Truncated mutant of ankrd11 and use thereof

By detecting ANKRD11 gene mutants and using a cell model with low p53 protein expression, we have solved the problems of early diagnosis and personalized intervention for KBG syndrome, realized early genetic diagnosis and personalized intervention for KBG syndrome, provided a basis for clinical diagnosis and prenatal diagnosis, broadened the spectrum of pathogenic genes, and laid the foundation for targeted therapy.

CN122104722APending Publication Date: 2026-05-29QINGDAO WOMEN & CHILDREN HOSPITAL
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
QINGDAO WOMEN & CHILDREN HOSPITAL
Filing Date
2026-03-10
Publication Date
2026-05-29

AI Technical Summary

Technical Problem

Existing technologies are insufficient to effectively resolve KBG syndrome caused by ANKRD11 gene mutations, lacking early diagnosis and personalized intervention strategies, as well as targeted treatment options.

Method used

We provide ANKRD11 gene mutants and related detection methods. We can detect ANKRD11 gene mutations using gene chips, primers and probes, construct a cell model with low p53 protein expression, and broaden the pathogenic gene spectrum of KBG syndrome.

Benefits of technology

This has enabled early genetic diagnosis and personalized intervention for KBG syndrome, provided a basis for clinical and prenatal diagnosis, enhanced our understanding of the disease, and laid the molecular foundation for targeted therapy.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122104722A_ABST
    Figure CN122104722A_ABST
Patent Text Reader

Abstract

The application belongs to the technical field of biology, and specifically discloses a truncated mutant of ANKRD11 and application thereof. The ANKRD11 gene mutant is any one of the following: a nucleic acid, wherein the nucleic acid has a target fragment, and the target fragment is compared with a wild-type ANKRD11 gene with a sequence of SEQ ID NO. 1, nucleotides from No. 1910 to No. 1913 are deleted; a polypeptide, wherein the polypeptide has a p.K637Tfs*15 mutation compared with a protein encoded by a wild-type ANKRD11 gene with a sequence of SEQ ID NO. 2. The application also relates to application of a reagent for detecting the aforementioned ANKRD11 gene mutant in screening of a KBG syndrome risk population. In the present disclosure, the pathogenic gene spectrum of the KBG syndrome is widened, the understanding of the disease is strengthened, experience is provided for clinical screening and diagnosis of the disease, and a basis is provided for prenatal diagnosis.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of biotechnology, and in particular relates to truncated mutants of ANKRD11 and their applications. Background Technology

[0002] KBG syndrome (KBGS) is a rare autosomal dominant multisystemic developmental disorder whose pathogenesis is closely related to the loss of function of the ANKRD11 gene (encoding ankyrin repeat domain protein 11, OMIM 611192). Various mutations in this gene, including frameshift mutations, nonsense mutations, missense mutations, splice site mutations, and microdeletions involving the 16q24.3 region of chromosome 16, can lead to abnormal ANKRD11 protein function, resulting in high heterogeneity in clinical manifestations. Major clinical features include short stature, distinctive facial features, macrodontia, neurodevelopmental delay, skeletal abnormalities, and epilepsy.

[0003] Of the reported cases of KBG syndrome worldwide, approximately 78.0% are caused by single-base mutations or small insertions / deletions in the ANKRD11 gene, while the remaining 22.0% are associated with 16q24.3 microdeletions. De novo variants account for the vast majority, representing approximately 81.9% of single-gene mutations and 75.0% of chromosomal deletions. In terms of mutation type distribution, frameshift mutations account for the highest proportion (approximately 65.2%), followed by nonsense mutations (approximately 27.3%), with other types of mutations being relatively less common. Furthermore, studies such as "The chromatinregulator Ankrd11 controls cardiac neural crest cell-mediated outflow tract remodeling and heart function," "Insights into the ANKRD11 variants and short-stature phenotype through literature review and ClinVar database search," and "ANKRD11 binding to cohesin suggests a connection between KBG syndrome and Cornelia de Lange syndrome" have all confirmed that abnormal ANKRD11 protein function is a sufficient condition for KBG syndrome. In-depth analysis of ANKRD11 gene mutants not only helps clarify the molecular pathogenesis of KBG syndrome, but also provides crucial scientific evidence for early genetic diagnosis, genetic counseling, and personalized intervention for this disease. Furthermore, functional studies based on ANKRD11 mutants can lay an important molecular foundation for developing targeted therapy strategies and screening specific drugs, demonstrating significant translational medical value and clinical application prospects. Summary of the Invention

[0004] To solve the above problems, the present invention adopts the following technical solution: The first aspect of the present invention provides an ANKRD11 gene mutant, wherein the ANKRD11 gene mutant is any one of the following: The nucleic acid has a target fragment, and the target fragment has a deletion of nucleotides AACA from 1910 to 1913 compared with the wild-type ANKRD11 gene with the sequence SEQ ID NO.1, i.e., the ANKRD11 gene c.1910_1913delAACA mutation; The polypeptide has the p.K637Tfs*15 mutation compared to the protein encoded by the wild-type ANKRD11 gene, which has the sequence SEQ ID NO.2.

[0005] Furthermore, the protein encoded by the wild-type ANKRD11 gene is the wild-type ANKRD11 protein. When the aforementioned c.1910_1913delAACA mutation occurs in the ANKRD11 gene, the 637th amino acid of the ANKRD11-encoded protein changes from lysine to threonine, resulting in a complete alteration of the entire amino acid sequence from position 637 onwards, and a premature stop codon appearing around position 652, causing premature termination of protein synthesis. In some cases, the mutant polypeptide has a segment with the amino acid sequence shown in SEQ ID NO.3, where the 637th amino acid is changed to threonine, and subsequent amino acids are also altered accordingly.

[0006] Regarding the effects of ANKRD11 gene mutants on organisms or organs: As an important nuclear transcriptional co-regulator, the dysfunction of ANKRD11 protein—usually caused by haploinadequacy due to gene mutation or inactivation of key functional domains—is sufficient to trigger disease phenotypes. Specifically, loss of ANKRD11 function first impairs its interactions with chromatin regulatory complexes (such as cohesin) and histone deacetylases (such as HDAC3), thereby disrupting chromatin structural stability and the coordination of target gene transcription programs. This molecular-level disruption further leads to decreased expression levels of downstream key regulatory genes (such as SETD5), impairing ribosome biosynthesis and global protein translation efficiency, thus affecting cell growth and metabolic homeostasis. At the developmental level, the aforementioned molecular and cellular cascade abnormalities specifically affect cell populations highly dependent on ANKRD11 function: impaired proliferation, differentiation, and migration of neural progenitor cells lead to abnormal brain structure, agenesis of the corpus callosum, and intellectual disability; dysregulation of the developmental program of craniofacial neural crest cells causes typical facial features (including prominent brow ridges and a broad nasal bridge); and impaired differentiation and growth of skeletal and dental progenitor cells manifest as delayed skeletal development, oblique fifth finger, and macrodontia. Therefore, ANKRD11 dysfunction, by disrupting the chromatin regulatory network and causing dysregulation of key developmental gene expression, impairs the normal developmental processes of multiple cell lineages, including neural, craniofacial, and skeletal cells, ultimately leading to the comprehensive clinical manifestations of KBG syndrome, including intellectual disability, distinctive facial features, skeletal abnormalities, and dental malformations.

[0007] It should be noted that the wild-type sequences mentioned in this article are generally common sequences. The aforementioned comparisons are based on specific sites. The sequence characteristics of the wild-type sequence itself should not affect the scope of this invention. The main purpose is to demonstrate the location of the novel mutation site. The emphasis is on the presence of this mutation, and it is not required that other sites must be consistent with the wild-type. In short, any site that has the novel mutation of this invention compared to the aforementioned wild-type sequence at a specific site should be considered within the scope of this invention, regardless of the issue of other sites.

[0008] A second aspect of the present invention provides the use of reagents for detecting the aforementioned ANKRD11 gene mutation in the preparation of products for screening individuals at risk of KBG syndrome.

[0009] Regarding the understanding of the risk population for KBG syndrome: The risk population for KBG syndrome refers to patients with KBG syndrome or those at risk of developing KBG syndrome.

[0010] The reagent for detecting the aforementioned ANKRD11 gene mutation can be any one of a gene chip, primers, or probes. By detecting the presence of the aforementioned ANKRD11 gene mutant in a sample (e.g., peripheral blood), it can be determined whether the sample originates from a patient with KBG syndrome or a high-risk group (formed and unformed fetuses are temporarily categorized as patients or high-risk groups). This is because the presence of the aforementioned ANKRD11 gene mutant necessarily indicates that the tested individual has KBG syndrome or is at risk. More specifically, the reagent for detecting the aforementioned ANKRD11 gene mutant is at least one of a probe or primer specifically targeting the aforementioned ANKRD11 gene mutant, and may also be other methods such as Sanger sequencing, NGS sequencing, etc. (all within the scope of the claims of this invention). The primers are generally primer pairs: forward primer: 5'GGGAGGATGACAGGGACTCT3', reverse primer: 5'GGTCGCGATCGTGCTTTAAC3'.

[0011] The test reagent is used to analyze whether the aforementioned ANKRD11 gene mutation is detected in peripheral blood samples. It can be directly analyzed by analyzing whether the aforementioned specific mutation is present in the peripheral blood samples of the tested population.

[0012] A third aspect of this invention provides a method for constructing a cell model with low p53 protein expression; the method involves transfecting a plasmid overexpressing the c.1910_1913delAACA mutant ANKRD11 into a tool cell line. This method provides a novel cell model that can obtain low p53 protein expression, which can be used as a research model for scientific research purposes.

[0013] Regarding the tool cell line: the tool cell line is HEK293 cells; transfection was performed using the Lipofectamine™ 3000 transfection kit. Specifically, regarding plasmid construction and transfection methods, existing techniques can be directly employed.

[0014] This disclosure broadens the pathogenic gene spectrum of KBG syndrome, enhances the understanding of the link between the ANKRD11 gene and KBG syndrome, strengthens clinicians' understanding of the disease, provides experience for clinical screening and diagnosis of the above-mentioned diseases, and also provides a basis for prenatal diagnosis. Attached Figure Description

[0015] Figure 1 A schematic diagram of the pedigree of KBG patients; Figure 2 Sanger sequencing validation peak diagram of the c.1910_1913delAACA mutation site in the ANKRD11 gene of the KBG proband and his parents; Figure 3 This is a diagram showing the expression of the c.1910_1913delAACA mutant of the ANKRD11 gene and related p53 protein. Detailed Implementation

[0016] The present invention will be further described in detail below with reference to specific research examples. However, it should not be construed that the scope of the present invention is limited to the following embodiments.

[0017] I. Research on pathogenic genes and mutation sites 1. Sample collection: The inventor collected a family history of KBG syndrome, such as Figure 1 As shown, □ represents a normal male, ○ represents a normal female, ● represents a female with the disease, and ↗ represents a proband. All family members involved in this invention research signed informed consent forms. The inventors collected peripheral blood samples from patients and normal individuals within the aforementioned KBG syndrome families.

[0018] The proband was a 1-year-3-month-old female patient who had developmental delays since birth. She could not crawl on her hands and knees, sit up in bed, or express herself by word. She had a fistula and fibroids in the right preauricular region, poor motor coordination, normal muscle tone in her limbs, and average cognitive level. She also had right-sided sensorineural hearing loss. MRI showed patchy long T2 signals around the bilateral lateral ventricles.

[0019] 2. Whole exome sequencing The inventors used the Roche KAPA HyperExome in conjunction with the MGI-DNB-T7 sequencing platform to perform whole-exome sequencing on the proband in this family. The target region coverage was >99.80%, the proportion of sites with a depth greater than 20× in the target region was >99.48%, and the average sequencing depth was approximately 280×.

[0020] 2.1 Sample Preparation Peripheral blood was collected from the proband and their parents in the aforementioned families, and peripheral blood DNA was extracted using the Qiagen Blood DNA minikit 1.2.1 kit (Qiagen, Germany). Quantification was performed using Qubit, ensuring that at least 2 μg of each DNA sample was used for whole-exome sequencing. 2.2 Library construction and sequencing DNA samples were randomly fragmented into 150-200 bp fragments using an E220 Covaris instrument. Following the manufacturer's instructions, fragment sizes were selected using AMPure XP Beads, followed by end repair, phosphorylation, and α-tailing. BGISEQ-500 platform-specific adapters were ligated to the α-tail fragments, the ligated fragments were purified, and amplified by PCR. Finally, the fragments were cycled to generate single-stranded DNA circulars. After quantitative identification, the library was sequenced.

[0021] 3. Variant detection, annotation, and database comparison; sequencing results and analysis. Whole-genome sequencing was performed on the proband and their parents. Sequencing data were matched against the SPAST genome reference using the Burrows-Wheeler alignment tool and annotated using snpEff 3 and the dbSNP database. First, all identified variants were screened using the dbSNP database, ExAC, HapMap database, 1000 genomes, and a local database of 100 healthy Chinese adults. Variants with a MAF > 0.01 in healthy individuals were removed. Then, all filtered variants were compared with the OMIM and CGD databases to identify gene variants associated with the disease phenotype.

[0022] Whole-exome sequencing analysis of the proband revealed a heterozygous variant, c.1910_1913del, in exon 9 of the ANKRD11 gene. This frameshift mutation involved the deletion of nucleotides AACA from 1910 to 1913, resulting in a change from lysine to threonine at amino acid position 637 of the encoded protein. This altered the entire amino acid sequence from position 637 onwards, and prematurely introduced a stop codon around position 652, causing premature termination of protein synthesis and affecting normal translation (p.K637Tfs*15) (PVS1). This variant had no reported frequency in the normal reference population gene database (allele frequency gnomAD:.) (PM2_PP). This variant was a de novo variant in this family (PS2_PP). Based on the aforementioned evidence, and in accordance with the ACMG (The American College of Medical Genetics and Genomics) variant classification guidelines, this variant has been further identified as a pathogenic variant (ACMG: PVS+2PP).

[0023] 4. Sanger sequencing verification The ANKRD11 gene was sequenced in patients and their parents (normal individuals) within the family. Based on the sequence determination results, whether the mutation was wild-type or mutant, the correlation between the c.1910_1913delAACA heterozygous mutation of the ANKRD11 gene and KBG syndrome was verified. The specific methods and steps are as follows: 1) DNA extraction Genomic DNA was extracted from the peripheral blood of the proband and his / her parents for later use.

[0024] 2) Primer design and PCR reaction Referring to the human genome sequence database GRCh37.1 / ANKRD11, specific primers targeting the c.1910_1913delAACA mutation site with the nucleotide sequence shown below were designed, as detailed in the table below.

[0025] The extracted DNA was used as a template to perform a PCR reaction with the above-mentioned specific primers according to conventional methods in the art, and the purified PCR product was sequenced.

[0026] The PCR amplification products obtained from the patient and their parents were sequenced for DNA. Based on the sequencing results, the ANKRD11 gene coding sequence of the above samples was compared. The results showed that the proband carried a heterozygous c.1910_1913delAACA mutation, while the parents of the normal proband did not carry this mutation. Therefore, it was preliminarily determined that this mutation is the pathogenic site of KBG syndrome.

[0027] 3) Test kit Prepare a detection kit containing primers suitable for ANKRD11 gene mutants (compared to SEQ ID NO.1, the ANKRD11 gene mutants have the c.1910_1913delAACA mutation) for screening biological samples susceptible to KBG syndrome, wherein these primers include the aforementioned ANKRD11 gene-specific primers.

[0028] The specific steps for screening biological samples susceptible to KBG syndrome using the above kit are as follows: DNA is extracted from the subject; the extracted DNA is used as a template to perform a PCR reaction with the above-mentioned specific primers; the PCR product is purified according to conventional methods in the art; the purified product is sequenced; and then the sequence is observed to determine if it contains c.1910_. The 1913delAACA mutation can be used to effectively detect whether a subject is susceptible to KBG syndrome.

[0029] 5. In vitro experiments to verify protein expression levels: 1) Plasmid construction: Overexpression plasmids for wild type and c.1910_1913delAACA mutant ANKRD11 were constructed and provided by Sangon Biotech (Shanghai) Co., Ltd.

[0030] 2) Cell transfection: HEK293 cells were cultured in 1×DMEM basic solution with 10% fetal bovine serum and 1% ampicillin-streptomycin added. Transfection was performed using the Lipofectamine™ 3000 transfection kit according to the manufacturer's instructions.

[0031] 3) Protein extraction and Western blot: Cells were washed with PBS buffer and lysed using RIPA lysis buffer on ice for 5 minutes. The samples were sonicated and centrifuged at 10,000 × g for 10 minutes at 4°C, and the supernatant was collected. The samples were diluted with 5× loading buffer and heated at 98°C for 10 minutes. Protein samples were separated using a 4%–12% SDS-PAGE gel and protein electrophoresis system according to the manufacturer's instructions.

[0032] Experimental results are as follows Figure 3As shown, this mutation results in the production of a truncated protein, impairing its function and leading to abnormal function of the protein encoded by ANKRD11, further confirming its pathogenicity. Furthermore, this truncated protein causes a decrease in p53 protein expression levels. Previous studies have shown that ANKRD11 can activate the p53 signaling pathway, while the loss-of-function mutation in this study leads to the loss of ANKRD11 activity, thereby weakening its regulatory effect on p53 and ultimately causing downregulation of p53 expression. This molecular mechanism provides direct evidence for explaining the pathological process of KBG syndrome caused by this mutation.

[0033] II. Introduction and Application Cases of Mutants Here is a brief introduction to the clinical applications of this type of product. It can be used to analyze the obtained samples for testing. By analyzing whether the sample has specific mutations, it can determine whether the sample source has a certain disease or is a high-risk group, thus providing a reference for clinical diagnosis and treatment. In particular, it provides better guidance in preconception screening, and can screen for potential serious diseases in the fetus during pregnancy to provide accurate advice.

[0034] In clinical applications, the general steps are as follows: S1, extracting nucleic acid samples from biological samples (the samples in this step can also be provided directly by the testing party). The type of biological sample is not particularly limited, as long as a nucleic acid sample reflecting the presence of an ANKRD11 mutation in the biological sample can be extracted. The biological sample can be at least one selected from human blood, skin, or subcutaneous tissue, preferably peripheral blood. This facilitates sampling and testing, thereby further improving the efficiency of screening biological samples susceptible to KBG syndrome. It should be noted that the term "nucleic acid sample" used in this section should be interpreted broadly; it can be any sample that reflects the presence of an ANKRD11 mutation in the biological sample. For example, it can be whole-genome DNA directly extracted from the biological sample, or a portion of the whole genome containing the ANKRD11 coding sequence, total RNA extracted from the biological sample, or mRNA extracted from the biological sample. This expands the range of biological sample sources and allows for the simultaneous determination of multiple information from the biological sample, thereby improving the efficiency of screening biological samples susceptible to KBG syndrome. Furthermore, for the use of RNA as a nucleic acid sample, the extraction of nucleic acid samples from biological samples further includes: extracting RNA samples from biological samples, preferably mRNA; and obtaining cDNA samples based on the obtained RNA samples through reverse transcription, with the obtained cDNA samples constituting the nucleic acid samples. This can further improve the efficiency of using RNA as a nucleic acid sample to screen biological samples susceptible to KBG syndrome. S2. After obtaining the nucleic acid samples, the nucleic acid samples are analyzed to determine their nucleic acid sequences; the methods and equipment for determining the nucleic acid sequences are not particularly limited. The nucleic acid sequences of the nucleic acid samples can be determined through sequencing.The methods and equipment used for sequencing are not particularly limited; second-generation sequencing technology, as well as third-generation, fourth-generation, or more advanced sequencing technologies, can be used. At least one device selected from HISEQ2000, SOLID, 454, ABI3730, and single-molecule sequencing devices can be used to sequence nucleic acid sequences. Thus, by combining the latest sequencing technologies, high sequencing depth can be achieved for single sites, significantly improving detection sensitivity and accuracy. Therefore, the high-throughput, deep sequencing capabilities of these devices can be utilized to further improve the efficiency of nucleic acid sample detection and analysis, thereby enhancing the accuracy of subsequent sequencing data analysis. And accuracy; therefore, determining the nucleic acid sequence of a nucleic acid sample can further include: first, constructing a nucleic acid sequencing library for the obtained nucleic acid sample; and sequencing the obtained nucleic acid sequence library to obtain data results composed of multiple sequencing data; it should be noted that the term "nucleic acid sequence" used in this section should be interpreted broadly, which can be the complete nucleic acid sequence information obtained after assembling the sequencing data obtained by sequencing the nucleic acid sample, or it can be the sequencing data (reads) obtained by sequencing the nucleic acid sample directly as the nucleic acid sequence, as long as these nucleic acid sequences contain the coding sequence corresponding to ANKRD11. S3, after determining the nucleic acid sequence of the nucleic acid sample, the nucleic acid sequence of the obtained nucleic acid sample is compared with the sequence of SEQ ID NO.1. If the obtained nucleic acid sequence has the c.1910_1913delAACA mutation, it indicates that the biological sample is susceptible to KBG syndrome (it can also be determined that the method also uses "a kit for screening biological samples with KBG syndrome" and "a reagent for detecting nucleic acids and / or peptides in the preparation of kits or devices").

[0035] Therefore, the method for screening biological samples susceptible to KBG syndrome according to embodiments of the present invention can effectively screen biological samples susceptible to KBG syndrome. The method and equipment for comparing nucleic acid sequences with SEQ ID NO.1 are not particularly limited and can be performed using any conventional software. Unless otherwise specified, the technical means used in the embodiments are conventional means familiar to those skilled in the art and can be performed with reference to *Molecular Cloning: A Laboratory Manual*, 3rd edition, or related products. All reagents and products used are commercially available. Various processes and methods not described in detail are conventional methods known in the art. The source, trade name, and components of reagents used, if necessary, are indicated upon their first appearance. Subsequent use of the same reagents, unless otherwise specified, are identical to the initial indication.

[0036] Those skilled in the art will appreciate that various modifications can be made to the above embodiments without departing from the overall spirit and concept of the present invention. For any aspects not detailed herein, reference can be made to the prior art. All such modifications fall within the protection scope of the present invention. The protection scheme of the present invention is defined by the appended claims.

Claims

1. A mutant of ANKRD11 gene, characterized in that, The ANKRD11 gene mutant is any of the following: Nucleic acid having a target fragment, wherein the target fragment has nucleotides AACA from number 1910 to 1913 deleted compared to the wild-type ANKRD11 gene with the sequence SEQ ID NO.1; The polypeptide has the p.K637Tfs*15 mutation compared to the protein encoded by the wild-type ANKRD11 gene, which has the sequence SEQ ID NO.

2.

2. The ANKRD11 gene mutant according to claim 1, characterized in that, The protein encoded by the wild-type ANKRD11 gene is the wild-type ANKRD11 protein.

3. The use of the reagent for detecting the ANKRD11 gene mutation in claim 1 in the preparation of products for screening individuals at risk of KBG syndrome.

4. The application according to claim 3; wherein, The reagent for detecting the ANKRD11 gene mutant in claim 1 is any one of a gene chip, primers, or probes.

5. The application according to claim 4; wherein, The primers are primer pairs: forward primer: 5'GGGAGGATGACAGGGACTCT3', reverse primer: 5'GGTCGCGATCGTGCTTTAAC3'.

6. The application according to claim 4; wherein, The reagent is used to analyze the presence of the ANKRD11 gene mutant in peripheral blood samples as described in claim 1.

7. The application according to claim 3; wherein, The at-risk population for KBG syndrome refers to patients with KBG syndrome or those at risk of developing KBG syndrome.

8. A method for constructing a cell model with low p53 protein expression; characterized in that, The overexpression plasmid of c.1910_1913delAACA mutant ANKRD11 was transfected into the tool cell line.

9. The method for constructing a cell model with low p53 protein expression according to claim 8; characterized in that, The cell line used was HEK293; transfection was performed using the Lipofectamine™ 3000 transfection kit.