A combination of SNP molecular markers for pig carcass traits, a polymerase chain breeding method and its application

By screening for SNP1, SNP2, and SNP3 sites in the exons of the FOS gene on pig chromosome 7, and combining PCR amplification and sequencing technologies, the problems of low accuracy and efficiency in pig breeding have been solved, enabling efficient screening of high lean meat percentage breeding pigs and improving the economic benefits and market competitiveness of the pig industry.

CN122128442APending Publication Date: 2026-06-02AGRICULTURAL GENOMICS INSTITUTE AT SHENZHEN CHINESE ACADEMY OF AGRICULTURAL SCIENCES (SHENZHEN BRANCH GUANGDONG LABORATORY FOR LINGNAN MODERN AGRICULTURE)
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202610503035.X
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Priority Date
2026-02-05
Filing Date
2026-04-16
Publication Date
2026-06-02

AI Technical Summary

Technical Problem

Existing pig breeding methods have limitations in terms of breeding speed, accuracy, and trait improvement efficiency, making it difficult to meet the demands of the modern pig industry for rapid improvement in breeding pig performance. In particular, the limited number of effective SNP markers and their weak correlation make it difficult to accurately locate dominant genotypes, thus limiting the improvement of breeding pig efficiency.

Method used

A combination of SNP molecular markers associated with pig slaughter weight, carcass length and backfat thickness is provided, including SNP1, SNP2 and SNP3 sites located in the 4th exon of the FOS gene on pig chromosome 7. Corresponding primer sets are designed, and individuals of the GG-CC-AA type are screened by PCR amplification and sequencing to achieve efficient screening of breeding pigs with high lean meat percentage.

Benefits of technology

By accurately identifying specific aggregated genotypes of SNP1, SNP2, and SNP3, it is possible to efficiently screen for high-lean-ratio breeding pigs with large slaughter weight, long carcass, and thin backfat, significantly improving the accuracy and efficiency of breeding pig selection, increasing pork yield and quality, reducing breeding costs, and enhancing market competitiveness.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122128442A_ABST
    Figure CN122128442A_ABST
Patent Text Reader

Abstract

This invention provides a combination of SNP molecular markers for pig carcass traits, a method for polymerase chain breeding, and its application, belonging to the field of molecular marker technology. This invention provides three SNP loci that influence slaughter weight, carcass length, and backfat thickness in pigs. Individuals with the GG genotype at SNP1, the CC genotype at SNP2, and the AA genotype at SNP3 exhibit higher slaughter weight and carcass length, but relatively lower backfat thickness. By accurately identifying the genotypes of these three loci and their specific combination GG-CC-AA, it is possible to efficiently screen for high-lean-percentage breeding pigs with large slaughter weight, long carcass, and thin backfat. This provides a scientific and reliable molecular marker basis for pig breeding, accelerates the selection process for high-lean-percentage breeding pigs, helps meet market demand for high-quality pork products, and promotes the efficient, high-quality, and sustainable development of the pig industry.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of molecular marker technology, and in particular to a combination of SNP molecular markers for pig carcass traits, a method for polymerase chain breeding, and their applications. Background Technology

[0002] The hog industry occupies a key pillar position in the global agricultural economy. Its development level not only affects the stable supply of meat products but also has a profound impact on the overall efficiency of agriculture and food safety. Developing breeds with superior traits is crucial for promoting the high-quality development of the hog industry, enhancing its competitiveness, and meeting the global market's demand for high-quality pork.

[0003] After long-term development, the pig industry has made significant progress in seed technology innovation, and the supply capacity of high-quality breeding pigs has been continuously improved, laying a solid foundation for the industry's large-scale and standardized development, while also effectively ensuring the public's consumption demand for pork products. However, as the industry transforms and upgrades towards higher efficiency and precision, the limitations of traditional breeding methods in terms of breeding speed, accuracy, and trait improvement efficiency have become increasingly prominent, making it difficult to meet the urgent needs of the modern pig industry for rapid improvement in breeding pig performance.

[0004] In recent years, the rapid development of molecular biology and high-throughput sequencing technologies has brought revolutionary breakthroughs to pig breeding. These technologies have enabled the efficient acquisition of gene sequences, making it possible to quickly screen for mutant individuals with advantageous traits by comparing wild-type genotypes. At the molecular level, the application of these technologies has significantly accelerated the breeding process of high-quality pigs, improved breeding results, and powerfully promoted the upgrading of the quality of pork and other agricultural products, providing a strong impetus for the global meat supply. For example, in studies on important traits such as backfat thickness and slaughter weight in pigs, researchers have used these technologies to screen for several key genes affecting these traits, providing important theoretical basis and technical support for pig breeding.

[0005] Taking the FOS gene as an example, the FOS protein encoded by this gene plays a central role as a transcription factor in various cellular life activities. Studies have confirmed that single nucleotide polymorphisms (SNPs) in gene exons can alter protein structure, thereby affecting gene expression and phenotypic performance. However, the number of effective SNP markers currently used in pig breeding is relatively limited, and the association between some markers and target traits is not strong enough, especially for multi-marker combinations and aggregations. This makes it difficult to accurately locate dominant genotypes during the selection process, limiting further improvements in pig breeding efficiency. Therefore, it is urgent to discover more novel SNP markers and their superior combinations that are closely related to important economic traits in pigs, in order to improve the molecular marker system and aggregation breeding methods for pig breeding, accelerate the genetic progress of pig breeding, and promote the development of the pig industry to a higher level. Summary of the Invention

[0006] The purpose of this invention is to provide a combination of SNP molecular markers for pig carcass traits, a method for polymerase chain breeding, and its application, which can efficiently screen for high lean meat percentage breeding pigs with large slaughter body weight, long carcass, and thin backfat.

[0007] To achieve the above-mentioned objectives, the present invention provides the following technical solution: This invention provides a combination of SNP molecular markers associated with pig slaughter weight, carcass length, and backfat thickness. The SNP molecular marker combination is located on pig chromosome 7, in the 4th exon of the FOS gene, and includes: SNP1 located at 98451341 bp on chromosome Chromosome7, with a polymorphism of G / A; SNP2 located at 98451575 bp on chromosome Chromosome7, with a polymorphism of C / T; SNP3 located at 98451601 bp on chromosome Chromosome7, with polymorphism A / G.

[0008] Preferably, SNP1 is located at position 51 of the nucleotide sequence shown in SEQ ID NO.1; The SNP2 is located at position 51 of the nucleotide sequence shown in SEQ ID NO.2; The SNP3 is located at position 51 of the nucleotide sequence shown in SEQ ID NO.3.

[0009] This invention also provides a primer set for detecting SNP locus combinations that affect slaughter weight, carcass length, and backfat thickness in pigs, characterized by comprising the following sequences: Primer F-SEQ ID NO.4: CTCCAAGCGGTAGGTAGAATCC; Primer R-SEQ ID NO.5: GAAGGAACCAGACAGGTCCA.

[0010] This invention also provides an application of SNP molecular marker combinations or the above-mentioned primer sets in the breeding of pigs.

[0011] This invention also provides a method for SNP molecular polymerization breeding of pig carcass traits, comprising the following steps: (1) DNA extraction from the pigs to be tested; (2) Amplify the DNA extracted in step (1) using the sequences shown in SEQ ID NO.4 and SEQ ID NO.5, and then sequence it; (3) Select breeding pigs based on sequencing results.

[0012] Preferably, in step (3), the screening criteria for selecting breeding pigs based on sequencing results are as follows: The genotypes of the 98451341, 98451575, and 98451601 nucleotide sites of Chromosome7 in the test pigs were detected, and individuals with the aggregated genotype GG-CC-AA were selected.

[0013] This invention also provides an application of the SNP molecular polymerization breeding method for the above-mentioned pig carcass traits in breeding.

[0014] The beneficial effects of this invention compared to the prior art are as follows: (1) This invention provides three SNP loci that affect pig slaughter weight, carcass length and backfat thickness. Individuals with the GG genotype at SNP1, the CC genotype at SNP2 and the AA genotype at SNP3 all show higher slaughter weight and carcass length, while their backfat thickness is relatively lower. By accurately identifying the specific aggregated genotypes of the three SNP1, SNP2 and SNP3 loci, it is possible to efficiently screen high lean meat percentage breeding pigs with large slaughter weight, long carcass and thin backfat, providing a scientific and reliable molecular marker basis for pig breeding and accelerating the breeding process of high lean meat percentage breeding pigs.

[0015] (2) This invention not only significantly improves the accuracy and efficiency of breeding pig selection, but also brings important economic benefits to the pig industry. By optimizing the performance of breeding pigs, pork production and quality can be directly improved, breeding costs can be reduced, and market competitiveness can be enhanced. At the same time, it helps to meet the market demand for high-quality pork products and promotes the development of the pig industry towards high efficiency, high quality and sustainability. Attached Figure Description

[0016] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0017] Figure 1 This is the result of clone detection for segments containing positions 98451341, 98451575, and 98451601 of the porcine chromosome chromosome 7 in this embodiment of the invention; the agarose gel concentration is 1.0%; wherein: lane PCR: PCR amplification product; lane Maker: DL 5000 Maker; Figure 2 This is the sequencing map of the genetic marker sequences SNP1, SNP2 and SNP3 in this embodiment of the invention; Figure 3 This is a table showing the aggregation correlation analysis between SNP1(G / A), SNP2(C / T), SNP3(A / G) and pig carcass traits in the embodiments of the present invention. Detailed Implementation

[0018] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as a limitation of the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0019] It should be understood that the terminology used in this invention is merely for describing particular embodiments and is not intended to limit the invention. Furthermore, with respect to numerical ranges in this invention, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Every smaller range between any stated value or intermediate value within a stated range, and any other stated value or intermediate value within said range, is also included in this invention. The upper and lower limits of these smaller ranges may be independently included or excluded from the range.

[0020] Unless otherwise stated, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. While only preferred methods and materials have been described herein, any methods and materials similar or equivalent to those described herein may be used in the implementation or testing of this invention. All references to this specification are incorporated by way of citation to disclose and describe methods and / or materials associated with those references. In the event of any conflict with any incorporated reference, the content of this specification shall prevail.

[0021] Various modifications and variations can be made to the specific embodiments described in this specification without departing from the scope or spirit of the invention, as will be apparent to those skilled in the art. Other embodiments derived from this specification will also be apparent to those skilled in the art. This specification and embodiments are merely exemplary.

[0022] The terms “include,” “including,” “have,” “contain,” etc., used in this article are all open-ended terms, meaning that they include but are not limited to.

[0023] SEQ ID NO.1: CGGAACCGGAGGAGGGAGCTGACTGACACACTCCAAGCGGAGACAGACCAGCTAGAAGACGAGAAGTCTGCTTTGCAGACTGAGATCGCCAACCTGCTGAA; SEQ ID NO.2: CCCGAATCTGAGGAGGCCTTCACCCTGCCCCTCCTCAATGACCCGGAGCCCAAGCCCTCCGTGGAGCCAGTCAAGAACGTCAGCAGCATGGAGCTGAAGGC; SEQ ID NO.3: GCCCCTCCTCAATGACCCGGAGCCCAAGCCCTCCGTGGAGCCAGTCAAGAACGTCAGCAGCATGGAGCTGAAGGCCGAGCCCTTTGATGACTTCCTGTTCC.

[0024] Example

[0025] (1) Source of laboratory animals The sample consisted of 531 Duroc pigs from a pig farm in Lejiazhuang, Sanshui District, Foshan, Guangdong.

[0026] (2) Determination of slaughter characteristics Slaughter traits were measured in pigs at 7 months of age. All methods for collecting slaughter traits complied with Chinese national standards, including but not limited to GB / T 17236 (Livestock and Poultry Slaughtering Operation Procedures for Pigs). Important traits measured included slaughter weight, straight carcass length, oblique carcass length, backfat thickness at the thickest point of the shoulder, backfat thickness at the last rib, backfat thickness at the loin-sacral junction, and backfat thickness at the 6th-7th ribs.

[0027] (3) Genomic DNA extraction Collect (2) pig ear tissue samples from slaughtered pigs with slaughter trait records, and place them in centrifuge tubes containing 70% alcohol and store them in a -20 ℃ refrigerator for later use.

[0028] Genomic DNA was extracted from pig ear tissue using the Tiangen Blood DNA Extraction Kit (DP304). After quality and concentration testing, the extracted DNA was diluted to 50 ng / μL and stored at -20 ℃ for later use.

[0029] (4) PCR amplification Using the DNA extracted in step (3) as a template and the sequences shown in SEQ ID NO.4 and SEQ ID NO.5 as primers, the PCR reaction was carried out according to the following reaction system: Taq Master Mix, 10.0 μL; 10 μM Primer F, 0.4 μL; 10 μM Primer R, 0.4 μL; ddH2O, 8.2 μL; 50 ng / μL DNA, 1.0 μL.

[0030] PCR reaction procedure: denaturation at 95 ℃ for 5 min, denaturation at 95 ℃ for 25 s, annealing at 57 ℃ for 25 s, extension at 72 ℃ for 30 s, 32 cycles, extension at 72 ℃ for 5 min, and storage of PCR products at 4 ℃.

[0031] (5) Electrophoresis detection The product from step (4) PCR amplification was subjected to electrophoresis on a 1.0% agarose gel. The results are as follows: Figure 1 As shown. Sequencing of the amplified products (e.g.) Figure 2 As shown in Table 1, the pig FOS gene fragment sequence was compared and analyzed with the sequence in GenBank using DNAMAN software to determine the G / A polymorphism of the SNP1 Chromosome7 genotype at position 98451341. Single-marker association analysis was performed on the SNP1 genotype with slaughter weight, carcass length and backfat thickness using the mixed linear model with Bonferroni correction in SPSS Statistics software.

[0032] Table 1 Association analysis between SNP1 (G / A) and pig carcass traits

[0033] Table 1 shows that, compared with the AA genotype, individuals with the SNP1 polymorphism GG genotype have higher slaughter weight and carcass length, but lower backfat thickness. Therefore, in the selection of breeding pigs, successive generations of breeding individuals with the SNP1 GG genotype can gradually increase slaughter weight and carcass length, while significantly reducing backfat thickness, thereby improving lean meat percentage and economic benefits.

[0034] (6) Association analysis between SNP2 (C / T) and pig slaughter traits Based on the sequencing results of step (5), DNAMAN software was used to compare and analyze the pig FOS gene fragment sequence in GenBank to determine the C / T polymorphism of the genotype at position 98451575 of SNP2 Chromosome7. Using the Bonferroni correction of the mixed linear model in SPSS Statistics software, single-marker association analysis was performed on SNP2 genotype and slaughter weight, carcass length and backfat thickness. The results are shown in Table 2.

[0035] Table 2 Association analysis between SNP2 (C / T) and pig carcass traits

[0036] Table 2 shows that, compared with the TT genotype, individuals with the SNP2 polymorphism CC genotype had higher slaughter weight and carcass length, but lower backfat thickness. Therefore, in breeding pig selection, successive generations of breeding individuals with the SNP2 CC genotype can gradually increase slaughter weight and carcass length, while significantly reducing backfat thickness, thus improving lean meat percentage and economic benefits.

[0037] (7) Association analysis between SNP3 (A / G) and pig slaughter traits Based on the sequencing results of step (5), DNAMAN software was used to compare and analyze the pig FOS gene fragment sequence in GenBank to determine the A / G polymorphism of the genotype at position 98451601 of SNP3 Chromosome7. Using the Bonferroni correction of the mixed linear model in SPSS Statistics software, single-marker association analysis was performed on SNP3 genotype and slaughter weight, carcass length and backfat thickness. The results are shown in Table 3.

[0038] Table 3 Association analysis between SNP3 (A / G) and pig carcass traits

[0039] Table 3 shows that, compared with the GG genotype, individuals with the SNP3 polymorphism AA genotype had higher slaughter weight and carcass length, but lower backfat thickness. Therefore, in breeding pig selection, successive generations of breeding individuals with the SNP3 AA genotype can gradually increase slaughter weight and carcass length, while significantly reducing backfat thickness, thereby improving lean meat percentage and economic benefits.

[0040] (8) Association analysis of the combined genotypes of SNP1, SNP2, and SNP3 with slaughter traits in pigs Based on the sequencing results of step (5), DNAMAN software was used to compare and analyze the porcine FOS gene fragment sequence with that in GenBank. The polymorphisms of SNP1 Chromosome7 at position 98451341 (G / A), SNP2 Chromosome7 at position 98451575 (C / T), and SNP3 Chromosome7 at position 98451601 (A / G) were determined. Aggregated genotypes were then analyzed using the Bonferroni correction of a mixed linear model in SPSS Statistics software, and the association between aggregated genotypes and slaughter weight, carcass length, and backfat thickness was performed. The results are as follows: Figure 3 As shown.

[0041] Figure 3The results showed that different combinations of SNP1, SNP2, and SNP3 genotypes had a significant and consistent impact on carcass traits in pigs. This effect exhibited a clear allele dosage effect, meaning that phenotypic values ​​changed systematically as the total number of mutant alleles increased. The most significant difference was found when directly comparing the GG-CC-AA type (with the fewest mutant alleles, 0) with the AA-TT-GG type (with the most, 4): as the total number of mutant alleles increased from 0 to 4, slaughter weight showed a significant decreasing trend, while backfat thickness showed a significant increasing trend. Figure 3 The results clearly reveal the pattern of multi-gene superposition effects: when SNP1, SNP2, and SNP3 are considered together, their effects accumulate (or synergistically) to produce a sufficiently large and stable detectable impact on carcass traits. Selecting individuals with the GG-CC-AA genotype can simultaneously increase slaughter weight and carcass length while reducing backfat thickness, demonstrating significant breeding value.

[0042] The above description is only a preferred embodiment of the present invention. It should be noted that for those skilled in the art, several improvements and modifications can be made without departing from the principle of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.

Claims

1. A set of SNP molecular markers associated with pig slaughter weight, carcass length, and backfat thickness, characterized in that, The SNP molecular marker combination is located on pig chromosome 7, in the 4th exon of the FOS gene, and includes: SNP1 located at 98451341 bp on chromosome Chromosome7, with a polymorphism of G / A; And SNP2 located at 98451575 bp on chromosome Chromosome7, with a polymorphism of C / T; And SNP3 located at 98451601 bp on chromosome Chromosome7, with polymorphism A / G.

2. The SNP molecular marker combination associated with pig slaughter weight, carcass length, and backfat thickness as described in claim 1, characterized in that, The SNP1 is located at position 51 of the nucleotide sequence shown in SEQ ID NO.1; The SNP2 is located at position 51 of the nucleotide sequence shown in SEQ ID NO.2; The SNP3 is located at position 51 of the nucleotide sequence shown in SEQ ID NO.

3.

3. A primer set for detecting SNP locus combinations affecting slaughter weight, carcass length, and backfat thickness in pigs, characterized in that, Including the following sequences: Primer F-SEQ ID NO.4: CTCCAAGCGGTAGGTAGAATCC; Primer R-SEQ ID NO.5: GAAGGAACCAGACAGGTCCA.

4. The application of the SNP molecular marker combination of claim 1 or 2 or the primer set of claim 3 in the breeding of pigs.

5. A method for SNP molecular polymerization breeding of pig carcass traits, characterized in that, Includes the following steps: (1) DNA extraction from the pigs to be tested; (2) Amplify the DNA extracted in step (1) using the sequences shown in SEQ ID NO.4 and SEQ ID NO.5, and then sequence it; (3) Select breeding pigs based on sequencing results.

6. The SNP molecular polymerization breeding method for pig carcass traits according to claim 5, characterized in that, In step (3), the screening criteria for selecting breeding pigs based on sequencing results are as follows: The genotypes of the 98451341, 98451575, and 98451601 nucleotide sites of Chromosome7 in the test pigs were detected, and individuals with the aggregated genotype GG-CC-AA were selected.

7. The application of the SNP molecular polymerization breeding method for pig carcass traits as described in claim 5 or 6 in breeding.