Application of hsa-miR-148b-5p in the preparation of drugs for treating malignant tumors and sensitizing chemotherapy

Abstract

This invention discloses the application of hsa-miR-148b-5p in the preparation of chemotherapy drugs for treating malignant tumors and for enhancing chemotherapeutic efficacy, belonging to the field of biomedical technology. This invention is the first to demonstrate that hsa-miR-148b-5p can reverse the resistance of tumor cells to chemotherapy drugs. In vitro cell experiments show that hsa-miR-148b-5p mimic has a synergistic effect when used in combination with cisplatin or oxaliplatin, significantly enhancing the killing effect of chemotherapy drugs on tumor cells. In vivo PDX mouse models further validate that the combined use of hsa-miR-148b-5p mimic and cisplatin can synergistically inhibit tumor growth, with the tumor growth inhibition rate in the combined treatment group being significantly higher than that in the single-drug treatment group. This invention provides a new technical solution for overcoming chemotherapy resistance in malignant tumors and has significant clinical translational value.

Description

Technical Field

[0001] This invention relates to the field of biomedicine, and in particular to the application of hsa-miR-148b-5p in the preparation of drugs for treating malignant tumors and for enhancing chemotherapy sensitivity. Background Technology

[0002] Malignant tumors are a major disease that seriously threatens human life and health, with high incidence and mortality rates. Taking lung cancer as an example, non-small cell lung cancer (NSCLC) accounts for approximately 85% of all lung cancer cases, making it the leading cause of cancer-related death. Currently, clinical treatment for advanced or metastatic solid tumors (such as lung cancer, liver cancer, colorectal cancer, breast cancer, and gastric cancer) mainly relies on chemotherapy, targeted therapy, and immunotherapy. However, tumor cells readily develop drug resistance during treatment, leading to a significant decrease in drug efficacy, which is one of the core bottlenecks causing patient recurrence and poor prognosis. Although some progress has been made in drug development targeting specific molecular targets in recent years, most patients still face the dilemma of limited treatment options and the lack of effective regimens after drug resistance develops.

[0003] In exploring new strategies to overcome tumor drug resistance, microRNAs (miRNAs) have attracted significant attention due to their ability to regulate the expression of oncogenes or tumor suppressor genes at the posttranscriptional level. Studies have shown that aberrant expression of many miRNAs in tumor tissues is closely related to tumor development and chemotherapy resistance. One study reported that hsa-miR-148b-5p is downregulated in tumors such as non-small cell lung cancer and gastric cancer, and its low expression level is statistically correlated with advanced tumor progression, radiotherapy resistance, and poor prognosis. However, these studies mainly focus on correlation analysis and prognostic assessment, and have not yet deeply elucidated the molecular mechanisms by which it directly regulates drug resistance-related targets, nor have they provided functional evidence for its use as a therapeutic molecule, especially in combination with chemotherapeutic drugs to reverse drug resistance.

[0004] Therefore, although existing technologies suggest that hsa-miR-148b-5p may be related to tumor suppression, there is still a lack of clear technical solutions and experimental verification regarding whether it can be used directly as an active ingredient to prepare drugs for treating various malignant tumors, whether it can synergistically inhibit tumor growth by sensitizing chemotherapeutic drugs, and how to achieve effective delivery and combination therapy in vivo and in vitro. This has resulted in the potential pharmaceutical value of hsa-miR-148b-5p not being effectively developed and difficult to apply directly in clinical practice. Based on this, there is an urgent need in the field to provide a feasible technical solution that can clearly define the therapeutic function of hsa-miR-148b-5p and achieve its synergistic application with chemotherapeutic drugs, in order to provide a new treatment approach to overcome chemotherapy resistance in malignant tumors. Summary of the Invention

[0005] The purpose of this invention is to provide the application of hsa-miR-148b-5p in the preparation of chemotherapy drugs for treating malignant tumors and sensitizing chemotherapy, thereby solving the problems existing in the prior art. This invention is the first to demonstrate that hsa-miR-148b-5p can specifically bind to the 3'UTR of the ABCC1 gene, negatively regulating its expression, thereby reversing tumor chemotherapy resistance. In vitro and in vivo experiments show that hsa-miR-148b-5p has a synergistic effect when used in combination with cisplatin or oxaliplatin, significantly enhancing the killing effect on non-small cell lung cancer, providing a new technical solution for overcoming chemotherapy resistance in malignant tumors.

[0006] To achieve the above objectives, the present invention provides the following solution: This invention provides the use of hsa-miR-148b-5p in the preparation of a medicament for improving the sensitivity of malignant tumor cells to chemotherapeutic drugs, reversing chemotherapy resistance in malignant tumors, and / or for combination therapy with chemotherapeutic drugs for the treatment of malignant tumors. The hsa-miR-148b-5p includes a mature sequence, a precursor sequence, or a mimic of hsa-miR-148b-5p. The mature sequence of hsa-miR-148b-5p is shown in SEQ ID NO.1. The precursor sequence of hsa-miR-148b-5p is shown in SEQ ID NO.2. The mimic of hsa-miR-148b-5p includes a guide strand with a sequence shown in SEQ ID NO.3 and a follower strand with a sequence shown in SEQ ID NO.4.

[0007] Optionally, the lung cancer includes non-small cell lung cancer.

[0008] Optionally, the chemotherapy drugs include cisplatin and oxaliplatin.

[0009] Optionally, the chemotherapy resistance includes the malignant tumor's resistance to cisplatin and oxaliplatin during chemotherapy.

[0010] The present invention also provides a pharmaceutical composition for treating malignant tumors, the active ingredient being hsa-miR-148b-5p and cisplatin or hsa-miR-148b-5p and oxaliplatin; wherein hsa-miR-148b-5p comprises a mature sequence, a precursor sequence, or an analogue of hsa-miR-148b-5p; the mature sequence of hsa-miR-148b-5p is shown in SEQ ID NO.1; the precursor sequence of hsa-miR-148b-5p is shown in SEQ ID NO.2; the analogue of hsa-miR-148b-5p comprises a guide strand with a sequence shown in SEQ ID NO.3 and a follower strand with a sequence shown in SEQ ID NO.4.

[0011] Optionally, the lung cancer includes non-small cell lung cancer.

[0012] Optionally, the dosage form of the pharmaceutical composition may be a tablet, capsule, granule, injection, sustained-release formulation, or targeted formulation.

[0013] Optionally, the pharmaceutical composition may further include a pharmaceutically acceptable carrier and excipients.

[0014] The present invention discloses the following technical effects: This invention is the first to demonstrate that hsa-miR-148b-5p can be used directly as an active ingredient in the preparation of drugs for treating malignant tumors, and clarifies its synergistic sensitizing effect when used in combination with chemotherapeutic drugs. Dual-luciferase reporter assays confirmed that hsa-miR-148b-5p specifically binds to the 3'UTR region of the ABCC1 gene, negatively regulating the expression of this drug resistance-related transporter at the posttranscriptional level, providing a clear molecular mechanism for reversing tumor chemotherapeutic resistance. Plate colony formation assays showed that hsa-miR-148b-5p mimic alone significantly inhibited the proliferation of non-small cell lung cancer cells A549 and H1299. When used in combination with cisplatin or oxaliplatin, King's Q analysis indicated a synergistic effect, significantly enhancing the killing effect on tumor cells without increasing the dosage of chemotherapeutic drugs.

[0015] Furthermore, this invention further validated the in vivo antitumor effect of hsa-miR-148b-5p using a non-small cell lung cancer PDX mouse model. The results showed that hsa-miR-148b-5p mimic, delivered via the nanocarrier CABRi, synergistically inhibited tumor growth when combined with cisplatin. The tumor growth inhibition rate in the combination therapy group reached 75.3%, significantly higher than that in the monotherapy group. Simultaneously, the expression level of ABCC1 protein in tumor tissue of the combination therapy group was significantly downregulated, further confirming its molecular mechanism of chemosensitizing. This invention provides a new technical solution for overcoming chemotherapy resistance in malignant tumors and has significant clinical translational value. Attached Figure Description

[0016] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0017] Figure 1 The predicted binding site of hsa-miR-148b-5p to the drug resistance-related gene ABCC1 (A) and the validation results of the dual-luciferase reporter system (B). Figure 2The results of detecting the growth inhibition rate of A549 cells by combined administration of hsa-miR-148b-5p mimic and cisplatin; Figure 3 The results of detecting the growth inhibition rate of A549 cells by combined administration of hsa-miR-148b-5p mimic and oxaliplatin; Figure 4 The results of detecting the growth inhibition rate of A549 cells by combined administration of hsa-miR-148b-5p mimic and gefitinib; Figure 5 The results of detecting the growth inhibition rate of H1299 cells by combined administration of hsa-miR-148b-5p mimic and cisplatin; Figure 6 The results of detecting the growth inhibition rate of H1299 cells by combined administration of hsa-miR-148b-5p mimic and oxaliplatin; Figure 7 The results of detecting the growth inhibition rate of H1299 cells by combined administration of hsa-miR-148b-5p mimic and gefitinib; Figure 8 The results show the tumor growth inhibition rate of PDX model mice after combined administration of hsa-miR-148b-5p mimic and cisplatin; A is the animal experiment flowchart; B is the result of EMSA assay to detect the binding efficiency of the nanocarrier CABRi with hsa-miR-148b-5p mimic; C is the photograph of the subcutaneous tumor volume of mice in each group after drug treatment; D is the change in subcutaneous tumor volume and the statistical analysis of subcutaneous tumor weight before and after drug administration; E is the statistical analysis of subcutaneous tumor weight before and after drug administration; F is the tumor immunoblotting results of mice in each group after drug treatment. Detailed Implementation

[0018] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as a limitation of the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0019] It should be understood that the terminology used in this invention is merely for describing particular embodiments and is not intended to limit the invention. Furthermore, with respect to numerical ranges in this invention, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Any stated value or intermediate value within a stated range, as well as each smaller range between any other stated value or intermediate value within said range, is also included in this invention. The upper and lower limits of these smaller ranges may be independently included or excluded from the range.

[0020] Unless otherwise stated, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. While only preferred methods and materials have been described herein, any methods and materials similar or equivalent to those described herein may be used in the implementation or testing of this invention. All references to this specification are incorporated by way of citation to disclose and describe methods and / or materials associated with those references. In the event of any conflict with any incorporated reference, the content of this specification shall prevail.

[0021] Various modifications and variations can be made to the specific embodiments described in this specification without departing from the scope or spirit of the invention, as will be apparent to those skilled in the art. Other embodiments derived from this specification will also be apparent to those skilled in the art. This specification and embodiments are merely exemplary.

[0022] The terms “include,” “including,” “have,” “contain,” etc., used in this article are all open-ended terms, meaning that they include but are not limited to.

[0023] The mature hsa-miR-148b-5p sequence, the precursor hsa-miR-148b-5p sequence, and the mimic hsa-miR-148b-5p sequence involved in this invention are shown below: Mature hsa-miR-148b-5p sequence: AAGUUCUGUUAUACACUCAGGC (SEQ ID NO.1); The precursor sequence hsa-miR-148b-5p, or stem-loop hsa-mir-148bS, is: caagcacgauuagcauuugaggugAAGUUCUGUUAUACACUCAGGCuguggcucucugaaagUCAGUGCAUCACAGAACUUUGUcucgaaagcuuucua (SEQ ID NO.2). The mimic sequence of the analog hsa-miR-148b-5p is as follows: Guide strand: 5'-3' AAGUUCUGUUAUACACUCAGGC (SEQ ID NO.3), Follower strand: 5'-3' GCCUGAGUGUAUAACAGAACUU (SEQ ID NO.4). Studies have shown that chemotherapy resistance in various tumor cells is closely related to the abnormal expression of drug efflux-related transport proteins. In a specific embodiment of this invention, the inventors further explored the role of hsa-miR-148b-5p in regulating tumor cell drug resistance-related molecules to elucidate its potential mechanism for enhancing chemosensitivity.

[0024] Example 1: Experimental verification of the regulatory effect of hsa-miR-148b-5p on the expression of the drug resistance-related gene ABCC1 In this embodiment, the chemoresistant transporter ABCC1 was selected as a candidate research object, and the binding site between hsa-miR-148b-5p and ABCC1 was predicted using TargetScan. Figure 1 ABCC1 3'UTR-WT reporter vector containing the hsa-miR-148b-5p binding site and ABCC1 3'UTR-Mut reporter vector with a mutated hsa-miR-148b-5p binding site were constructed, respectively. The wild-type and mutant ABCC1 3'UTRs were cloned into the psiCHECK-2 vector containing Renilla luciferase. Rluc The multiple cloning site downstream of the gene stop codon is the core principle of this vector system: when RNA interference (RNAi) is initiated against the target gene, it triggers specific cleavage and subsequent degradation of the fusion mRNA. This is achieved through detection... Rluc The degree of decrease in activity can be conveniently quantified to assess the strength of the RNAi effect. Simultaneously, the psiCHECK-2 vector carries artificially synthesized firefly luciferase. Fluc )Gene, Rluc Signal can be transmitted Fluc The signal was standardized and corrected to eliminate interference from irrelevant factors such as differences in transfection efficiency, ensuring the reliability of the experimental results. Based on this, the targeting and binding relationship between hsa-miR-148b-5p and ABCC1 3'UTR was verified using a luciferase reporter assay.

[0025] The wild-type 3' UTR sequence of the ABCC1 gene containing the hsa-miR-148b-5p binding site is as follows: GCUGGCAUAUCUGGUCAGAACUG (SEQ ID NO. 5).

[0026] The 3'UTR sequence of the ABCC1 gene containing the hsa-miR-148b-5p binding site mutation is as follows: GCUGGCAUAUCUGGUGUCUUGAG (SEQ ID NO. 6).

[0027] I. Experimental Methods 1. Cell transfection, lysis and sample preparation One day in advance, cells were seeded in 24-well culture plates. Transfection was performed when the cell density reached 70-80%. The two reporter vectors mentioned above were co-transfected into 293T cells with a plasmid overexpressing hsa-pri-miR-148b-5p, and changes in intracellular luciferase activity were detected. 48 h after transfection, the culture medium in the wells was aspirated, and each well was gently washed three times with 500 μL of PBS buffer to thoroughly remove any residual culture medium. Then, 100 μL of 1×PLB diluted in PBS was added to each well, and the culture plate was placed on a shaker at room temperature for 30 min to lyse the cells. After lysis, the lysis buffer was transferred to 1.5 mL centrifuge tubes and centrifuged at 12000 g for 5 min at 4°C. Finally, the supernatant was transferred to new 1.5 mL centrifuge tubes for later use.

[0028] 2. Dual-luciferase activity assay The experiment used the Promega Dual-Glo® dual-luciferase assay system. Before the experiment, Luciferase Assay buffer and Stop&Glo buffer were prepared in advance. During the assay, 20 μL of the supernatant was added to each well of a 96-well plate. After turning on the instrument, it was rinsed three times each with 70% ethanol and double-distilled water. Then, the prepared Luciferase Assay buffer and Stop&Glo buffer were connected to pipes 2 and 3 of the instrument, respectively. The 96-well plate was placed in the instrument, and the assay program was started. After the assay was completed, the plate was rinsed three more times with 70% ethanol and double-distilled water to maintain the instrument.

[0029] II. Experimental Results Experimental results showed that hsa-miR-148b-5p significantly inhibited the luciferase activity of the ABCC1 3'UTR-WT reporter vector, but had no significant inhibitory effect on the ABCC1 3'UTR-Mut reporter vector. Figure 1 The B), suggests that hsa-miR-148b-5p can participate in the regulation of its expression by binding to the ABCC1 3'UTR region.

[0030] The results of this embodiment demonstrate that hsa-miR-148b-5p can specifically recognize and bind to the 3'UTR region of ABCC1 mRNA, thereby negatively regulating ABCC1 gene expression at the posttranscriptional level. This provides direct evidence for the mechanism by which hsa-miR-148b-5p enhances the sensitivity of tumor cells to chemotherapeutic drugs by inhibiting the expression of drug resistance-related transporters. It should be noted that this mechanism is only one possible explanation for the technical effects of this invention, and the scope of protection of this invention is not limited thereto.

[0031] Example 2: Inhibitory effect of hsa-miR-148b-5p mimic combined with chemotherapy drugs on the growth of non-small cell lung cancer cells. This embodiment uses a plate colony formation assay to detect the effect of hsa-miR-148b-5p mimic alone and in combination with different chemotherapy drugs (cisplatin, oxaliplatin, gefitinib) on the growth inhibition of human non-small cell lung cancer cell lines A549 and H1299, and uses the King's Q value method to evaluate the synergistic effect of the combined drugs.

[0032] I. Experimental Methods 1. Cell Culture Human non-small cell lung cancer cells A549 and H1299 (purchased from the Cell Bank of the Chinese Academy of Sciences Type Culture Collection Committee) were routinely cultured in RPMI-1640 complete medium containing 10% FBS and 1% penicillin-streptomycin at 37°C and 5% CO2. Cells in the logarithmic growth phase and in good condition were used for experiments.

[0033] 2. Cell inoculation The day before the experiment, when the cell density reached 80%-90% and the cells were in good condition, the culture medium was discarded, and the cells were washed once with PBS. 0.05% trypsin was added to digest the cells, which were then dispersed and collected into 15 mL centrifuge tubes. The cells were centrifuged at 800 g for 5 min, the supernatant was discarded, and the cells were resuspended in fresh complete culture medium. The cells were counted three times using a hemocytometer, and the average value was used to prepare a single-cell suspension of 1500 cells / mL.

[0034] The diluted cell suspension was seeded into 12-well plates at a density of 1 mL per well (i.e., 1500 cells / well), with 3 replicates per group. After gently mixing with a cross-shaped incubator, the plates were pre-cultured at 37°C in a 5% CO2 incubator for 12 hours to allow the cells to adhere fully.

[0035] 3. Drug grouping and administration After cell adhesion, appropriate concentrations of hsa-miR-148b-5p mimic and / or chemotherapy drugs were added according to the experimental design. The experimental groups are as follows: Control group: Add an equal volume of PBS or mimic NC.

[0036] hsa-miR-148b-5p mimic monotherapy group: hsa-miR-148b-5p mimic was added to final concentrations of 0.25 nM and 1.5 nM, respectively.

[0037] Chemotherapy drug monotherapy group: Different concentrations of chemotherapy drugs are added according to the type of drug. Cisplatin: final concentrations of 1 μM and 2 μM; Oxaliplatin: final concentrations of 1 μM and 6 μM; Gefitinib: final concentrations 5 μM and 10 μM.

[0038] Combination therapy group: The above-mentioned concentrations of hsa-miR-148b-5p mimic and chemotherapy drugs were added simultaneously, as shown in Tables 1-12. After administration, the culture plates were gently mixed and returned to the incubator for further incubation.

[0039] 4. Cell Culture and Clonal Formation Continuous culture: Cells are cultured continuously in drug-containing medium for 10-12 days, with the medium replaced with fresh medium containing the corresponding drug concentration every 3-4 days to maintain a constant drug concentration.

[0040] Observation records: Observe the formation of cell clones regularly under an inverted microscope. Discontinue culture when visible cell clonal clusters (each clone containing more than 50 cells) appear in the control group. The culture time is generally 10-12 days.

[0041] 5. Fixation, staining, and data acquisition and analysis The supernatant was aspirated, and the cells were fixed in fixative at room temperature for 30 min. Then, 1% crystal violet was added and stained at room temperature for 30 min. After staining, the crystal violet was aspirated, and cell clones were photographed. The crystal violet staining area and intensity were calculated using ImageJ software, and the tumor cell growth inhibition rate (%) was calculated. To evaluate the combined effect of hsa-miR-148b-5p mimic and chemotherapy drugs, the King's Q method was used for quantitative analysis. The calculation formula is as follows: in: E A+B Tumor cell growth inhibition rate (%) of hsa-miR-148b-5p mimic in combination with chemotherapy drugs; E A The tumor cell growth inhibition rate (%) of hsa-miR-148b-5p mimic single drug action; E B Tumor cell growth inhibition rate (%) of chemotherapy drugs as a single agent.

[0042] Q-value evaluation criteria: Q>1.15 indicates a synergistic effect, 0.85 ≤ Q ≤ 1.15 indicates an additive effect, and Q<0.85 indicates an antagonistic effect.

[0043] II. Experimental Results 1. Growth inhibitory effect of HSA-MIR-148B-5P mimic combined with cisplatin on A549 A549 cells were treated with a certain concentration of hsa-miR-148b-5p mimic in combination with cisplatin to investigate the growth inhibitory effect of hsa-miR-148b-5p mimic combined with cisplatin on A549 cells. The results are shown in Tables 1 and 2.

[0044] Table 1. Growth-inhibiting effect of miR-148b-5p mimic combined with cisplatin on A549. Table 2 Synergistic coefficients of miR-148b-5p mimic combined with cisplatin Figure 2 The results show the inhibition rate of A549 cell growth by combined administration of hsa-miR-148b-5p mimic and cisplatin. The results indicate that hsa-miR-148b-5p mimic alone significantly inhibits A549 cell growth, and its inhibitory effect is further enhanced when combined with cisplatin. When 1.5 nM hsa-miR-148b-5p mimic was combined with 1 μM or 2 μM cisplatin, the Q values ​​were 1.255 and 1.402, respectively, both greater than 1.15, indicating a synergistic inhibitory effect.

[0045] 2. Growth inhibitory effect of HSA-MIR-148B-5P mimic combined with oxaliplatin on A549. A549 cells were treated with a certain concentration of hsa-miR-148b-5p mimic in combination with oxaliplatin to investigate the inhibitory effect of hsa-miR-148b-5p mimic combined with oxaliplatin on the growth of A549 cells. The results are shown in Tables 3 and 4.

[0046] Table 3. Growth inhibitory effect of hsa-miR-148b-5p mimic combined with oxaliplatin on A549 cells Table 4 Synergistic coefficients of hsa-miR-148b-5p mimic combined with oxaliplatin Figure 3The results of the combined administration of hsa-miR-148b-5p mimic and oxaliplatin on the growth inhibition rate of A549 cells were presented, indicating that hsa-miR-148b-5p mimic alone can significantly inhibit the growth of A549 cells, and the inhibitory effect on A549 cell growth is further enhanced when combined with oxaliplatin. Q-value analysis showed that the Q values ​​of each combination group ranged from 1.160 to 1.230, all greater than 1.15, indicating that the combined application of hsa-miR-148b-5p mimic and oxaliplatin has a synergistic effect in A549 cells.

[0047] 3. The growth-inhibiting effect of HSA-MIR-148B-5P mimic combined with gefitinib on A549. A549 cells were treated with a certain concentration of hsa-miR-148b-5p in combination with gefitinib to investigate the growth inhibitory effect of hsa-miR-148b-5p mimic combined with gefitinib on A549 cells. The results are shown in Tables 5-6.

[0048] Table 5. Growth inhibitory effect of hsa-miR-148b-5p mimic combined with gefitinib on A549. Table 6 Synergistic coefficient of hsa-miR-148b-5p mimic combined with gefitinib Figure 4 The results of the combined administration of hsa-miR-148b-5p mimic and gefitinib on the growth inhibition rate of A549 cells were presented, indicating that hsa-miR-148b-5p mimic alone can significantly inhibit the growth of A549 cells, and the inhibitory effect on A549 cell growth is further enhanced when combined with gefitinib. Q-value analysis showed that the Q values ​​of each combination group ranged from 1.030 to 1.078, less than 1.15, indicating an additive effect.

[0049] 4. Growth inhibitory effect of HSA-MIR-148B-5P mimic combined with cisplatin on H1299 H1299 cells were treated with a certain concentration of hsa-miR-148b-5p in combination with cisplatin to investigate the growth inhibitory effect of hsa-miR-148b-5p combined with cisplatin on H1299 cells. The results are shown in Tables 7 and 8.

[0050] Table 7. Growth-inhibiting effect of hsa-miR-148b-5p mimic combined with cisplatin on H1299. Table 8 Synergistic coefficients of miR-148b-5p mimic in combination with cisplatin Figure 5 The results of the combined administration of hsa-miR-148b-5p mimic and cisplatin on the growth inhibition rate of H1299 cells were presented, indicating that hsa-miR-148b-5p mimic alone can significantly inhibit the growth of H1299 cells, and the inhibitory effect on H1299 cell growth is further enhanced when combined with cisplatin. Meanwhile, the Q value of 1.5 nM mimic combined with 2 μM cisplatin was 1.275, showing a synergistic effect.

[0051] 5. Growth inhibitory effect of HSA-MIR-148B-5P mimic combined with oxaliplatin on H1299 H1299 cells were treated with a certain concentration of hsa-miR-148b-5p combined with oxaliplatin to investigate the growth inhibitory effect of hsa-miR-148b-5p mimic combined with oxaliplatin on H1299 cells. The results are shown in Tables 9 and 10.

[0052] Table 9. Growth inhibitory effect of hsa-miR-148b-5p mimic combined with oxaliplatin on H1299. Table 10 Synergistic coefficients of miR-148b-5p mimic combined with oxaliplatin Figure 6 The results show the inhibition rate of H1299 cell growth by the combined administration of hsa-miR-148b-5p mimic and oxaliplatin. The results indicate that hsa-miR-148b-5p mimic alone significantly inhibits the growth of H1299 cells, and the inhibitory effect is further enhanced when combined with oxaliplatin. Although the inhibition rate in the combined treatment group was higher than that in some single-drug groups, Q-value analysis showed that the Q values ​​ranged from 0.676 to 0.854 at the tested concentrations, indicating an additive or mild antagonistic effect, suggesting that the synergistic effect may be cell type or drug specific.

[0053] 6. Growth inhibitory effect of HSA-MIR-148B-5P mimic combined with gefitinib on H1299 cells H1299 cells were treated with a certain concentration of hsa-miR-148b-5p mimic in combination with gefitinib to investigate the inhibitory effect of hsa-miR-148b-5p mimic in combination with gefitinib on the growth of H1299 cells. The results are shown in Tables 11-12.

[0054] Table 11 Growth inhibitory effect of hsa-miR-148b-5p mimic combined with gefitinib on H1299 Table 12 Synergistic coefficient of miR-148b-5p mimic combined with gefitinib Figure 7 The results of the combined administration of hsa-miR-148b-5p mimic and gefitinib on the growth inhibition rate of H1299 cells were presented, indicating that hsa-miR-148b-5p mimic alone can significantly inhibit the growth of H1299 cells, and the inhibitory effect on H1299 cell growth is further enhanced when combined with gefitinib. Q-value analysis showed that the Q values ​​of each combination group ranged from 0.847 to 0.956, indicating an additive effect.

[0055] The results of this embodiment indicate that hsa-miR-148b-5p mimic monotherapy inhibits the growth of human non-small cell lung cancer (NSCLC) cell lines A549 and H1299 in a dose-dependent manner. When combined with chemotherapeutic agents (cisplatin, oxaliplatin, and gefitinib), the inhibitory effect on NSCLC cell growth is further enhanced. King's Q-value analysis shows that hsa-miR-148b-5p mimic exhibits a synergistic effect with cisplatin in both A549 and H1299 cells; a synergistic effect with oxaliplatin in A549 cells; and a primarily additive effect with gefitinib in both cell types. These results demonstrate that hsa-miR-148b-5p mimic has the potential to sensitize various chemotherapeutic agents, providing experimental evidence for its combined use with chemotherapeutic agents in the treatment of malignant tumors.

[0056] Example 3: Animal experiment on the inhibitory effect of hsa-miR-148b-5p mimic combined with chemotherapy drugs on non-small cell lung cancer. This embodiment uses a patient-derived xenograft (PDX) model from human non-small cell lung cancer patients to verify in vivo the inhibitory effect of hsa-miR-148b-5p mimic alone and in combination with cisplatin on tumor growth, evaluating its in vivo antitumor efficacy and the synergistic effect of combined drug use. The animal experimental procedure is as follows: Figure 8 As shown in A.

[0057] Laboratory animals: BALB / c-nu nude mice, 4-6 weeks old, female, weighing 18-22 g, purchased from Beijing Vital River Laboratory Animal Technology Co., Ltd. All animals were housed in an SPF-grade environment with free access to food and water, and were used in experiments after one week of acclimatization.

[0058] PDX tumor model: Human non-small cell lung cancer PDX model tumor tissue (provided by Shanghai Jiao Tong University School of Medicine, pathologically identified as non-small cell lung cancer tissue).

[0059] Main reagents: hsa-miR-148b-5p mimic and negative control miRNA NC (sequence: UUGUACUACACAAAAGUACUG, SEQ ID NO.7).

[0060] Targeted delivery vector: Assembled protein nanocarrier CABRi (disclosed in the patent application with application number "202411527302.4", invention title "An assembled protein nanocarrier CABRi for targeted delivery of small interfering nucleic acids and its preparation method and application"), used for encapsulating and delivering miRNA mimic.

[0061] Cisplatin injection (Sigma-Aldrich).

[0062] DMEM medium, PBS buffer, and Matrigel (Corning).

[0063] Gentamicin injection (2 mg / mL), anesthetic (sodium pentobarbital or isoflurane), 75% ethanol.

[0064] I. Experimental Methods One day before the experiment, all surgical instruments (scalpels, scissors, forceps, needle holders, inoculation needles, etc.) were cleaned, packaged, and sterilized at high temperature and pressure (121℃, 30 minutes), and then dried for later use.

[0065] On the day of the experiment, according to the grouping requirements, hsa-miR-148b-5p mimic and CABRi carrier were mixed according to the instructions to form an encapsulation complex. EMSA experiments were used to detect the binding efficiency of the CABRi nanocarrier with hsa-miR-148b-5p mimic. Figure 8 As shown in B; the cisplatin solution was diluted with sterile PBS to the required concentration (5 mg / kg dosing volume).

[0066] 1. Establishment of PDX tumor model Donor tumor acquisition: Euthanized donor mice bearing PDX tumors were immersed in 75% ethanol for 3-5 minutes for sterilization. In a laminar flow hood, the mice were secured to a sterile operating board, and the subcutaneous tumor tissue was carefully dissected using sterile scissors and forceps. The extracted tumor tissue was immediately placed in a 10 cm culture dish containing sterile PBS and washed 2-3 times to remove blood and necrotic tissue. The tumor was then transferred to a culture dish containing DMEM complete medium.

[0067] Tumor block preparation: In the culture medium, the tumor tissue was trimmed evenly with a sterile scalpel and forceps, removing obvious necrotic and fibrotic parts. The remaining fresh tumor tissue was cut into small pieces of approximately 2 mm × 2 mm × 2 mm. 3-4 tumor blocks were prepared for each recipient mouse.

[0068] Tumor inoculation: Immerse the cut tumor fragments in pre-cooled matrix gel, ensuring a uniform coating of matrix gel on the surface. Use forceps to pick up a tumor fragment and place it at the tip of the inoculation needle. After disinfecting the skin in the middle of the right axilla of the nude mouse, insert the needle subcutaneously, advancing approximately 1 cm. Push the plunger of the inoculation needle to carefully push the tumor fragment into the subcutaneous space, then slowly withdraw the needle. Observe the inoculation site to ensure the tumor fragment remains subcutaneously without significant bleeding.

[0069] Postoperative care: On the second day after inoculation, each mouse was injected intraperitoneally with 200 μL of gentamicin solution (2 mg / mL) to prevent infection. The mice's mental state, activity, diet, and tumor growth at the inoculation site were observed daily.

[0070] 2. Animal grouping and dosing regimen 2.1 Tumor surveillance and grouping Regularly monitor tumor growth, measuring the major axis (a) and minor axis (b) of the tumor using calipers. When the tumor volume reaches approximately 5 mm × 5 mm (i.e., a volume of approximately 62.5 mm²), [the tumor is considered to have reached its maximum diameter]. 3 When the tumor-bearing mice were randomly divided into 4 groups of 5 mice each, they were marked. The grouping is shown in Table 13.

[0071] Table 13 Grouping and Dosing Regimen 2.2 Drug administration procedure On the day of administration, prepare the corresponding medications according to the group assignments.

[0072] miRNA formulations (control group and miR-148b-5p group): The CABRi vector was mixed with miRNA NC or hsa-miR-148b-5p mimic in an optimized ratio and incubated at room temperature for 20-30 minutes to form a complex. The complex was then administered via tail vein injection, with an injection volume of 100-150 μL per mouse.

[0073] Cisplatin preparation: Dilute the cisplatin stock solution with sterile PBS to 1 mg / mL, calculate the required volume per mouse based on a dose of 5 mg / kg, and administer via intraperitoneal injection.

[0074] Combined group: miR-148b-5p mimic / CABRi complex was injected via the tail vein, and cisplatin solution was injected intraperitoneally, respectively.

[0075] Dosing cycle: Administer once every 3 days, for a total of 3 doses (days 0, 3, and 6).

[0076] 2.3 Indicator Testing and Evaluation General condition observation: Observe the mental state, activity level, food and water intake, skin and fur condition, and any abnormal reactions of the mice in each group every day, and record the mortality.

[0077] Tumor volume measurement: Starting from day 0 of drug administration, the long axis (a) and short axis (b) of the tumor were measured every 3 days. Measurements were performed using vernier calipers, with 3 measurements taken for each tumor and the average value taken. The tumor volume V was calculated using the formula: V = a × b 2 / 2, Where a is the long diameter of the tumor (mm) and b is the short diameter of the tumor (mm).

[0078] After the treatment cycle was completed, the tumors in each group were dissected and weighed to measure their weight and size, and the tumor growth inhibition rate was calculated.

[0079] II. Experimental Results 2.1 General condition of mice in each group Throughout the experiment, the mice in all groups were in good spirits, with normal activity and appetite, and no obvious drug toxicity or abnormal behavior was observed. No mice died during the experiment.

[0080] 2.2 Effect of hsa-miR-148b-5p mimic combined with cisplatin on PDX tumor volume Dynamic changes in tumor volume, such as Figure 8 As shown in the CD. Before administration (day 0), there was no significant difference in the average tumor volume among the groups of mice (approximately 60-80 mm). 3 After drug administration began, the tumor volume in the control group continued to grow rapidly. Compared with the control group, tumor growth in each treatment group was inhibited to varying degrees. In the hsa-miR-148b-5p mimic monotherapy group, tumor volume growth was significantly slower than in the control group starting from day 3 after administration. By the experimental endpoint (day 9), the average tumor volume was significantly smaller than that in the control group (P<0.05), indicating that in vivo administration of hsa-miR-148b-5p mimic monotherapy has an inhibitory effect on PDX tumor growth.

[0081] Cisplatin monotherapy group: Cisplatin treatment also significantly inhibited tumor growth, and the tumor volume was significantly smaller than that of the control group at the experimental endpoint (P<0.01).

[0082] In the combination therapy group, the combination therapy of hsa-miR-148b-5p mimic and cisplatin showed the most significant inhibitory effect on tumor growth. From day 3 after administration, the tumor volume in the combination group was significantly smaller than that in each monotherapy group. By the endpoint of the experiment (day 9), the average tumor volume in the combination group was significantly smaller than that in the hsa-miR-148b-5p mimic monotherapy group (P<0.05) and the cisplatin monotherapy group (P<0.05), indicating that the combination therapy had a synergistic and enhanced antitumor effect.

[0083] 2.3 Effect of hsa-miR-148b-5p mimic combined with cisplatin on PDX tumor weight The experimental endpoint was achieved by weighing the dissected tumor as follows: Figure 8 As shown in Figure E: The average tumor weight in the control group was 0.85±0.12g. The average tumor weight in the hsa-miR-148b-5p mimic monotherapy group was 0.52±0.09g, with a tumor growth inhibition rate of approximately 38.8%. The average tumor weight in the cisplatin monotherapy group was 0.41±0.08g, with a tumor growth inhibition rate of approximately 51.8%. The average tumor weight in the combination therapy group was 0.21±0.05g, with a tumor growth inhibition rate of approximately 75.3%, significantly higher than any single therapy group (P<0.01). Tumor tissue images clearly showed that the tumor volume and size in the combination therapy group were significantly smaller than those in the control group and the single therapy group. Figure 8 (C).

[0084] 2.4 Molecular detection of tumor tissue Tumor tissue collected at the experimental endpoint was analyzed by Western blot. Figure 8 The results showed that, compared with the control group, the expression level of ABCC1 protein in tumor tissue of the hsa-miR-148b-5p mimic treatment group was reduced, and the decrease in ABCC1 expression was more significant in the combination treatment group, suggesting that hsa-miR-148b-5p mimic in vivo may enhance the anti-tumor effect of cisplatin by regulating the expression of drug resistance-related proteins.

[0085] This embodiment validated, using a non-small cell lung cancer (PDX) mouse model, that hsa-miR-148b-5p mimic, delivered via the nanocarrier CABRi and administered via tail vein, significantly inhibited PDX tumor growth in vivo. The combined use of hsa-miR-148b-5p mimic and cisplatin demonstrated a synergistic anti-tumor effect in vivo, with significantly stronger tumor growth inhibition than either single-agent treatment. Downregulation of the drug resistance-related protein ABCC1 in tumor tissues of the combination therapy group suggests a potential mechanism for sensitizing chemotherapy.

[0086] The above results indicate that hsa-miR-148b-5p mimic has clear anti-tumor activity in vivo, and can produce a synergistic effect when used in combination with cisplatin, providing favorable in vivo experimental evidence for the clinical application of hsa-miR-148b-5p in the preparation of drugs for the treatment of malignant tumors and for enhancing chemotherapy sensitization.

[0087] The embodiments described above are merely preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Various modifications and improvements made by those skilled in the art to the technical solutions of the present invention without departing from the spirit of the present invention should fall within the protection scope defined by the claims of the present invention.

Claims

1. The use of hsa-miR-148b-5p in the preparation of drugs for improving the sensitivity of malignant tumor cells to chemotherapeutic drugs, reversing chemotherapy resistance in malignant tumors, and / or in combination with chemotherapeutic drugs for the treatment of malignant tumors, characterized in that, The hsa-miR-148b-5p includes a mature sequence, a precursor sequence, or an analogue of hsa-miR-148b-5p; the mature sequence of hsa-miR-148b-5p is shown in SEQ ID NO.1; the precursor sequence of hsa-miR-148b-5p is shown in SEQ ID NO.2; the analogue of hsa-miR-148b-5p includes a guide strand with a sequence shown in SEQ ID NO.3 and a follower strand with a sequence shown in SEQ ID NO.

4.

2. The application according to claim 1, characterized in that, The lung cancers mentioned include non-small cell lung cancer.

3. The application according to claim 1, characterized in that, The chemotherapy drugs include cisplatin and oxaliplatin.

4. The application according to claim 1, characterized in that, The chemotherapy resistance includes the malignant tumor's resistance to cisplatin and oxaliplatin during chemotherapy.

5. A pharmaceutical composition for treating malignant tumors, characterized in that, The active ingredient is hsa-miR-148b-5p with cisplatin or hsa-miR-148b-5p with oxaliplatin; the hsa-miR-148b-5p includes the mature sequence, precursor sequence, or mimic of hsa-miR-148b-5p; the mature sequence of hsa-miR-148b-5p is shown in SEQ ID NO.1; the precursor sequence of hsa-miR-148b-5p is shown in SEQ ID NO.2; the mimic of hsa-miR-148b-5p includes a guide strand with the sequence shown in SEQ ID NO.3 and a follower strand with the sequence shown in SEQ ID NO.

4.

6. The drug according to claim 5, characterized in that, The lung cancers mentioned include non-small cell lung cancer.

7. The drug according to claim 5, characterized in that, The dosage form of the pharmaceutical composition is tablet, capsule, granule, injection, sustained-release formulation, or targeted formulation.

8. The drug according to claim 5, characterized in that, The pharmaceutical composition also includes pharmaceutically acceptable carriers and excipients.

Images