A dual-plasmid recombinant Escherichia coli engineered bacterium, its construction method and application

By constructing a dual-plasmid recombinant Escherichia coli engineered bacterium, heterologously expressing the TNF-IL23R fusion protein and incorporating a quorum sensing-regulated cleavage circuit, the problem of uncontrollable dual-pathway regulation of TNF-α and IL-23 in existing technologies was solved, achieving steady drug release and bacterial population density control, thus improving therapeutic efficacy and safety.

CN122128198APending Publication Date: 2026-06-02ZHEJIANG UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202610289135.7
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2026-03-11
Publication Date
2026-06-02

Smart Images

  • Figure CN122128198A_ABST
    Figure CN122128198A_ABST
Patent Text Reader

Abstract

This invention discloses a dual-plasmid recombinant Escherichia coli engineered bacterium, its construction method, and its applications, belonging to the fields of synthetic biology and immunotherapy. Using the safe probiotic Escherichia coli Nissle 1917 as the chassis strain, this invention constructs a recombinant Escherichia coli engineered bacterium through heterologous expression of the TNF-IL23R fusion protein via a dual-plasmid system and the inclusion of a quorum sensing-regulated lysis circuit. This recombinant engineered bacterium can efficiently express the TNF-IL23R fusion protein, simultaneously blocking the TNF-α and IL-23 dual pathways, enhancing anti-inflammatory effects and reducing the risk of drug resistance, thus achieving therapeutic effects. It can also secrete N-acylhomoserine lactone, utilizing the quorum sensing system to regulate lysis genes, controlling bacterial population density, avoiding excessive bacterial population burden on the body, and simultaneously achieving steady drug release by controlling bacterial autolysis. This provides a high-quality bacterial strain resource for in vivo therapy of autoimmune diseases.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the fields of synthetic biology and immunotherapy, and in particular to a dual-plasmid recombinant Escherichia coli engineered bacterium, its construction method, and its applications. Background Technology

[0002] Autoimmune diseases and diseases related to chronic immunodeficiency are closely related to genetic susceptibility, gut microbiota imbalance, and immune homeostasis disturbances, and have become a significant chronic disease burden. Clinical treatment primarily focuses on immunosuppression and anti-inflammatory therapies, with commonly used drugs including glucocorticoids and biologics. However, these treatments have limitations such as low long-term remission rates, significant systemic toxicity, and easy resistance to single-target drugs, which have become the core bottleneck in treatment.

[0003] Abnormal activation and synergistic effects of the TNF-α and IL-23 pathways are core disease mechanisms, forming a positive feedback loop that drives chronic inflammation and autoimmune responses. Sustained activation of the IL-23 pathway is a key factor inducing resistance to anti-TNF-α treatment, and dual-target regulation exhibits significant synergistic advantages. However, while the commonly used engineered probiotic *E. coli* Nissle 1917 can achieve in-situ targeted delivery to the intestine, current applications of this strain are mostly single-function modules, failing to achieve synergistic regulation of both pathways. Furthermore, it suffers from uncontrollable release of therapeutic load and imbalances in bacterial proliferation and clearance, increasing the burden on the body and failing to meet clinical translational needs. Currently, precise regulation of in vivo colonization, lysis, and drug release by engineered bacteria remains a technical challenge. There is an urgent need to construct a dynamic, programmable engineered bacterial system with targeted colonization, pulsed, controllable release, and programmed self-clearance functions to balance therapeutic efficacy and biosafety. Summary of the Invention

[0004] The purpose of this invention is to provide a dual-plasmid recombinant Escherichia coli engineered bacterium, its construction method, and its applications, to solve the problems existing in the prior art. This invention uses the safe probiotic Escherichia coli Nissle 1917 as the chassis strain, and constructs a recombinant Escherichia coli engineered bacterium by heterologously expressing the TNF-IL23R fusion protein through a dual-plasmid system and incorporating a quorum sensing-regulated lysis circuit. This recombinant engineered bacterium can efficiently express the TNF-IL23R fusion protein, simultaneously blocking the TNF-α and IL-23 dual pathways, enhancing anti-inflammatory effects and reducing the risk of drug resistance, thus achieving therapeutic effects. It can also secrete N-acylhomoserine lactone, and utilize the quorum sensing system to regulate the lysis gene, controlling the bacterial population density and avoiding excessive bacterial population burden on the body. Simultaneously, by controlling the bacterial autolysis behavior, it achieves steady and sustained drug release. This provides a high-quality bacterial strain resource and therapeutic tool for in vivo therapy of autoimmune diseases.

[0005] To achieve the above objectives, the present invention provides the following solution: This invention provides a dual-plasmid recombinant Escherichia coli engineered bacterium, wherein the dual-plasmid recombinant Escherichia coli engineered bacterium comprises a therapeutic plasmid and a lysis loop plasmid; The therapeutic plasmid contains a gene encoding the TNF-IL23R fusion protein as shown in SEQ ID NO.1; The lysis loop plasmid contains the quorum sensing system gene as shown in SEQ ID NO.2 and the lysis gene as shown in SEQ ID NO.3.

[0006] In this invention, the quorum sensing system is the Vibrio fischeri LuxI / LuxR quorum sensing system, which contains the LuxI gene, the LuxR gene, and the Plux promoter.

[0007] In this invention, the lysis gene is of phage origin. X174 E gene.

[0008] Optionally, the starting plasmid of the therapeutic plasmid is a vector plasmid containing the pBBR1 replication origin, and the starting plasmid of the cleavage circuit plasmid is a high-copy vector plasmid containing the pUC replication origin.

[0009] Optionally, the vector plasmid containing the pBBR1 replication origin contains the T3 promoter.

[0010] Optionally, the chassis strain of the dual-plasmid recombinant Escherichia coli engineered bacteria includes Escherichia coli Nissle 1917.

[0011] The present invention also provides a method for constructing the above-mentioned dual-plasmid recombinant Escherichia coli engineered bacteria, comprising the following steps: (1) The gene encoding the TNF-IL23R fusion protein as shown in SEQ ID NO.1 was cloned into a vector plasmid containing the pBBR1 replication origin to construct a therapeutic plasmid; (2) The quorum sensing system gene shown in SEQ ID NO.2 and the cleavage gene shown in SEQ ID NO.3 were cloned into a high-copy vector plasmid containing the pUC replication origin to construct a cleavage loop plasmid; (3) The therapeutic plasmid and the lysis circuit plasmid are sequentially transformed into Escherichia coli to construct the dual-plasmid recombinant Escherichia coli engineered bacteria.

[0012] Optionally, the Escherichia coli includes Escherichia coli Nissle 1917.

[0013] The present invention also provides a TNF-IL23R fusion protein, the gene sequence encoding the TNF-IL23R fusion protein being shown in SEQ ID NO.1.

[0014] The present invention also provides the application of the above-mentioned dual-plasmid recombinant Escherichia coli engineered bacteria in the production of TNF-IL23R fusion protein, the gene sequence encoding the TNF-IL23R fusion protein being shown in SEQ ID NO.1.

[0015] The present invention also provides the application of the above-mentioned dual-plasmid recombinant Escherichia coli engineered bacteria in the production of N-acylhomoserine lactone.

[0016] The present invention also provides the use of the above-mentioned dual-plasmid recombinant Escherichia coli engineered bacteria or the above-mentioned TNF-IL23R fusion protein in the preparation of drugs for treating immune system diseases.

[0017] The present invention discloses the following technical effects: This invention uses the safe probiotic *Escherichia coli* Nissle 1917 as the chassis strain. A recombinant *E. coli* engineered bacterium is constructed by heterologously expressing the TNF-IL23R fusion protein via a dual plasmid system and incorporating a quorum-sensing lysis delivery module. This recombinant engineered bacterium can efficiently express the TNF-IL23R fusion protein and secrete N-acylhomoserine lactone (AHL). By utilizing a quorum-sensing system to regulate the lysis gene, the bacterial population density is controlled within the OD range. 600 The concentration is around 0.5, avoiding an excessive bacterial population that could burden the body. Furthermore, by controlling bacterial lysis, a steady release of the drug is achieved. Compared to existing technologies, the advantages of this invention are: Firstly, it integrates a dual-targeting immune regulation module of TNF-IL23R and a quorum sensing lysis delivery module into this safe probiotic chassis. Leveraging its colonization ability, it accumulates in the intestinal immune hub, exerting its effects through the gut-systemic immune axis. The TNF-IL23R fusion protein has a dual-targeting advantage, simultaneously blocking the core pro-inflammatory pathways of IL-23 and TNF-α, overcoming the bottleneck of single-target drug resistance. The lysis loop enables steady release of the therapeutic protein and control of bacterial population density, balancing drug release efficiency and microecological safety. The safety of the chassis strains has been clinically verified. The dual plasmid heterologous replication origin ensures genetic stability, and the lysis loop acts as a "suicide switch" to enhance safety. The modular and replaceable functional units of the system lay the foundation for the development of in vivo therapies for various immune-related diseases, possessing strong platform potential and clinical translational value.

[0018] The recombinant engineered bacteria of this invention possess excellent intestinal colonization ability and immune-activating activity. Through oral administration, they can target and colonize immune sites in the intestinal mucosa, and can be used to treat autoimmune diseases such as systemic lupus erythematosus, as well as chronic immunodeficiency caused by circadian rhythm disorders and long-term stress, thereby achieving systemic immune homeostasis regulation and functional repair. This invention provides high-quality bacterial strain resources and therapeutic tools for in vivo therapy of autoimmune diseases. Attached Figure Description

[0019] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0020] Figure 1 This is a schematic diagram of the structure of the cleavage circuit plasmid pLy of the present invention; Figure 2 This is a schematic diagram of the structure of the therapeutic plasmid pTI of the present invention; Figure 3 This is an electrophoresis image showing the PCR verification of the pLy plasmid in the engineered strain EcN-TI-Ly of this invention. Figure 4 This is an electrophoresis image of the PCR verification of the pTI plasmid in the engineered strain EcN-TI-Ly of this invention; Figure 5 This is a comparison of the sequencing results of the pLy plasmid in the engineered bacterium EcN-TI-Ly of this invention with the theoretical sequence. Figure 6 This is a comparison between the sequencing results of the pTI plasmid in the engineered bacterium EcN-TI-Ly of this invention and the theoretical sequence. Figure 7 This is a comparison of the growth curves of the engineered strain EcN-TI-Ly and wild-type EcN. Figure 8 The graph shows the detection results of the AHL content of the engineered strain EcN-TI-Ly and the wild-type EcN in this invention. Figure 9 This is a TEM image of the engineered strain EcN-TI-Ly after 16 hours of culture. Figure 10 This is a Western blot verification image of the TNF-IL23R fusion protein in the engineered strain EcN-TI-Ly of this invention; Figure 11 This is a TEM image of the engineered strain EcN-TI-Ly cultured to the late logarithmic phase of the present invention. Detailed Implementation

[0021] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as a limitation of the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0022] It should be understood that the terminology used in this invention is merely for describing particular embodiments and is not intended to limit the invention. Furthermore, with respect to numerical ranges in this invention, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Any stated value or intermediate value within a stated range, as well as each smaller range between any other stated value or intermediate value within said range, is also included in this invention. The upper and lower limits of these smaller ranges may be independently included or excluded from the range.

[0023] Unless otherwise stated, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. While only preferred methods and materials have been described herein, any methods and materials similar or equivalent to those described herein may be used in the implementation or testing of this invention. All references to this specification are incorporated by way of citation to disclose and describe methods and / or materials associated with those references. In the event of any conflict with any incorporated reference, the content of this specification shall prevail.

[0024] Various modifications and variations can be made to the specific embodiments described in this specification without departing from the scope or spirit of the invention, as will be apparent to those skilled in the art. Other embodiments derived from this specification will also be apparent to those skilled in the art. This specification and embodiments are merely exemplary.

[0025] The terms “include,” “including,” “have,” “contain,” etc., used in this article are all open-ended terms, meaning that they include but are not limited to.

[0026] Unless otherwise specified, the experimental methods used in the following examples are conventional methods. Unless otherwise specified, all microbiological aseptic procedures are performed in the following examples. Unless otherwise specified, all materials and reagents used in the following examples are commercially available.

[0027] Strains and vectors: Escherichia coli Nissle 1917 (EcN, purchased from ATCC); high-copy vector backbone (containing pUC origin of replication and ampicillin resistance gene; the vector used in the following examples is pTac-GS1-E (phiX174), containing pUC origin of replication, purchased from Sangon Biotech); wide-host-range vector backbone (containing pBBR1 origin of replication and kanamycin resistance gene; the vector used in the following examples is pBBR1MCS-2 (Addgene plasmid #85168, purchased from Addgene).

[0028] Genes and primers: TNF-IL23R fusion protein encoding gene (nucleotide sequence as shown in SEQ ID NO.1, synthesized by Sangon Biotech); LuxI / LuxR quorum sensing system gene composed of LuxI gene, LuxR gene and Plux promoter (nucleotide sequence as shown in SEQ ID NO.2, synthesized by Qingke Biotech); ϕX174E gene (nucleotide sequence as shown in SEQ ID NO.3, synthesized by Qingke Biotech); HRV 3C site gene (nucleotide sequence as shown in SEQ ID NO.4, synthesized by Qingke Biotech); primers used for colony PCR and plasmid construction (synthesized by Qingke Biotech, sequences are shown in Table 1).

[0029] SEQ ID NO.1:

[0030] SEQ ID NO.2:

[0031] SEQ ID NO.3: ATGGTACGCTGGACTTTGTGGGATACCCTCGCTTTCCTGCTCCTGTTGAGTTTATTGCTTGCCGTCATTGCTTATTATGTTCATCCCGTCAACATTCAAACGGCCTGTCTCATCATGGAAGGCGCTGAATTTACGGAAA ACATTATTAATGGCGTCGAGCGTCCGGTTAAAGCCGCTGAATTGTTCGCGTTTACCTTGCGTGTACGCGCAGGAAACACTGACGTTCTTACTGACGCAGAAGAAAACGTGCGTCAAAAATTACGTGCGGAAGGAGTGA.

[0032] SEQ ID NO.4: CTGGAAGTTCTGTTCCAGGGGCCC.

[0033]

[0034] Reagents: Ampicillin, kanamycin (from Sigma), N-acylhomoserine lactone (AHL, from Cayman), anti-HA tag antibody (from Cell Signaling Technology), Western blotting reagents (such as SDS-PAGE gel kit, ECL chemiluminescence solution, from Beyotime); LB medium, SOC resuscitation medium (formulas refer to the third edition of Molecular Cloning: A Laboratory Manual).

[0035] Instruments: PCR instrument (Bio-Rad), gel imaging system (Tanon), microplate reader (Thermo Fisher), constant temperature shaker (Shanghai Zhicheng), clean bench (Suzhou Purification).

[0036] Example 1: Construction of the cleavage circuit plasmid pLy 1. Amplification of the target fragment Synthesized containing LuxI gene, LuxR gene, Plux promoter and The full-length fragment of the X174 E gene (obtained by linking the sequences shown in SEQ ID NO.2 and SEQ ID NO.3 with the sequence shown in SEQ ID NO.4) was used as a template for PCR amplification using primers pLy-F / pLy-R.

[0037] The PCR amplification system consisted of: 25 μL of 2×Phanta Max Master Mix, 2 μL each of forward and reverse primers (10 μmol / L), 1 μL of template DNA, and 20 μL of ddH2O.

[0038] The PCR amplification program was as follows: 95℃ pre-denaturation for 3 min; 95℃ denaturation for 30 s, 58℃ annealing for 30 s, 72℃ extension for 1.5 min, for a total of 35 cycles; 72℃ final extension for 5 min.

[0039] 2. Enzyme digestion of vector and target fragment The PCR amplification products and the high-copy vector backbone were double-digested with restriction endonucleases EcoRI and BamHI, respectively, to precisely knock out the original GST coding gene of the vector and insert the core coding gene of the luxI quorum sensing system (containing the sequences shown in SEQ ID NO. 2 and SEQ ID NO. 3) upstream of the coding sequence of the cleavage gene (phiX174). The digestion products were separated by 1% agarose gel electrophoresis and recovered using a gel extraction kit.

[0040] 3. Connection and Transformation The recovered lysis loop module was mixed with the enzyme-digested vector backbone at a molar ratio of 3:1, and T4 DNA ligase (1 μL) and 10×T4 ligation buffer (2 μL) were added. Ligation was carried out at 22℃ for 2 h. The ligation product was transformed into E. coli DH5α competent cells, plated on LB agar plates containing 100 μg / mL ampicillin, and incubated upside down at 37℃ for 12 h. Single colonies were picked for colony PCR verification. After the positive clones were correctly sequenced, the plasmid pLy (structure shown in [link to plasmid]) was extracted. Figure 1 ).

[0041] Example 2 Construction of the therapeutic plasmid pTI 1. Amplification of the target fragment Using the synthesized TNF-IL23R fusion protein encoding gene (SEQ ID NO.1) as a template, PCR amplification was performed using primers pTI-F / pTI-R; the PCR reaction system and conditions were the same as in Example 1, except that the extension time was adjusted to 90s (optimized according to the length of the target gene).

[0042] 2. Enzyme digestion of vector and target fragment The PCR amplification product (TNF-IL23R gene) and the vector backbone containing the pBBR1 replication origin were double-digested with EcoRI and XhoI, respectively. The digestion and gel recovery procedures were the same as in Example 1.

[0043] 3. Connection and Transformation The recovered TNF-IL23R gene was ligated to the enzyme-digested vector backbone at a molar ratio of 3:1. The ligation product was transformed into DH5α competent cells and plated on LB agar plates containing 50 μg / mL kanamycin. The cells were incubated at 37°C for 12 h. Single colonies were picked for colony PCR verification. After sequencing of positive clones to confirm the absence of base mutations, the plasmid was extracted, which is the therapeutic plasmid pTI (structure shown in [link to pTI]). Figure 2 ).

[0044] Example 3: Construction, screening and identification of engineered dual-plasmid recombinant Escherichia coli Nissle 1917 1. Preparation of EcN competent cells Escherichia coli Nissle 1917 (hereinafter referred to as EcN) competent cells were prepared using the CaCl2 method. EcN cells were seeded in LB medium and cultured with shaking at an appropriate temperature until mid-log phase. After incubation on ice, the cells were centrifuged at low temperature, the supernatant was discarded, and the precipitate was resuspended in pre-cooled CaCl2 solution and incubated on ice. After centrifugation again, the cells were resuspended in CaCl2 solution containing glycerol, aliquoted, and stored at -80°C.

[0045] 2. Thermal shock transformation (first transformation of pLy plasmid) EcN competent cells were mixed with plasmid pLy, subjected to heat shock after being placed in an ice bath, and then cooled in an ice bath. After being revived at an appropriate temperature by adding SOC medium, the mixture was spread on LB agar plates containing ampicillin and cultured to obtain EcN strain containing only pLy.

[0046] 3. Secondary transformation (transformation into pTI plasmid) Prepare EcN competent cells containing pLy using the same method as in step 1, add an appropriate amount of plasmid pTI, and repeat the heat shock transformation and resuscitation steps described above; spread the resuscitated bacterial culture on LB plates containing ampicillin and kanamycin, and obtain transformant colonies to be screened after incubation at the appropriate temperature.

[0047] 4. Screening and validation of positive clones Colony PCR Validation: Single colonies were picked from double-antibody plates and colony PCR was performed using primers X174E-f / X174E-r (specifically amplifying fragments on plasmid pLy) and Feature14-F / Feature14-R (specifically amplifying fragments on plasmid pTI), respectively. PCR products were detected by 1% agarose gel electrophoresis. Results are shown in [Figure 1]. Figure 3 and Figure 4 (Colony PCR verification electrophoresis image). From Figure 3 and Figure 4 It can be seen that the negative control (untransformed EcN strain) had no specific bands, and the selected transformant colonies all amplified bands that matched the expected size, proving that plasmids pLy and pTI had been successfully transformed into EcN strain.

[0048] Plasmid sequencing verification: The recombinant plasmid that passed the double enzyme digestion verification was sent to Qingke Bio-sequencing Company for sequencing. The sequencing results were compared with the theoretical sequence. The comparison figure is shown below. Figure 5 and Figure 6 (Sequencing comparison of plasmid pLy and pTI). Sequencing results showed that the target gene sequences of both plasmids had no base mutations, deletions, or insertions, proving that the recombinant plasmid construction was correct, and the candidate engineered strain EcN-TI-Ly was finally obtained.

[0049] Colony morphology observation: The colony morphology of candidate engineered strain EcN-TI-Ly on double-antibody LB plates is translucent, flat and round, with a smooth and raised surface.

[0050] Example 4: Functional Verification of the Dual-Plasmid Recombinant Escherichia coli Nissle 1917 Engineered Bacteria 1. Functional verification of the AHL signal-mediated cleavage circuit 1.1 Experimental Materials and Grouping Strains: engineered strain EcN-TI-Ly, wild-type EcN.

[0051] Reagents: N-acylhomoserine lactone (AHL) ELISA kit (purchased from Nanjing Herbal Source Biotechnology Co., Ltd.), LB liquid culture medium.

[0052] Grouping: Two experimental groups were set up: ① Wild-type EcN group; ② Engineered EcN-TI-Ly group.

[0053] 1.2 Growth curve monitoring The two groups of bacterial strains were inoculated into LB liquid medium and cultured at 37°C with shaking at 200 rpm. Samples were taken every 2 hours to detect the OD of the bacterial culture. 600 Values ​​are used to plot growth curves.

[0054] 1.3 ELISA detection of AHL content Supernatants from two groups of strains were cultured at different time points (8h, 16h, 24h), and the AHL content was measured according to the ELISA kit instructions. The functional activity of the quorum sensing system was assessed by detecting the content of AHL, a specific signaling molecule of the quorum sensing system.

[0055] 1.4 Results Analysis Growth curves of the two groups of strains are shown below. Figure 7 Wild-type EcN entered a stationary phase after 16 hours of culture, with OD... 600 The peak value was approximately 0.9, and the bacterial density remained stable during the stationary phase. The growth rate of the engineered strain EcN-TI-Ly was slower than that of the wild type. After 16 hours of cultivation (stationary phase), the OD value... 600The value was approximately 0.5. This result indicates that the lysis circuit was successfully established and functionally active in the engineered bacteria, capable of controlling the population density of the engineered bacteria to maintain at an OD value. 600 ≈0.5, to avoid excessive bacterial density from placing an additional burden on the body.

[0056] The results of AHL content detection for the two groups of strains are shown below. Figure 8 No AHL signal (absorbance OD) was detected in the supernatant of wild-type EcN at any time point. 450 (Below the kit detection limit); the engineered strain EcN-TI-Ly showed a low AHL content (OD) in the supernatant at 8 h (log phase). 450 The value was approximately 0.15, corresponding to a concentration of approximately 12 pg / ml; at 16 h (stationary period), the AHL content significantly increased (OD). 450 The value was approximately 0.27, corresponding to a concentration of approximately 22 pg / ml; the AHL content further increased at 24 h (OD). 450 The value was approximately 0.52, corresponding to a concentration of approximately 43 pg / ml. Further observation of the engineered strain EcN-TI-Ly after 16 h of culture using an optical microscope was performed, and the results are shown below. Figure 9 It is evident that the engineered bacteria EcN-TI-Ly exhibit significant bacterial aggregation (quorum sensing) and bacterial distortion. This result demonstrates that the quorum sensing system has been successfully established and is functionally active in the engineered bacteria.

[0057] 2. Expression and activity verification of TNF-IL23R fusion protein 2.1 Protein Extraction Candidate engineered strain EcN-TI-Ly and negative control EcN were inoculated into double-antibiotic LB liquid medium and cultured with shaking at an appropriate temperature until the late logarithmic phase. An appropriate amount of bacterial culture was centrifuged at 12,000 rpm for 5 min at 4°C to collect the cells. The cells were then treated with RIPA lysis buffer at 4°C for 30 min, centrifuged again, and the lysate protein sample was obtained. Alternatively, an appropriate amount of bacterial culture was directly centrifuged and filtered to obtain the supernatant protein sample.

[0058] 2.2 Western Blot Detection The obtained protein samples were subjected to SDS-PAGE electrophoresis and transferred to NC membranes; after blocking with skim milk, the membrane was incubated overnight with anti-HA tag primary antibody, washed, and then incubated at room temperature with HRP-labeled secondary antibody; after washing the membrane again, ECL luminescent solution was added, and the target protein bands were detected by gel imaging system.

[0059] 2.3 Results Analysis See results Figure 10The negative control strain EcN showed no specific band, while the lysate and supernatant of the candidate engineered strain EcN-TI-Ly showed clear bands at the expected molecular weight (50~70kDa), proving that the TNF-IL23R fusion protein was successfully expressed in the engineered strain.

[0060] Further observation of the cultured engineered strain EcN-TI-Ly using an optical microscope is shown in the figure below. Figure 11 It was observed that the engineered bacterium EcN-TI-Ly did not exhibit distinct rod-shaped cells and showed cell lysis. Combining the results of the supernatant analysis and the strain's growth curve, it was determined that the TNF-IL23R fusion protein was released into the supernatant due to the strain's autolytic lysis behavior. This result indicates that the engineered bacterium possesses the function of autonomously controlled drug release.

[0061] In summary, the dual-plasmid transformed engineered strain EcN-TI-Ly constructed in this invention contains a gene expression plasmid encoding the TNF-IL23R fusion protein and a quorum sensing-regulated lysis gene loop plasmid. The lysis gene loop plasmid can control the bacterial autolysis behavior under the regulation of the quorum sensing system. On the one hand, it can control the bacterial population density to avoid excessive bacterial population from burdening the organism. On the other hand, it can achieve sustained drug release by controlling the bacterial autolysis behavior.

[0062] The embodiments described above are merely preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Various modifications and improvements made by those skilled in the art to the technical solutions of the present invention without departing from the spirit of the present invention should fall within the protection scope defined by the claims of the present invention.

Claims

1. A dual-plasmid recombinant Escherichia coli engineered bacterium, characterized in that, The dual-plasmid recombinant Escherichia coli engineered bacteria contains a therapeutic plasmid and a lysis loop plasmid; The therapeutic plasmid contains a gene encoding the TNF-IL23R fusion protein as shown in SEQ ID NO.1; The lysis loop plasmid contains the quorum sensing system gene as shown in SEQ ID NO.2 and the lysis gene as shown in SEQ ID NO.

3.

2. The engineered Escherichia coli with dual plasmids according to claim 1, characterized in that, The starting plasmid of the therapeutic plasmid is a vector plasmid containing the pBBR1 replication origin, and the starting plasmid of the cleavage circuit plasmid is a high-copy vector plasmid containing the pUC replication origin.

3. The engineered Escherichia coli with dual plasmids according to claim 2, characterized in that, The vector plasmid containing the pBBR1 replication origin contains the T3 promoter.

4. The engineered Escherichia coli with dual plasmids according to claim 1, characterized in that, The chassis strain of the dual-plasmid recombinant Escherichia coli engineered bacteria includes Escherichia coli Nissle 1917.

5. A method for constructing the dual-plasmid recombinant Escherichia coli engineered bacteria according to any one of claims 1-4, characterized in that, Includes the following steps: (1) The gene encoding the TNF-IL23R fusion protein as shown in SEQ ID NO.1 was cloned into a vector plasmid containing the pBBR1 replication origin to construct a therapeutic plasmid; (2) The quorum sensing system gene shown in SEQ ID NO.2 and the cleavage gene shown in SEQ ID NO.3 were cloned into a high-copy vector plasmid containing the pUC replication origin to construct a cleavage loop plasmid; (3) The therapeutic plasmid and the lysis circuit plasmid are sequentially transformed into Escherichia coli to construct the dual-plasmid recombinant Escherichia coli engineered bacteria.

6. The construction method according to claim 5, characterized in that, The Escherichia coli includes Escherichia coli Nissle1917.

7. A TNF-IL23R fusion protein, characterized in that, The gene sequence encoding the TNF-IL23R fusion protein is shown in SEQ ID NO.

1.

8. The use of the dual-plasmid recombinant Escherichia coli engineered strain according to any one of claims 1-4 in the production of TNF-IL23R fusion protein, characterized in that, The gene sequence encoding the TNF-IL23R fusion protein is shown in SEQ ID NO.

1.

9. The use of the dual-plasmid recombinant Escherichia coli engineered strain according to any one of claims 1-4 in the production of N-acylhomoserine lactone.

10. The use of the dual-plasmid recombinant Escherichia coli engineered strain according to any one of claims 1-4 or the TNF-IL23R fusion protein according to claim 7 in the preparation of a medicament for treating immune system diseases.