Enhancer for regulating igfbp5 gene expression and adipogenic differentiation of intramuscular preadipocytes and application thereof

CN122104699APending Publication Date: 2026-05-29HENAN AGRICULTURAL UNIVERSITY
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
HENAN AGRICULTURAL UNIVERSITY
Filing Date
2026-02-03
Publication Date
2026-05-29

AI Technical Summary

Technical Problem

Existing technologies are insufficient to effectively increase the intramuscular fat content of chicken meat, leading to a decline in meat quality, and there is a lack of efficient molecular markers for breeding selection.

Method used

It provides enhancers EN1, EN2, and EN3 that regulate the proliferation and adipogenic differentiation of chicken intramuscular preadipocytes, and promotes the proliferation and adipogenic differentiation of chicken intramuscular preadipocytes by significantly enhancing IGFBP5 gene expression.

Benefits of technology

It significantly promotes the proliferation, adipogenic differentiation and lipid deposition of preadipocytes in chicken muscle, providing an efficient molecular marker for broiler breeding, increasing intramuscular fat content and improving meat quality.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122104699A_ABST
    Figure CN122104699A_ABST
Patent Text Reader

Abstract

The application provides a kind of regulation IGFBP5 The application belongs to the technical field of gene regulation, and provides an enhancer for regulating the proliferation and adipogenic differentiation of chicken intramuscular preadipocytes, which includes one or more of enhancer EN1, enhancer EN2 and enhancer EN3, the nucleotide sequence of the enhancer EN1 is shown as SEQ ID NO. 2; the nucleotide sequence of the enhancer EN2 is shown as SEQ ID NO. 1; and the nucleotide sequence of the enhancer EN3 is shown as SEQ ID NO. 3. The enhancer can significantly enhance IGFBP5 gene expression and promote the proliferation and adipogenic differentiation of chicken intramuscular preadipocytes.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of gene regulation technology, and more particularly to a regulation method. IGFBP5 Enhancers of gene expression and adipogenic differentiation of intramuscular preadipocytes and their applications. Background Technology

[0002] Chicken is the world's largest producer and consumer of meat, and the second largest consumer of meat in my country. Intramuscular fat (IMF) content directly affects the texture, tenderness, and flavor of meat, and is a key indicator for assessing meat quality. Long-term intensive selection of broiler chickens for traits such as weight and growth rate, while significantly improving growth performance, has also led to a decrease in IMF content, resulting in poorer meat quality. Therefore, elucidating the genetic basis and regulatory mechanisms of IMF deposition in chickens, and developing efficient molecular markers for breeding selection to increase IMF content and improve meat quality, has always been a hot topic and a challenge in the field of high-quality broiler breeding.

[0003] Intramuscular fat (IMF) is mainly found in the perimysium, epimysium, and endomysium, and its main components are triglycerides and phospholipids. IMF deposition is mainly manifested by the proliferation (increased number) and adipogenic differentiation (increased volume) of intramuscular preadipocytes; that is, the number of adipocytes and their lipid synthesis and accumulation capacity determine the IMF content. The number of adipocytes is generally fixed during the embryonic period and early development, while intramuscular fat deposition in later stages of development mainly depends on the increase in adipocyte volume.

[0004] Enhancers (ENs) are DNA sequences in eukaryotic genomes that significantly activate the transcription of target genes, ranging in length from 100 to 2000 bp. Enhancers are characterized by histone modifications and are classified into three states based on the type of modification: pre-activated state (H3K4me1 only), active state (both H3K4me1 and H3K27ac present), and quiescent state (both H3K4me1 and H3K27me3 present). Only enhancers in the active state can activate gene transcription. Super-enhancers (SEs) are large clusters of transcriptionally active enhancers, enriched with higher densities of transcription factors, cofactors, and active enhancer histone modifications than ordinary enhancers, driving higher gene expression levels. In recent years, with the continuous development of sequencing technology and bioinformatics analysis, enhancers and super-enhancers have been gradually identified and are playing important regulatory roles in mammalian lipid metabolism. Summary of the Invention

[0005] The purpose of this invention is to provide an enhancer for regulating the proliferation and adipogenic differentiation of chicken intramuscular preadipocytes, significantly enhancing... IGFBP5Gene expression and promote the proliferation and adipogenic differentiation of preadipocytes in chicken muscle.

[0006] To achieve the above-mentioned objectives, the present invention provides the following technical solution: This invention provides an enhancer for regulating the proliferation and adipogenic differentiation of chicken intramuscular preadipocytes, comprising one or more of enhancer EN1, enhancer EN2, and enhancer EN3, wherein the nucleotide sequence of enhancer EN1 is shown in SEQ ID NO.1; the nucleotide sequence of enhancer EN2 is shown in SEQ ID NO.2; and the nucleotide sequence of enhancer EN3 is shown in SEQ ID NO.3.

[0007] Preferably, used for activation IGFBP5 Gene transcription.

[0008] The present invention also provides the application of the enhancer in regulating the proliferation of chicken intramuscular preadipocytes, adipogenic differentiation of chicken intramuscular preadipocytes, or lipid deposition of chicken intramuscular preadipocytes.

[0009] This invention also provides a method for regulating intramuscular preadipocytes in chickens. IGFBP5 Gene, IGFBP5 The nucleotide sequence of the gene is shown in SEQ ID NO.4; overexpression IGFBP5 The gene can promote the proliferation, adipogenic differentiation and lipid deposition of preadipocytes in chicken muscle.

[0010] The present invention also provides the aforementioned IGFBP5 Application of genes in regulating the proliferation of preadipocytes in chicken muscle or in breeding.

[0011] Beneficial effects

[0012] The enhancer provided by this invention can significantly promote the proliferation, adipogenic differentiation, and lipid deposition of preadipocytes in chicken muscle. Through dual-luciferase reporter system, gene expression interference, and a series of cell function experiments, it was confirmed that this enhancer has significant transcriptional activation activity and can positively regulate target genes. IGFBP5 The expression and function of the marker have been fully validated and the results are reliable. It can serve as a highly valuable molecular marker. Applying it to marker-assisted selection (MAS) breeding of chickens can provide a direct and efficient genetic selection tool for the targeted breeding of new broiler breeds with high intramuscular fat content and superior meat quality, and has significant industrial application value. Attached Figure Description

[0013] Figure 1 This is a graph showing the activity identification results of the three enhancers in Example 1; Figure 2 After the interference enhancer activity in Example 1, the effect on IGFBP5 Figure showing the effect of gene mRNA expression; Figure 3 This is a graph showing the effect of interfering enhancer activity on the expression of cell proliferation marker genes in Example 1; Figure 4 This is a graph showing the effect of interferon enhancer activity on the viability of chicken intramuscular adipocytes in Example 1; Figure 5 This is a graph showing the effect of interfering enhancer activity on the cell cycle of chicken intramuscular adipocytes in Example 1. Figure 6 This is a graph showing the effect of interferon enhancer activity on the proliferation rate of chicken intramuscular adipocytes in Example 1; Figure 7 This is a graph showing the results of Oil Red O staining in Example 1 to detect the effect of interfering ENs activity on lipid droplet accumulation in cells; Figure 8 The figure shows the results of Red O staining in Example 1 to detect the effect of interfering ENs activity on intracellular triglyceride content. Detailed Implementation

[0014] The technical solutions provided by the present invention will be described in detail below with reference to the embodiments, but they should not be construed as limiting the scope of protection of the present invention.

[0015] The nucleotide sequence of enhancer EN1 is shown in SEQ ID NO.1: AAGGACCAGAAATCAGCACAGCTTCAGCTAAATCAGGAGCACACCAGCATGGTACCCACCATGCTGCACTGCTGGGTCCACCATCAGCCACTGATGTGTTCCTGTTGTATGCGCAGGTTTGCAGGCTCAGCAGTAATTAAAACCAATCCCTCTGACTCTACCCTTGGGTAGATTAAGCTTTGAATCCTGT; The nucleotide sequence of enhancer EN2 is as SEQ ID Shown in NO.2: GTGATTCCTTCAAACTGATCTCCAGCCTCCACTGTCATTCATTCCTGGTGAGACTCCAATATCCACTGGGAAGCTCTATATCATAGTCTGCTGAGTGGTGCTGATATCAGAACTCTCCTCATGATAGCTGC TGTACAAAACAGGAGATAAGCTGGGACTAGATGAAGCAGAGGTCAGTAAGAAAAGAAGATGCACAGAGAAGGGACATACTCATGTTCACACCAGAAATAGAAGCAAGATCAGGGTTAGATTTCAGGACTTCTGAAACT; The nucleotide sequence of enhancer EN3 is shown in SEQ ID NO.3: CTTCAGAGAAGGATGCAAACCAAGCTTTGAGCACCCTTGTGGCACAGGCCCTGGGAATTACAAGAAGGGAGGCTCACTCCTAGCAGGTGGCTGGCTGAGATTGCCTGTGGGCAAAGCTGGCACTGGAGAACCCACGTGGCTCACGTCCCGTGGCTGGTCAGCAGCAGGCAGGCTCAGAGCCAGCCATGTGGGACTGTGTGTGTGAGCCATGCTGCAGATCCAGGAGCACCTGCTTTTAAATTGAGGCAAATTACTCTTCGTTCCTAGGCATACAGCGTGGTCTGCATGAAGTCATCAAGCTATCATCTTCTGAAACAAGGGAGACAACTGCTTACCCACTAAGGAGTCATGGAACACTCCCATGTATTCAGTATGGCAAGCACTCAGTCCAGTAACTTCTTACAGGAGCTCAGGTCCACTCTCCAGGAACCAGCTACCAGAAATAGGATGCTACATGAAATGCCTGAGCTGTCACTGTAGCAGAGTAAAGCTGACAACTGTGGTTTGAGCCTAGTGCAGTTTTAG; IGFBP5 The nucleotide sequence of the gene is shown in SEQ ID NO.4: ATGCTGCTGCGGCTCCTGGTGCTGCTGGGCGCCTGCCCGGGGCTCTCGCGGTGCCTGGGTTCCTTCGTTCAGTGCGAACCGTGCGACGGCAAAGCTCTGTCGCTGTGCCCTCCGCCGCCGCTGGGCTGCGAGCTGGTGAAGGAGCCGGGCTGCGGCTGCTGCCTCACCTGCGCCCTGCCCGCCGGGCAGCCCTGCGGCGTCTACACCGAGCGCTGCGCCCGAGGACTCCGCTGCCTGCCCCGCCAGGGCGAGGAGAAACCGCTGCACGCCCTGCTCCACGGCACCGCCGTCTGCCTCAGCGAGAAGAGCTACCGCGAGCAAGCCAAGGCCGAACGGGAATCCCGTGAGCATGAGGAGCCGACCACATCGGAGATGACGGAGGAGACCTACCCGCCCAAGGCCTACCGGCCCAAGCACGGCCGCCTCTCTGACCTCAAAGCTGAGGCCCTGAAGAAGGACCGCCGGAAGAAGCTGACCTTGGCCAAGTTTGTGGGCATGGCGGAGAACACGGCACATCCCCGCGTGGTCATCCCTGAGCTCCGGCAAGAGTTTGAGCTGGGCCCTTGCCGCAGGCACATGGAGGCCTCCCTGCAGGAGCTGAAGAGCAGCCAGAGGATGGTCCCCCGCGCTGTGCACCTCCCCAACTGCGACCGAAAGGGATTCTACAAGAGGAAGCAGTGCAAGCCCTCCCGGGGCCGGAAGCGTGGGCTGTGTTGGTGTGTGGACAAATATGGCATGAAGCTGCCGGGGACTGACTACCTGAGCGGAGACCTGCAGTGTCACGCATTCGACAGCAGCAACGTGGAG。

[0016] Example 1

[0017] 1. Materials and methods

[0018] 1.1 Experimental animals

[0019] In this experiment, 18-day-old Arbor Acre broiler (AA broiler) embryos were selected for the isolation of primary chicken intramuscular preadipocytes.

[0020] 1.2 Main Reagents

[0021] Type I collagenase: DMEM / F12 medium (Gibco), fetal bovine serum (Gibco), Lipofectamine 3000 (Invitrogen), Oil Red O staining solution (Solarbio), CCK-8 kit (Tongren Chemical), EdU kit (RiboBio), triglyceride ELISA kit (Beijing Pulilai Gene Technology Co., Ltd.), Trizol lysis buffer (TransGen), chloroform (Macklin), isopropanol (Sinopharm), 75% alcohol (Lircon), 4% neutral paraformaldehyde tissue fixative, RNase-free water, reverse transcription kit.

[0022] 1.3 Instruments

[0023] CO2 incubator (Thermo Fisher), laminar flow hood (Wujiang City Purification Equipment Factory), fluorescence microscope (Leica), real-time quantitative PCR instrument (Roche), micro nucleotide detector (Thermo Fisher), low-temperature high-speed centrifuge (Thermo Scientific), microplate reader (Rayto), autoclave (Panasonic), pipette (Eppendorf), ultra-low temperature freezer (Panasonic), low-temperature high-speed centrifuge (Thermo Scientific), laminar flow hood (Wujiang City Purification Equipment Factory).

[0024] 2. Isolation and culture of chicken intramuscular preadipocytes

[0025] 18-year-old AA broiler embryos were selected. The eggshells were wiped with 75% alcohol, and the embryos were removed by cracking the shells with sterile forceps. The pectoral muscle tissue was then removed with sterile scissors. The pectoral muscle tissue was quickly rinsed with PBS containing 1% antibiotics and 75% alcohol to remove impurities and then quickly minced into a paste. The minced pectoral muscle tissue was transferred to 50 mL centrifuge tubes. For every 5 mL of the paste, 4 times the volume of digestion solution was added (the digestion solution was prepared as follows: type I collagenase was added to 1 g of bovine serum albumin and 100 mL of DMEM / F12 basal medium, mixed thoroughly, and then dispensed into 50 mL tubes). The tubes were then placed in a 37°C water bath for 1 h of digestion, gently mixing every 5 min to ensure complete digestion of the pectoral muscle tissue. After 1 h of digestion, an equal volume of DMEM / F12 complete medium (containing 10% fetal bovine serum and 1% penicillin-streptomycin) was added to terminate the digestion. Undigested tissue fragments were removed by filtering through 100-mesh, 70-mesh, and 40-mesh filters, respectively. The cells were centrifuged at 1000 r / min for 3 min, and the cell pellet was collected. The cell pellet was resuspended in DMEM / F12 complete medium, and the cell suspension was seeded into T75 culture flasks and incubated at 37℃ and 5% CO2 for 2 h. Unattached cells were discarded, and the adherent intramuscular preadipocytes were retained. The culture medium was replaced with fresh DMEM / F12 complete medium and cultured at 37℃ and 5% CO2.

[0026] 3. Construction and transfection of enhancer-active interference vector

[0027] 3.1 Identification of enhancer activity using a dual-luciferase reporter system

[0028] The pGL3-promoter vector was selected as the reporter vector for firefly luciferase (FLuc), and enhancer sequences EN1, EN2, and EN3 were inserted. pRL-TK was selected as the internal control vector for renal luciferase (RLuc) to correct for experimental errors. The FLuc reporter vector and the RLuc internal control vector were co-transfected into chicken intramuscular preadipocytes. After 36 h of culture, the cells were lysed, and D-luciferin and coelentrin (using Stop & Glo reagent) were added sequentially to detect FLuc and RLuc activities stepwise. The enhancer activity was finally assessed by calculating the FLuc / RLuc ratio.

[0029] 3.2 Construction of Enhancer Active Interference Vector

[0030] Single-stranded guide RNA (sgRNA) sequences were designed using CRISPRscan software targeting the EN1, EN2, and EN3 sequences, respectively, and inserted into the gene-editing tool recombinant plasmid dCas9-KRAB-sgRNA-ENs to construct ENs activity interference vectors dCas9-KRAB-sgRNA-EN1, dCas9-KRAB-sgRNA-EN2, and dCas9-KRAB-sgRNA-EN3. dCas9-KRAB-empty served as a negative control vector. This series of plasmids achieves epigenetic regulation of specific genomic loci by fusing catalytically inactivated Cas9 (dCas9) protein with the KRAB (Krüppel associated box) transcriptional repressor domain. These plasmids were constructed by Yunzhou Biotechnology (Guangzhou) Co., Ltd.

[0031] 3.3 Cell transfection steps

[0032] When cell confluence reaches 90% or higher, cell passage can be performed. Wash with 1×PBS to remove residual culture medium, add 2 mL of 0.25% trypsin to the culture flask, let stand for 1 min until the cells detach and disperse by gentle agitation, then immediately add 5-6 mL of DMEM / F12 complete culture medium and gently pipette until the cells are dispersed. Collect the cell suspension, centrifuge to obtain the cell pellet, resuspend the cells, and seed them into cell culture plates. Incubate at 37°C in a 5% CO2 incubator. When the cells reach 70% confluence, perform plasmid transfection according to the instructions for Lipofectamine 3000 transfection reagent.

[0033] 4. Detection Indicators and Methods

[0034] 4.1 Cell proliferation capacity detection

[0035] 4.1.1 CCK-8 Method

[0036] Chicken intramuscular preadipocytes were seeded into 96-well plates with a final volume of 125 μL of complete culture medium per well. When the cell confluence reached 50%, the cells were transfected with dCas9-KRAB-empty and dCas9-KRAB-sgRNA-ENs recombinant plasmids. At 6 h, 18 h, 30 h and 42 h after transfection, 10 μL of CCK-8 reagent was added to each well. After gentle shaking and mixing, the cells were incubated at 37°C in the dark for 2 h. The absorbance at 450 nm was then measured immediately using a microplate reader.

[0037] 4.1.2 Flow cytometry

[0038] Intramuscular preadipocytes were seeded into 12-well plates. After transfection for 36 h, the cells were washed with 1×PBS, digested with 200 μL of trypsin, and transferred to 1.5 mL sterile centrifuge tubes. The cells were washed twice with 1×PBS and fixed overnight in 75% ethanol. In advance, 1 mL of sterile PBS, 20 µL of RNase A, and 25 µL of propidium iodide stock solution were added sequentially to the centrifuge tubes, vortexed, and set aside. The overnight fixed cells were centrifuged at 1000 rpm for 5 min, the supernatant ethanol was discarded, the cells were washed with PBS, and the supernatant was discarded. Then, 500 µL of the aforementioned propidium iodide staining solution was added to each tube to resuspend the cells, and incubated at room temperature in the dark for 30 min. Following the standard procedure, one sample was loaded at a time, and 20,000-30,000 viable cells in each sample were analyzed by flow cytometry. The proportion of cells in different cell cycles was analyzed using FlowJo software.

[0039] 4.1.3 EdU

[0040] After seeding cells into 24-well plates, when cell confluence reached 50%, recombinant plasmids dCas9-KRAB-empty and dCas9-KRAB-sgRNA-ENs were transfected. 24 hours after transfection, EdU experiments were performed according to the Ribobio EdU kit instructions: EdU reagent A was diluted 1:1000 with complete culture medium to prepare a working solution. After replacing the original culture medium, 500 μL of freshly diluted solution was added to each well, and the plates were incubated at 37°C with 5% CO2 for 1 hour. The staining effect was observed using a fluorescence microscope, and red EdU positive signals (proliferating cells) and blue Hoechst nuclear staining signals (total cells) were simultaneously captured. The percentage of positive cells was statistically analyzed to assess the proliferation level.

[0041] 4.2 Detection of adipogenic differentiation capacity

[0042] 4.2.1 Oil Red O staining

[0043] Chicken intramuscular preadipocytes were seeded into 6-well plates. When cell confluence reached 70%, they were transfected with dCas9-KRAB-empty and dCas9-KRAB-sgRNA-ENs plasmids, respectively. 24 h after transfection, the induction medium was replaced (50 mL DMEM / F12 complete medium with 400 μL oleic acid stock solution), and the cells were cultured for another 48 h. The treated cells were washed three times with PBS buffer, fixed with pre-chilled 4% paraformaldehyde for 40 min, the fixative was removed, and the cells were washed three times with PBS. Finally, the cells were stained with Oil Red O working solution for 30 min. The Oil Red O working solution was removed, and the cells were washed three times with PBS. 200 μL of PBS was added to each well to keep the cells moist, and the cells were observed and photographed under a fluorescence inverted microscope. The PBS was removed, and 500 μL of 100% isopropanol was added to each well. After standing for 10 min, the absorbance was measured at 500 nm using a microplate reader.

[0044] 4.2.2 Measurement of intracellular TG content

[0045] Discard the differentiation-inducing medium and gently wash the cells twice with PBS buffer. Then, add an appropriate amount of cell lysis buffer to each well and incubate on ice for lysis. During this procedure, place the culture plate on an ice bath for 15 min, gently pipetting every 5 min to promote complete cell lysis. Transfer the lysis buffer to centrifuge tubes and centrifuge at 12000 rpm for 10 min. Carefully aspirate the supernatant for later use. Measure the TG concentration according to the triglyceride (TG) assay kit instructions. Simultaneously, take an equal volume of lysis buffer sample and determine the total protein content using a BCA protein quantification kit. Finally, standardize the TG values ​​of each sample to the milligram of protein level to reflect the intracellular triglyceride content.

[0046] 5. Activity identification of enhancers

[0047] In chicken breast muscle tissue, all three enhancers (EN1, EN2, and EN3) exhibited highly active enhancer histone H3K27ac and H3K4me1 modifications. Figure 1 AC). The sequences of three enhancers (EN1, EN2, and EN3) were amplified and cloned into the pGL3-promoter reporter vector, which was then co-transfected with the pRL-TK plasmid into chicken intramuscular preadipocytes. Cells were collected 24 h later, and the activities of the three enhancers were detected using a dual-luciferase reporter system. The results showed that the relative luciferase activities of all three enhancers were significantly increased compared to the control group (PGL3-promoter + PRL-TK). Figure 1 D). It can be seen that all three tandem enhancers have transcriptional activation properties, thus forming a super enhancer.

[0048] 6. qPCR detection of the effect of interfering ENs activity on IGFBP5 gene mRNA expression

[0049] Single-stranded guide RNA (sgRNA) sequences (EN1: TGTGTTCCTGTTGTATGCGCAGG (SEQ ID NO.5); EN2: GGTGAGACTCCAATATCCACTGG (SEQ ID NO.6); EN3: TCGTTCCTAGGCATACAGCGTGG (SEQ ID NO.7)) were designed targeting enhancer sequences and ligated into the px330-dCas9-KRAB vector to construct adipocyte-specific enhancer activity interference recombinant vectors (dCas9-KRAB-sgRNA-ENs) and control vectors (dCas9-KRAB-empty). These vectors were transfected into chicken intramuscular preadipocytes with 70% confluence, and changes in IGFBP5 gene expression levels were detected. The results are as follows: Figure 2 As shown.

[0050] The results showed that the expression level of the IGFBP5 gene decreased significantly after interfering with the activity of EN1, EN2, and EN3, respectively, indicating that EN1, EN2, and EN3 can promote the post-transcriptional expression of the IGFBP5 gene.

[0051] 7. qPCR detection of the effect of interfering with ENs activity on the expression of cell proliferation marker genes

[0052] In chicken intramuscular preadipocytes, EN1, EN2, and EN3 were interfered with, and the effects of enhancers on cell proliferation were investigated using the following experiments: cell viability was assessed using the CCK-8 assay at 12 h, 24 h, 36 h, and 48 h after transfection; cell cycle changes were detected using propidium iodide (PI) staining combined with flow cytometry; cell proliferation was assessed using the EdU assay; and images were processed and analyzed using ImageJ software after fluorescence microscopy. The results are shown below. Figures 3-6 As shown.

[0053] The results showed that, compared with the control group (dCas9-KRAB-empty group), interference with EN1, EN2, and EN3 significantly reduced the mRNA expression levels of cell proliferation marker genes (including CDKN1A, CDK1, and PCNA). Figure 3 CCK-8 assay showed that interference with EN1, EN2, and EN3 significantly inhibited cell viability at 18, 30, and 42 hours. Figure 4 Flow cytometry analysis showed that interfering with the activity of EN1, EN2, and EN3 significantly reduced the number of cells in S phase. Figure 5 EdU assay results showed that interfering with the activity of EN1, EN2, and EN3 significantly reduced the cell proliferation rate. Figure 6 ).

[0054] These results indicate that EN1, EN2, and EN3 can promote the proliferation of intramuscular preadipocytes in chickens.

[0055] 8. Effect of Oil Red O staining on interfering ENs activity on adipogenic differentiation of chicken intramuscular preadipocytes

[0056] After interfering with the activities of EN1, EN2, and EN3, the effects of the enhancer on adipogenic differentiation of chicken intramuscular preadipocytes were investigated using the following experiments: When chicken intramuscular preadipocytes reached 70% confluence, the activities of EN1, EN2, and EN3 were interfered with by transfection with an enhancer activity-interfering recombinant vector (dCas9-KRAB-sgRNA-ENs). When cell confluence reached over 90%, adipogenic differentiation was induced with 160 μM sodium oleate, and the intracellular lipid droplet content was detected using Oil Red O staining. In addition, the intracellular triglyceride content was detected using ELISA, and the results are as follows: Figure 7 and Figure 8 As shown.

[0057] The results showed that, compared with the control group (dCas9-KRAB-empty), the intracellular lipid droplet accumulation and triglyceride content were significantly reduced due to interference from EN1, EN2, and EN3 activities. This indicates that EN1, EN2, and EN3 can promote adipogenic differentiation of preadipocytes in chicken muscle.

[0058] The above description is only a preferred embodiment of the present invention. It should be noted that for those skilled in the art, several improvements and modifications can be made without departing from the principle of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.

Claims

1. An enhancer for regulating the proliferation and adipogenic differentiation of chicken intramuscular preadipocytes, characterized in that, It includes one or more of enhancers EN1, enhancer EN2 and enhancer EN3, wherein the nucleotide sequence of enhancer EN1 is shown in SEQ ID NO.1; the nucleotide sequence of enhancer EN2 is shown in SEQ ID NO.2; and the nucleotide sequence of enhancer EN3 is shown in SEQ ID NO.

3.

2. The enhancer as claimed in claim 1, characterized in that, Used to activate IGFBP5 Gene transcription.

3. The application of the enhancer according to claim 1 in regulating the proliferation of chicken intramuscular preadipocytes, adipogenic differentiation of chicken intramuscular preadipocytes, or lipid deposition of chicken intramuscular preadipocytes.

4. A method for regulating preadipocytes in chicken muscle IGFBP5 Genes, characterized by, IGFBP5 The nucleotide sequence of the gene is shown in SEQ ID NO.4; overexpression IGFBP5 The gene can promote the proliferation, adipogenic differentiation and lipid deposition of preadipocytes in chicken muscle.

5. A version according to claim 4 IGFBP5 Application of genes in regulating the proliferation of preadipocytes in chicken muscle or in breeding.