium comprises mTeSR Plus.

[0023] Preferably, in step (3), the preparation process of the vascularized cardiac organoid is as follows: (3.1) Replace the culture medium I of the embryoid body with culture medium II for culturing; (3.2) Replace culture medium II with culture medium III for culturing; (3.3) Replace culture medium III with culture medium IV for culturing; (3.4) Replace the culture medium IV with culture medium V for culturing.

[0024] In this invention, culture in medium II induces embryoids to differentiate into mesoderm; culture in medium III induces differentiation of embryoids into cardiac mesoderm, while simultaneously inducing iEC-iPSC-derived mesoderm cells to differentiate into endothelial cells; culture in medium IV induces differentiation and specialization of cardiomyocytes; and culture in medium V allows for long-term culture and maintenance of cardiac organoids. The obtained cardiac organoids exhibit a rudimentary form resembling heart chambers and spontaneous pulsation. The roles of small molecules or growth factors in different culture media were as follows: CHIR-99021, as an activator of the Wnt / β-catenin signaling pathway, promoted the differentiation of pluripotent stem cells into mesoderm; bone morphogenetic protein 4 (BMP-4) played a role in mesoderm induction and cardiac mesoderm formation, promoting compartment formation; Activin A protein, in the mesoderm induction stage, worked synergistically with BMP-4 to promote mesoderm differentiation and regulate mesoderm cell tissue organization; PI3K inhibitor LY294002, in coordination with other factors, induced stem cell differentiation into mesoderm and regulated cell proliferation and survival; fibroblast growth factor basic protein (FGF-2), in the mesoderm induction and cardiac mesoderm stages, worked synergistically with BMP-4 to promote cell proliferation and survival and regulate extracellular matrix remodeling; IWP-2, as a Wnt signaling inhibitor, promoted the specialization of mesoderm cells into cardiac mesoderm; and retinoic acid (RA) regulated cardiomyocyte-specific differentiation in the cardiac mesoderm-cardiomyocyte lineage differentiation stage.

[0025] Preferably, the culture medium II comprises 50-100 U / mL penicillin, 50-100 μg / mL streptomycin, 1%-5% insulin-free B-27, 3-8 μM Wnt / β-catenin signaling pathway activator (CHIR-99021), 40-60 ng / mL Activin A protein, 3-8 μM PI3K inhibitor (LY294002), 5-15 ng / mL bone morphogenetic protein 4 (BMP-4), 20-40 ng / mL FGF-2, and 1640 medium. The 1-5% concentration can be, for example, 1%, 2%, 3%, 4%, or 5%. The 3-8 μM concentration can be, for example, 3 μM, 4 μM, 5 μM, 6 μM, 7 μM, or 8 μM. The 40-60 ng / mL can be, for example, 40 ng / mL, 45 ng / mL, 50 ng / mL, 55 ng / mL, or 60 ng / mL. The 5-15 ng / mL can be, for example, 5 ng / mL, 6 ng / mL, 7 ng / mL, 8 ng / mL, 9 ng / mL, 10 ng / mL, 11 ng / mL, 12 ng / mL, 13 ng / mL, 14 ng / mL, or 15 ng / mL. The 20-40 ng / mL can be, for example, 20 ng / mL, 25 ng / mL, 30 ng / mL, 35 ng / mL, or 40 ng / mL. The 50-100 U / mL can be, for example, 50 U / mL, 60 U / mL, 70 U / mL, 80 U / mL, 90 U / mL, or 100 U / mL, and the 50-100 μg / mL can be, for example, 50 μg / mL, 60 μg / mL, 70 μg / mL, 80 μg / mL, 90 μg / mL, or 100 μg / mL, etc.

[0026] Preferably, in step (3.1), the culture temperature is 35℃-40℃, and the time is 36-60 h. The 35℃-40℃ can be, for example, 35℃, 36℃, 37℃, 38℃, 39℃, or 40℃. The 36-60 h can be, for example, 36 h, 38 h, 40 h, 42 h, 44 h, 46 h, 48 h, 50 h, 52 h, 54 h, 56 h, 58 h, or 60 h.

[0027] Preferably, in step (3.2), the culture medium III comprises 50-100 U / mL penicillin, 50-100 μg / mL streptomycin, 1%-5% insulin-free B-27, 3-8 μM Wnt inhibitor (IWP-2), 5-15 ng / mL BMP-4, 6-10 ng / mL FGF-2, 0.1-3 μM retinoic acid, 0.5-5 μM doxycycline, and 1640 medium. The 1-5% can be, for example, 1%, 2%, 3%, 4%, or 5%. The 3-8 μM can be, for example, 3 μM, 4 μM, 5 μM, 6 μM, 7 μM, or 8 μM. The 5-15 ng / mL concentration can be, for example, 5 ng / mL, 6 ng / mL, 7 ng / mL, 8 ng / mL, 9 ng / mL, 10 ng / mL, 11 ng / mL, 12 ng / mL, 13 ng / mL, 14 ng / mL, or 15 ng / mL. The 6-10 ng / mL concentration can be, for example, 6 ng / mL, 7 ng / mL, 8 ng / mL, 9 ng / mL, or 10 ng / mL. The 0.1-3 μM concentration can be, for example, 0.1 μM, 0.5 μM, 1 μM, 1.5 μM, 2 μM, 2.5 μM, or 3 μM. The 0.5-5 μM concentration can be, for example, 0.5 μM, 1 μM, 2 μM, 3 μM, 4 μM, or 5 μM. The 50-100 U / mL can be, for example, 50 U / mL, 60 U / mL, 70 U / mL, 80 U / mL, 90 U / mL, or 100 U / mL, and the 50-100 μg / mL can be, for example, 50 μg / mL, 60 μg / mL, 70 μg / mL, 80 μg / mL, 90 μg / mL, or 100 μg / mL, etc.

[0028] Preferably, in step (3.2), the culture temperature is 35℃-40℃, and the time is 2-8 days. The 35℃-40℃ can be, for example, 35℃, 36℃, 37℃, 38℃, 39℃, or 40℃. The 2-8 days can be, for example, 2 days, 3 days, 4 days, 5 days, 6 days, 7 days, or 8 days.

[0029] Preferably, in step (3.3), the culture medium IV comprises 50-100 U / mL penicillin, 50-100 μg / mL streptomycin, 1%-5% insulin-free B-27, 5-15 ng / mL BMP-4, 5-10 ng / mL FGF-2, 0.5-5 μM doxycycline, and 1640 medium. The 1-5% can be, for example, 1%, 2%, 3%, 4%, or 5%. The 5-15 ng / mL can be, for example, 5 ng / mL, 6 ng / mL, 7 ng / mL, 8 ng / mL, 9 ng / mL, 10 ng / mL, 11 ng / mL, 12 ng / mL, 13 ng / mL, 14 ng / mL, or 15 ng / mL. The 5-10 ng / mL concentration can be, for example, 5 ng / mL, 6 ng / mL, 7 ng / mL, 8 ng / mL, 9 ng / mL, or 10 ng / mL. The 0.5-5 μM concentration can be, for example, 0.5 μM, 1 μM, 2 μM, 3 μM, 4 μM, or 5 μM. The 50-100 U / mL concentration can be, for example, 50 U / mL, 60 U / mL, 70 U / mL, 80 U / mL, 90 U / mL, or 100 U / mL. The 50-100 μg / mL concentration can be, for example, 50 μg / mL, 60 μg / mL, 70 μg / mL, 80 μg / mL, 90 μg / mL, or 100 μg / mL.

[0030] Preferably, in step (3.3), the culture temperature is 35℃-40℃, and the time is 36-60 h. The 35℃-40℃ can be, for example, 35℃, 36℃, 37℃, 38℃, 39℃, or 40℃. The 36-60 h can be, for example, 36 h, 38 h, 40 h, 42 h, 44 h, 46 h, 48 h, 50 h, 52 h, 54 h, 56 h, 58 h, or 60 h.

[0031] Preferably, in step (3.4), the culture medium V comprises 50-100 U / mL penicillin, 50-100 μg / mL streptomycin, 1%-5% B-27 (containing insulin), 1-5 μM doxycycline, and 1640 medium. The 1-5% concentration can be, for example, 1%, 2%, 3%, 4%, or 5%. The 1-5 μM concentration can be, for example, 1 μM, 2 μM, 3 μM, 4 μM, or 5 μM. The 50-100 U / mL concentration can be, for example, 50 U / mL, 60 U / mL, 70 U / mL, 80 U / mL, 90 U / mL, or 100 U / mL. The 50-100 μg / mL concentration can be, for example, 50 μg / mL, 60 μg / mL, 70 μg / mL, 80 μg / mL, 90 μg / mL, or 100 μg / mL.

[0032] Preferably, in step (3.4), the culture temperature is 35℃-40℃, and the time is 10-20 days. The 35℃-40℃ can be, for example, 35℃, 36℃, 37℃, 38℃, 39℃, or 40℃. The 10-20 days can be, for example, 10 days, 11 days, 12 days, 13 days, 14 days, 15 days, 16 days, 17 days, 18 days, 19 days, or 20 days.

[0033] In a second aspect, the present invention provides a vascularized cardiac organoid containing an endothelial network prepared by the method for generating vascularized cardiac organoids by co-differentiation of pluripotent stem cells according to the first aspect.

[0034] Compared with the prior art, the present invention has at least the following beneficial effects: 1. The method of the present invention involves mixing iETV2-iPSCs, which can be induced to express ETV2 by doxycycline, with iPSCs to form embryoid bodies. During the differentiation of cardiac organoids, doxycycline is used to induce ETV2 expression in iETV2-iPSCs, causing these cells to differentiate into endothelial cells, promoting the formation of endothelial networks in cardiac organoids, thereby promoting the vascularization of cardiac organoids.

[0035] 2. This invention promotes endothelial cell differentiation and endothelial network maintenance through doxycycline, avoiding the use of the expensive cytokine VEGF-A and saving on organoid construction costs. Attached Figure Description

[0036] Figure 1The images show the endothelial cell differentiation induced by iEC-iPSCs after Dox treatment. Image A shows the detection of pluripotent stem cell markers; Image B shows the fluorescence expression of mCherry after doxycycline induction; Image C shows the protein expression of ETV2 and mCherry after doxycycline induction; and Image D shows the induction of ETV2 and endothelial marker genes by doxycycline at different time gradients. CDH5 and PECAM1 A diagram illustrating the situation.

[0037] Figure 2 Figure 1 shows the expression of endothelial cell markers induced by Ctrl-iPSCs and iEC-iPSCs under cardiac organoid differentiation conditions. Figure 2 shows the expression and co-localization of mCherry and CD144 in the two cell types under doxycycline induction conditions, and Figure 3 shows the expression and co-localization of mCherry and CD31 in the two cell types under doxycycline induction conditions.

[0038] Figure 3 The images show the morphology and biomarker detection of cardiac organoids at different stages of differentiation. Image A is a schematic diagram of the differentiation stages of cardiac organoids, Image B is a bright-field morphology image of organoids at different stages of differentiation, and Image C is an image showing the expression of the cardiomyocyte biomarker cTnT at different stages of differentiation.

[0039] Figure 4 The images show the structure of the co-differentiated endothelial network. Image A shows the distribution of mCherry in the cardiac organoids on day 28 of differentiation. Image B shows the co-distribution of the endothelial marker CD144 and mCherry in the cardiac organoid slices on day 28 of differentiation. Image C shows the distribution and co-localization of the endothelial markers CD144 and CD31 in the cardiac organoids on day 18 of differentiation.

[0040] Figure 5 This is an experimental flowchart of the method of the present invention. Detailed Implementation

[0041] The technical solution of the present invention will be further described below with reference to the accompanying drawings and specific embodiments. However, the following examples are merely simplified examples of the present invention and do not represent or limit the scope of protection of the present invention. The scope of protection of the present invention is determined by the claims.

[0042] Example 1 This embodiment describes the preparation of iEC-iPSCs. Lentiviral vectors pLV-EF1a-Tet 3G (genymycin resistant) and pLVX-TRE3G-mCherry-ETV2 (puromycin resistant) expressing Tet 3G and TRE3G-mCherry-ETV2, respectively, were constructed. This system is a Tet-on 3G inducible expression system. pLVX-Tet 3G and pLV-EF1α vectors were purchased from the Miaoling plasmid platform. Using pLVX-Tet 3G plasmid as a PCR template, the Tet 3G fragment was constructed into the multiple cloning site of the pLV-EF1α vector through PCR amplification (PCR upstream primer sequence SEQ ID NO.3: CGGGATCCGCCACCATGTCTAGACTGGA; PCR downstream primer sequence SEQ ID NO.4: CGACGCGTTTACCCGGGGAGCATGTCAA), restriction enzyme digestion, ligation, and transformation. The restriction enzyme sites for the Tet 3G fragment were BamHⅠ and MluⅠ, respectively. The pLVX-TRE3G-mCherry vector was purchased from Shanghai Bosheng Biotechnology. Using cDNA obtained from reverse transcription of iPSCs mRNA as a PCR template, the CDS sequence of the ETV2 gene was constructed at the multiple cloning site following the mCherry sequence through PCR amplification (PCR upstream primer sequence SEQ ID NO.5: CGACGCGTATGGACCTGTGGAACTGGGAT; PCR downstream primer sequence SEQ ID NO.6: CGGAATTCTTATTGTGTCTCTGCTCCCCGTCCG), restriction enzyme digestion, ligation, and transformation experiments. The restriction enzyme sites of the ETV2 fragment were Mlu I and EcoR I.

[0043] Lentiviral solutions were obtained by transfecting HEK293T cells with lentiviral packaging vectors psPAX.2, pMD2.G, and pLV-EF1a-Tet 3G and pLVX-TRE3G-mCherry-ETV2 using lentiviral transfection reagents, followed by collection of the supernatant. HEK293T cells were passaged into 6 cm culture dishes, and transfection was performed when the cell density was approximately 60%. The ratio of each vector in the transfection system was 2:1:2:pPAX.2:pMD2.G:pLV-EF1a-Tet 3G or pLVX-TRE3G-mCherry or pLVX-TRE3G-mCherry-ETV2, with a total transfection plasmid amount of 7 μg and transfection reagent of 12 μL. After 8 hours of transfection, the medium was replaced with fresh HEK293T medium, and the lentiviral supernatant was collected 48 hours after transfection. Lentiviral solutions containing Tet 3G, TRE3G-mCherry, and TRE3G-mCherry-ETV2 can be obtained.

[0044] Naïve-iPSCs (untreated iPSCs) were infected with lentivirus, followed by selection using genimycin and puromycin to identify successfully infected cells. Specifically, naïve-iPSCs were passaged into 6-well plates with 0.5 mM EDTA at a cell density of 20%. After 24 hours, the culture medium was replaced with fresh stem cell medium, and equal volumes of lentivirus solutions containing Tet 3G and TRE3G-mCherry-ETV2 (final culture volume 3 mL) and polybrene at a final concentration of 8 μg / mL were added. After another 24 hours of infection, the culture medium was replaced with fresh stem cell medium. Forty-eight hours after infection, selection was performed using 2 μg / mL puromycin for 2 days and 400 μg / mL genimycin for 4 days to obtain successfully infected iEC-iPSCs. Similarly, naïve-iPSCs were infected with lentivirus solutions containing Tet 3G and TRE3G-mCherry to select Ctrl-iPSCs.

[0045] The iEC-iPSCs obtained in this embodiment were characterized, and the immunofluorescence detection results showed that, Figure 1 As shown in Figure A, lentiviral infection and drug screening did not affect the expression of pluripotency marker proteins in iEC-iPSCs. Adding different concentrations of Dox to the iEC-iPSC culture medium for two days resulted in... Figure 1 As shown in Figure B, the red fluorescence of mCherry can be observed under a fluorescence microscope, such as... Figure 1 As shown in Figure C, Western blot analysis revealed the expression of ETV2 and mCherry proteins. This indicates that the Tet-On 3G system functions correctly in iEC-iPSCs. Furthermore, for functional validation of iEC-iPSCs differentiating into endothelial cells, treatment with 2 μM Dox at different time gradients yielded the following results: Figure 1 As shown in Figure D, detection ETV2 , CDH5 , PECAM1 Gene expression status, results showed CDH5 and PECAM1 The expression level of [the substance] increased with increasing treatment time. These results indicate that iEC-iPSCs can induce endothelial cells under Dox treatment conditions.

[0046] To verify the function of iEC-iPSCs in inducing endothelial differentiation under cardiac organoid induction conditions in this embodiment, we cultured iEC-iPSCs in 2D culture dishes and used the same medium replacement method for 3D embryoid differentiation into cardiac organoids. Specifically, iEC-iPSCs and Ctr-iPSCs were digested into single-cell suspensions using Solase single-cell digestion solution, and the cells were resuspended in stem cell medium mTeSR Plus (STEMCELL) with 10 μM Rock inhibitor Y-27632 (medium I). Cell counts were then performed at a rate of 20,000 / cm³. 2 After passage, the cells were cultured in medium I for 2 days, followed by mediums II, III, and IV for 2, 4, and 2 days respectively, and finally in maintenance medium V for 2 days. Simultaneously, cardiac organoid differentiation media II, III, and IV (without doxycycline) and maintenance medium V were used as control groups. The results are as follows: Figure 2 Figures A and B show that iEC-iPSCs can differentiate into CD144 and CD31-positive endothelial cells in cardiac organoid differentiation medium containing doxycycline, and the expression of endothelial markers colocalizes with mCherry. This indicates that the endothelial cells are differentiated from iEC-iPSCs that induce ETV2 expression, and iEC-iPSCs have the ability to induce the formation of endothelial cells under cardiac organoid differentiation conditions.

[0047] Control group iEC-iPSCs cultured in differentiation medium without doxycycline did not differentiate into endothelial cells and did not express fluorescent proteins, as shown in the following results. Figure 2 Figures A and B show that this indicates that there is no expression leakage in the Tet-on 3G system in this embodiment.

[0048] Meanwhile, Ctrl-iPSCs, which can only induce the expression of the fluorescent protein mCherry, were used as a control, and the results were as follows: Figure 2 Figures A and B show that mCherry protein expression can be detected when Dox is added to the culture medium, but the presence of CD144 or CD31 positive endothelial cells is not detected; mCherry protein expression is not detected when Dox is not added to the culture medium.

[0049] The above experimental results show that the iEC-iPSCs constructed in this invention, which can induce endothelial cell differentiation, have the ability to differentiate into endothelial cells.

[0050] Example 2 This embodiment describes the preparation of vascularized cardiac organoids.

[0051] (1) Formation of the embryoid body iEC-iPSCs and naïve-iPSCs were digested into single-cell suspensions using Solase single-cell digestion solution. Cells were resuspended in stem cell culture medium (mTeSR Plus) with 10 μM Rock inhibitor Y-27632 (medium I) and counted. Cardiac organoid differentiation was performed in 96-well low-absorption U-shaped plates with an initial cell count of 5000 cells per well and 200 μL of medium I per well. The iEC-iPSC and naïve-iPSC single-cell suspensions were mixed in a 2:8 ratio in 96-well U-shaped low-absorption plates, centrifuged at 300 g for 5 minutes, and then incubated statically at 37°C in a 5% CO2 incubator. Differentiation was not induced at this stage and this was designated Day-2. After 48 hours of culture, cells aggregated to form embryoid bodies.

[0052] (2) Inducing embryoid bodies to differentiate into mesoderm The stem cell culture medium I in the 96-well U-shaped low-absorption plate was replaced with differentiation medium II. Medium II consisted of RPMI 1640 basal medium supplemented with 100 U / mL penicillin, 100 μg / mL streptomycin, 2% insulin-free medium supplement B-27 (Gibco product code A1895601), and concentrations of 6 μM Wnt / β-catenin signaling pathway activator (CHIR-99021), 50 ng / mL Activin A protein, 5 μM PI3K inhibitor (LY294002), 10 ng / mL bone morphogenetic protein 4 (BMP-4), and 30 ng / mL fibroblast basic protein (FGF-2). Approximately 30 μL of medium was left unabsorbed during the medium replacement to avoid damaging the embryoids by aspirating them into the pipette tip. Differentiation induction began at this point, marked as Day 0. After the medium replacement, the plates were incubated at 37°C in a 5% CO2 incubator for another 48 hours.

[0053] (3) Inducing embryoid bodies to differentiate into cardiac mesoderm Dox was added to induce the differentiation of iEC-iPSC-derived mesodermal cells into endothelial cells. Differentiation medium II was replaced with differentiation medium III, which consisted of RPMI 1640 basal medium supplemented with 100 U / mL penicillin, 100 μg / mL streptomycin, 2% B-27 (without insulin), 5 μM Wnt inhibitor (IWP-2), 10 ng / mL BMP-4, 8 ng / mL FGF-2, 0.5 μM retinoic acid (RA), and 2 μM Dox. Since both cardiomyocyte and endothelial cell differentiation involve a mesodermal stage, inducing iEC-iPSC-derived mesodermal cells to differentiate into endothelial cells at this stage is beneficial for the formation of vascularized organoids. At this point, most cells derived from naïve-iPSCs differentiated into cardiac mesoderm, while iEC-iPSC-derived mesodermal cells differentiated into endothelial cells under Dox induction; this stage is designated as Day 2. Continue culturing for 4 days in a 37℃, 5% CO2 incubator, changing the differentiation medium III every two days.

[0054] (4) Inducing organoids to specialize towards myocardium Differentiation medium III was replaced with differentiation medium IV, which consisted of RPMI 1640 basal medium supplemented with 100 U / mL penicillin, 100 μg / mL streptomycin, 2% B-27 (without insulin), 10 ng / mL BMP-4, 8 ng / mL FGF-2, and 2 μM Dox. This stage induced the differentiation and specialization of organoids into cardiomyocytes, designated as Day 6. The culture was carried out at 37 ℃ in a 5% CO2 incubator for 48 hours.

[0055] (5) Formation and maintenance of cardiac organoids The differentiation medium IV was replaced with maintenance medium V. Its components were RPMI 1640 basal medium supplemented with 100 U / mL penicillin, 100 μg / mL streptomycin, 2% medium supplement B-27 (Gibco product number 17504044), and 2 μM Dox. This was recorded as Day 8. Culture was continued for 10–20 days, thereafter changing maintenance medium V every two days until detection. In this example, samples were collected and analyzed after 10 and 20 days of continued culture.

[0056] Based on the above, Figure 3 The heart organoids obtained through the process shown in Figure A exhibit morphological changes at different stages, as follows: Figure 3As shown in Figure B, spontaneous pulsation of the cardiac organoids can be observed starting on day 8 of differentiation. Based on the results of cardiac organoid sections at different stages, expression of the cardiomyocyte marker troponin cTnT can be detected after day 6 of differentiation, and the cardiac organoids form compartmental structures during differentiation, as shown in Figure B. Figure 3 As shown in Figure C.

[0057] In the above experiments, the ratio of iEC-iPSCs to naïve-iPSCs in the differentiation initiation cells was 2:8. Vascularized cardiac organoids were harvested on day 28 of induced differentiation. After washing with DPBS, they were fixed in 1% paraformaldehyde for 30 minutes. The distribution of mCherry fluorescent protein in the organoids was observed using laser confocal microscopy. The results showed that mCherry formed linear or reticular structures in the cardiac organoids, such as... Figure 4 As shown in Figure A, the cardiac organoids in this embodiment were frozen sections using OCT embedding medium, and immunofluorescence detection of the endothelial cell marker protein CD144 was performed. The results showed that CD144-positive endothelial cells were linearly distributed within the organoids and co-localized with mCherry cells, as shown in Figure A. Figure 4 As shown in Figure B, this indicates that the endothelial cells in the organoids are differentiated from iEC-iPSCs cells that can induce ETV2 expression. Furthermore, whole-organoid immunofluorescence assays of the cardiac organoids in this embodiment showed that the endothelial cell markers CD144, CD31, and mCherry were all distributed in a reticular pattern within the organoids, exhibiting co-localization as shown in Figure B. Figure 4 As shown in Figure C. The above results indicate that the cardiac organoids induced by co-differentiation of iEC-iPSCs and naïve-iPSCs possess a vascularized endothelial cell network.

[0058] The above experiments demonstrate that the product prepared by this invention is as follows: Figure 5 As shown, after blending iEC-iPSCs and naïve-iPSCs, embryoid bodies are formed. During the process of inducing the embryoid bodies to differentiate into cardiac organoids, doxycycline is added to induce iEC-iPSCs to differentiate into endothelial cells, thereby promoting the formation of an endothelial cell network in the cardiac organoids and thus achieving the construction of co-differentiated vascularized cardiac organoids.

[0059] Example 3 This embodiment investigates the effects of ETV2 and doxycycline on efficacy. (1) Investigating the effect of ETV2 on the effect Ctrl-iPSCs (i.e., those without ETV2 expression) that can only be induced to express mCherry were also co-mixed with naïve-iPSCs at a ratio of 2:8 in 96-well U-shaped low-absorption plates. Induction was performed according to the cardiac organoid differentiation steps in Example 2. Organoids were harvested on day 28 of differentiation, fixed with paraformaldehyde, and the distribution of mCherry fluorescent protein was observed under a laser confocal microscope. The results showed that mCherry was distributed in a punctate pattern in the organoids, rather than in a linear or network-like pattern. Figure 4 As shown in Figure A. Additionally, frozen sections of the cardiac organoids in this comparative example were analyzed using immunofluorescence to detect endothelial cell expression and mCherry expression. The results showed that only a small amount of the endothelial cell marker CD144 was expressed in this comparative example, and it was scattered. mCherry protein was also scattered in the organoids in a dotted pattern. Figure 4 As shown in Figure B.

[0060] (2) Investigating the effect of doxycycline on efficacy Dox was removed from the cardiac organoid differentiation media II, III, IV, and maintenance medium V. Cardiac organoids were then induced using a mixture of iEC-iPSCs and naïve-iPSCs as described in Example 2. The cardiac organoids from this comparative example were collected for whole-body immunofluorescence staining to detect endothelial cell expression and mCherry expression. Results showed no CD144 and CD31-positive endothelial cell expression in the organoids, and no mCherry fluorescence expression as described in Example 2. Figure 4 As shown in Figure C.

[0061] In summary, the cardiac organoids obtained by the co-differentiation of iEC-iPSCs and naïve-iPSCs that can induce endothelial differentiation in this invention possess a vascularized endothelial cell network, and vascularized cardiac organoids can be obtained by following the specific operating steps in the embodiments of this invention.

[0062] The applicant declares that the above description is only a specific embodiment of the present invention, but the protection scope of the present invention is not limited thereto. Those skilled in the art should understand that any changes or substitutions that can be easily conceived by those skilled in the art within the technical scope disclosed in the present invention fall within the protection and disclosure scope of the present invention.

Claims

1. A method for generating vascularized cardiac organoids through co-differentiation of pluripotent stem cells, characterized in that, The method includes: (1) iEC-iPSCs were obtained by introducing exogenous genes Tet 3G and ETV2 into iPSCs; (2) Mix the iEC-iPSCs from step (1) with iPSCs, add culture medium I, and culture to obtain embryoid bodies; (3) The embryoids in step (2) were induced by cardiac organoid differentiation method combined with doxycycline, and vascularized cardiac organoids were obtained after differentiation culture.

2. The method for generating vascularized cardiac organoids through co-differentiation of pluripotent stem cells according to claim 1, characterized in that, In step (1), the method of introducing the exogenous gene includes lentiviral infection; Preferably, the vector for introducing the exogenous gene includes pLV-EF1a and / or pLVX-TRE3G-mCherry.

3. The method for generating vascularized cardiac organoids through co-differentiation of pluripotent stem cells according to claim 1 or 2, characterized in that, In step (1), the method further includes screening iEC-iPSCs; Preferably, the screening reagents include genimycin and puromycin.

4. The method for generating vascularized cardiac organoids by co-differentiation of pluripotent stem cells according to any one of claims 1-3, characterized in that, In step (2), the ratio of the number of iEC-iPSCs to iPSCs is 1:(3-5); Preferably, in step (2), the culture temperature is 35℃-40℃ and the time is 36-60 h.

5. The method for generating vascularized cardiac organoids by co-differentiation of pluripotent stem cells according to any one of claims 1-4, characterized in that, In step (2), the culture medium I includes 5-15 μM Rock inhibitor and human pluripotent stem cell culture medium.

6. The method for generating vascularized cardiac organoids by co-differentiation of pluripotent stem cells according to any one of claims 1-5, characterized in that, In step (3), the preparation process of the vascularized cardiac organoid is as follows: (3.1) Replace the culture medium I of the embryoid body with culture medium II for culturing; (3.2) Replace culture medium II with culture medium III for culturing; (3.3) Replace culture medium III with culture medium IV for culturing; (3.4) Replace the culture medium IV with culture medium V for culturing.

7. The method for generating vascularized cardiac organoids through co-differentiation of pluripotent stem cells according to claim 6, characterized in that, In step (3.1), the culture medium II comprises 50-100 U / mL penicillin, 50-100 μg / mL streptomycin, 1%-5% insulin-free B-27, 3-8 μM Wnt / β-catenin signaling pathway activator, 40-60 ng / mL Activin A protein, 3-8 μM PI3K inhibitor, 5-15 ng / mL bone morphogenetic protein 4, 20-40 ng / mL FGF-2 and 1640 medium; Preferably, in step (3.1), the culture temperature is 35℃-40℃ and the time is 36-60 h; Preferably, in step (3.2), the culture medium III comprises 50-100 U / mL penicillin, 50-100 μg / mL streptomycin, 1%-5% insulin-free B-27, 3-8 μM Wnt inhibitor, 5-15 ng / mL bone morphogenetic protein 4, 6-10 ng / mL FGF-2, 0.1-3 μM retinoic acid, 0.5-5 μM doxycycline, and 1640 medium. Preferably, in step (3.2), the culture temperature is 35℃-40℃ and the time is 2-8 days.

8. The method for generating vascularized cardiac organoids by co-differentiation of pluripotent stem cells according to claim 6 or 7, characterized in that, In step (3.3), the culture medium IV comprises 50-100 U / mL penicillin, 50-100 μg / mL streptomycin, 1%-5% insulin-free B-27, 5-15 ng / mL bone morphogenetic protein 4, 5-10 ng / mL FGF-2, 0.5-5 μM doxycycline and 1640 medium; Preferably, in step (3.3), the culture temperature is 35℃-40℃ and the time is 36-60 h.

9. The method for generating vascularized cardiac organoids by co-differentiation of pluripotent stem cells according to any one of claims 6-8, characterized in that, In step (3.4), the culture medium V comprises 50-100 U / mL penicillin, 50-100 μg / mL streptomycin, 1%-5% B-27, 1-5 μM doxycycline and 1640 medium; Preferably, in step (3.4), the culture temperature is 35℃-40℃ and the time is 10-20 days.

10. A vascularized cardiac organoid comprising an endothelial network prepared by a method for generating vascularized cardiac organoids by co-differentiation of pluripotent stem cells according to any one of claims 1-9.