Application of 3-(methylsulfonyl)propionitrile in the preparation of drugs for treating peripheral nerve adhesions
The drug prepared using 3-(methylsulfonyl)propionitrile (Dapansut, OLT1177) has solved the problem of poor treatment effect of peripheral nerve adhesions. By inhibiting adhesions and promoting nerve myelin regeneration, it achieves more comprehensive nerve function recovery.
Patent Information
- Application Number
- CN202512016492.4
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-12-30
- Publication Date
- 2026-06-05
Smart Images

Figure CN122140694A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of biomedical technology, and more particularly to the use of 3-(methylsulfonyl)propionitrile in the preparation of drugs for treating peripheral nerve adhesion diseases. Background Technology
[0002] The peripheral nervous system, as a crucial pathway for signal transmission between the central nervous system and target organs, is widely distributed and functionally important. Peripheral nerve adhesions are a common post-traumatic complication, often caused by accidental trauma such as traffic accidents, war injuries, and earthquakes. The core pathological mechanism involves abnormal adhesions between the injured nerve and surrounding muscles, fascia, and connective tissue, leading to nerve fiber compression and impaired nerve impulse conduction. This results in a series of symptoms, including limb motor dysfunction, sensory abnormalities, and muscle atrophy, severely impacting the patient's quality of life and limb function recovery.
[0003] Currently, clinical treatments for peripheral nerve adhesions mainly fall into three categories: surgical treatment, drug treatment, and physical therapy. Surgical treatment primarily involves nerve decompression, which separates adherent tissues to relieve nerve compression. However, surgery itself is invasive and may trigger new inflammatory responses and tissue damage, leading to a high risk of secondary adhesions. Drug treatment is mainly divided into two categories: broad-spectrum anti-inflammatory drugs (such as nonsteroidal anti-inflammatory drugs), which can only non-specifically inhibit systemic inflammatory responses and cannot precisely target the inflammatory microenvironment at the site of nerve injury; long-term use can easily cause side effects such as gastrointestinal irritation and liver and kidney damage. The other category consists of neurotrophic drugs (such as methylcobalamin and nerve growth factor), which can only supplement nerve nutrition and lack the effect of inhibiting adhesion formation, making it difficult to fundamentally resolve the core contradiction between nerve adhesion and repair, thus limiting the therapeutic effect. Physical therapy, including hot compresses, acupuncture, and rehabilitation training, can only relieve discomfort symptoms caused by mild adhesions; it cannot separate severe tissue adhesions or promote the structural repair of damaged nerves, and its clinical application is limited to adjunctive therapy. Summary of the Invention
[0004] The purpose of this invention is to solve the problems of poor treatment effect and high recurrence rate in the existing technology for nerve adhesion.
[0005] To achieve the above objectives, the present invention adopts the following technical solution:
[0006] Application of 3-(methylsulfonyl)propionitrile in the preparation of drugs for treating peripheral nerve adhesions.
[0007] Preferably, the molecular formula of the 3-(methylsulfonyl)propionitrile is C4H7NO2S, and its chemical structural formula is shown below:
[0008] .
[0009] Preferably, the peripheral nerve adhesion disease is a disease caused by nerve and muscle adhesion at the site of injury due to accidental trauma, resulting in the inability to transmit nerve impulses.
[0010] Preferably, the peripheral nerve adhesion disease includes sciatic nerve adhesion.
[0011] Preferably, the 3-(methylsulfonyl)propionitrile promotes the motor balance and nerve conduction rate of mice, and promotes the recovery of adherent nerves, so as to achieve the therapeutic effect on peripheral nerve adhesion disease.
[0012] This application also provides a medicament for treating peripheral nerve adhesions, wherein the medicament has 3-(methylsulfonyl)propionitrile as its active ingredient.
[0013] Preferably, the drug also includes medically acceptable excipients.
[0014] Preferably, the excipients are selected from one or more of diluents, adhesives, disintegrants, lubricants, cosolvents, and emulsifiers.
[0015] Preferably, the dosage form of the drug is one of the following: injection, topical gel, oral preparation, or topical ointment.
[0016] Compared with the prior art, this application has the following beneficial effects:
[0017] The drug proposed in this application can effectively reduce the degree of adhesion between the nerve and surrounding tissues and significantly improve muscle atrophy symptoms, as verified by a mouse model of sciatic nerve adhesion. Compared with the trauma and high recurrence rate of surgical treatment, the drug proposed in this application is a non-invasive or minimally invasive treatment with good patient tolerance. It can effectively reduce treatment risks and rehabilitation costs and has a wider range of clinical applicability.
[0018] Secondly, the drug in this application exerts its therapeutic effect through a dual mechanism of action: on the one hand, it inhibits adhesion formation and relieves nerve compression; on the other hand, it promotes myelin sheath regeneration, improves the integrity of the myelin sheath structure, and increases nerve conduction rate, achieving a synergistic effect of "adhesion relief + nerve repair." Animal experiments have confirmed that this drug can significantly improve the motor balance and gait function of model mice, and compared with existing treatments, it can more comprehensively promote the recovery of nerve function. Attached Figure Description
[0019] Figure 1 This is a comparative diagram used in one embodiment of this application to verify that dapanshutide (OLT1177) reduces sciatic nerve adhesions in mice;
[0020] Figure 2 This is a comparative diagram used in one embodiment of this application to verify that dapanthenol (OLT1177) effectively promotes the motor function of mice;
[0021] Figure 3 This is a comparative diagram used in one embodiment of the present application to verify that dapanshutide (OLT1177) effectively increases the sciatic nerve conduction rate in mice;
[0022] Figure 4 This is a comparative diagram used in one embodiment of this application to verify that dapanshutide (OLT1177) effectively promotes the motor balance ability of mice;
[0023] Figure 5 This is a comparative diagram used in one embodiment of the present application to verify that dapanshut (OLT1177) promotes nerve myelin regeneration and has a significant neuroprotective effect.
[0024] Figure 6 A comparative diagram showing the effects of dapanshut (OLT1177) on the development and repair of myelin sheath of the sciatic nerve in mice according to one embodiment of this application;
[0025] Figure 7 This is a comparative diagram showing that dapanthenol (OLT1177) inhibits the expression of inflammatory factors and has a significant anti-inflammatory effect in one embodiment of this application. Detailed Implementation
[0026] This application provides the use of 3-(methanesulfonyl)propionitrile in the preparation of a drug for treating peripheral nerve adhesion diseases, wherein the molecular formula of 3-(methanesulfonyl)propionitrile is C4H7NO2S, and its chemical structural formula is shown below:
[0027] .
[0028] The peripheral nerve adhesion disease is a condition caused by adhesion between nerves and muscles at the site of injury due to accidental trauma, resulting in the inability to transmit nerve impulses. In one embodiment, the peripheral nerve adhesion disease includes sciatic nerve adhesion.
[0029] Based on the above applications, this application also provides a medicament for treating peripheral nerve adhesions, the medicament comprising 3-(methylsulfonyl)propionitrile, and in one embodiment, the medicament further comprising a medically acceptable adjuvant.
[0030] The present invention will be further described in detail below with reference to specific embodiments.
[0031] I. Experimental Materials and Their Sources:
[0032] 3-(Methanesulfonyl)propanenitrile (Dapansutrile, OLT1177, CAS: 54863-37-5), bovine serum albumin, glutaraldehyde, and DMSO were purchased from Sigma-Aldrich. Real-time quantitative PCR dyes were purchased from Roche Biotechnology, and primers were from Shanghai Sangon Biotech Co., Ltd.
[0033] II. Construction of the Sciatic Nerve Adhesion Model
[0034] Eight-week-old ICR mice were selected and purchased from the Animal Center of Nanjing University.
[0035] The process of establishing the sciatic nerve adhesion model is as follows:
[0036] Anesthesia was administered subcutaneously with 3% sodium pentobarbital (1 mL / kg). The skin below the buttocks was incised, and the muscle was bluntly incised with fine surgical scissors and forceps to expose the right sciatic nerve in the middle of the thigh. 20 μL of an adhesive (45% bovine serum albumin + 12% glutaraldehyde) was dripped between the sciatic nerve and the muscle to construct a sciatic nerve adhesion model.
[0037] Drug experimental group: intraperitoneal injection of 30 µg / g dapanshutide (OLT1177) for 7 consecutive days.
[0038] Control group: 20 µL DMSO was injected intraperitoneally for 7 consecutive days.
[0039] All animal experimental protocols were approved by the Animal Protection and Utilization Committee of Nantong University and the Jiangsu Provincial Animal Protection Ethics Committee. The establishment of the mouse sciatic nerve adhesion model was carried out in accordance with the approved guidelines.
[0040] III. Observation of nerve adhesion and muscle atrophy in mice
[0041] Six weeks after model establishment, the sciatic nerve adhesion and muscle atrophy were compared between control and experimental mice to clarify the effect of dapanthenol (OLT1177) on nerve adhesion in mice. Mice were anesthetized by subcutaneous injection of 3% sodium pentobarbital (1 mL / kg). The skin below the buttocks was incised, and the skin and muscle tissue were separated to directly observe the phenotypic differences between the two groups of mice.
[0042] IV. Animal Behavioral Testing
[0043] To clarify the effect of dapanshut (OLT1177) on motor recovery in mice with sciatic nerve adhesions, rotarod experiments, electrophysiological experiments, and gait experiments were conducted in this application.
[0044] Spinning bar experiment: An accelerated spinning bar device (LE8500, Pan Laboratory) was used. Before the experiment, mice were acclimatized to the laboratory for 30 minutes. The mice were gently placed on the spinning bar by gently swinging them, and trained for 3 days at 3-5 minute intervals in accelerated mode (4-40 rpm). Training was repeated at a constant speed (16 rpm) until the mice could remain on the bar for at least 300 seconds. For the formal experiment, the mice were placed on a rotating drum, and the spinning bar was set to accelerated mode, accelerating at 4-40 rpm for 5 minutes. The time spent moving on the spinning bar was recorded before measuring the fall.
[0045] Gait experiment: Gait dynamics of quadrupeds were assessed by analyzing mouse footprints using the Digigait imaging system, with stride length of the hind limbs evaluated at a speed of 8 cm / s. Footprints were analyzed using four measurements: distance to the contralateral foot, footprint length, maximum toe extension between the first and fifth toes, and claw extension between the centers of the second and fourth toes.
[0046] Electrophysiological Experiments: In this study, mice were anesthetized with a compound anesthetic. Conduction velocity (NCV) was then measured using an electromyography (EMG) device (Neuropack S1 MEB-9402, Nihon-Kohden, Tokyo, Japan). A needle electrode was inserted into the gastrocnemius muscle of the mouse, with a ground electrode clipped to the exposed skin. The stimulation intensity was gradually increased from 0.1 mA to 3.0 mA, triggering a waveform. Stimulation was performed at a frequency of 1 Hz for 1 ms. Data were recorded for further analysis. Throughout the experiment, the mouse body temperature was maintained at 37℃ ± 0.5℃ using a heating lamp.
[0047] V. Electron Microscopic Observation of Sciatic Nerve Tissue
[0048] Three mice with sciatic nerve adhesions for 6 weeks were randomly selected from different groups (dapanshutide (OLT1177) treatment group and control group). Under deep anesthesia, sciatic nerve tissue from the adhesion site was harvested and cut into electron microscopy specimens (1.2 mm × 1 mm × 1 mm). The tissues were fixed in 4% glutaraldehyde solution, then fixed again with 1% osmium tetroxide, stained with uranium acetate, dehydrated with graded ethanol, embedded in epoxy resin, semi-thin sections for localization, and ultrathin sections counterstained with lead citrate. Selected sections were observed under a transmission electron microscope. The obtained images were analyzed using the instrument's built-in image analysis system to measure the myelinated nerve diameter and axon diameter. The myelin sheath thickness was measured using the axon diameter / myelinated nerve diameter ratio (g-ratio) to infer the protective effect of dapanshutide (OLT1177) on damaged nerves.
[0049] VI. Detection of Immune Factor Expression
[0050] Total RNA was extracted from sciatic nerve tissue using Invitrogen's Trizol reagent, and then first-strand cDNA was synthesized using Roche's reverse transcription kit. Gene expression analysis was performed using Roche's SYBR Green Supermix and a Bio-Rad iQ5 Multicolor Real-Time PCR Detection System. The results were analyzed using a 2... -△△Ct mRNA levels were calculated using a method that calibrates mRNA levels using the 18S housekeeping gene. The primer sequences used are as follows:
[0051] 18S rRNA forward primer: AGCTCCAATAGCGTATATTAAAG
[0052] 18S rRNA negative primer: CGGTCCTATTCCATTATTCCTA
[0053] IL1α forward primer: GTGTTGCTGAAGGAGTTG
[0054] IL1α negative primer: ATCTGGAAGTCTGTCATAGAG
[0055] IL12α forward primer: TTCTCCCATCACATCTCATC
[0056] IL12α negative primer: TGCTCTTCTGCTAACACAT
[0057] TNFα forward primer: GCTTTTCAACAACTACTCAGAA
[0058] TNFα negative primer: GATCTTATCCAGCCTCATTCT
[0059] VII. Experimental Results
[0060] The peripheral nervous system is widely distributed throughout the body and plays a crucial role in transmitting signals between target organs and the central nervous system. Peripheral nerve injury and adhesions are common clinical symptoms, especially those caused by accidental trauma such as traffic accidents, war, and earthquakes, where nerve and muscle adhesions at the site of injury prevent nerve impulse transmission. The sciatic nerve is the most important and readily observable material for studying peripheral nerve adhesions. Therefore, this application uses the sciatic nerve for subsequent experiments.
[0061] 3-(Methanesulfonyl)propanenitrile (Dapansutrile, OLT1177, CAS: 54863-37-5) is a β-sulfonyl nitrile compound with strong bioactivity inhibiting the NLRP3 inflammasome and has been proven safe for humans. Studies have shown that OLT1177 can treat acute kidney injury (AKI) mediated by NLRP3 inflammasome-mediated pyroptosis. In cancer treatment, the combined use of OLT1177 and dexamethasone can reduce tumor growth by targeting the nuclear and mitochondrial functions of STAT3. To date, numerous studies have shown that OLT1177 has therapeutic effects on knee osteoarthritis, gout, and melanoma, with the gout indication currently in phase II clinical trials. It is well known that persistent neuroinflammation is a key factor affecting the treatment of peripheral nerve adhesions, and dapansutrile (OLT1177) has excellent anti-inflammatory effects. Therefore, we investigated the relationship between 3-(methanesulfonyl)propanenitrile (Dapansutrile, OLT1177, CAS: 54863-37-5) and peripheral nerve adhesions.
[0062] To investigate whether 3-(methanesulfonyl)propanenitrile (Dapansutrile, OLT1177, CAS: 54863-37-5) can improve the degree of peripheral nerve adhesion in vivo, a sciatic nerve adhesion model was established using ICR mice. The difference in the degree of nerve adhesion between the drug experimental group and the control group was observed. The results showed that dapansutrile (OLT1177) can effectively reduce the degree of nerve adhesion. Figure 1 Motor behavior analysis was conducted to examine changes in balance and nerve conduction rate in mice treated with dapanshutide (OLT1177). The results showed that mice treated with dapanshutide (OLT1177) exhibited better recovery of balance and faster nerve conduction rate. Figure 2-4 To further clarify the protective effect of dapanthenol (OLT1177) on adherent sciatic nerve tissue, this application used transmission electron microscopy to observe the myelin sheath tissue of the sciatic nerve in different groups of mice. The results showed that the myelin sheath structure of the adherent nerve was more orderly and the newly formed myelin sheath was thicker after drug treatment. Figure 56). Prolonged neuroinflammation is a significant factor affecting the recovery of nerve adhesions. To confirm the biological mechanism by which dapanthenide (OLT1177) regulates sciatic nerve adhesions, this application analyzed the drug's effect on the expression of inflammatory factors. The results showed that the drug effectively inhibited the expression of pro-inflammatory factors, significantly suppressed the occurrence and development of inflammation, maintained the immune microenvironment, and facilitated nerve recovery. Figure 7 ).
[0063] The above results indicate that 3-(Methanesulfonyl)propanenitrile (Dapansutrile, OLT1177, CAS: 54863-37-5) can effectively promote the motor balance and nerve conduction rate of mice, promote the recovery of adherent nerves, and has a positive therapeutic effect on peripheral nerve adhesion diseases.
Claims
The use of 1,3-(methanesulfonyl)propionitrile in the preparation of drugs for treating peripheral nerve adhesions.
2. The use of 3-(methylsulfonyl)propionitrile according to claim 1 in the preparation of a drug for treating peripheral nerve adhesion diseases, characterized in that: The molecular formula of the 3-(methylsulfonyl)propionitrile is C4H7NO2S, and its chemical structural formula is shown below: 。 3. The use of 3-(methylsulfonyl)propionitrile according to claim 1 in the preparation of a drug for treating peripheral nerve adhesion diseases, characterized in that: The peripheral nerve adhesion disease is a condition caused by nerve and muscle adhesion at the site of injury due to accidental trauma, resulting in the inability to transmit nerve impulses.
4. The use of 3-(methanesulfonyl)propionitrile according to claim 3 in the preparation of a drug for treating peripheral nerve adhesion diseases, characterized in that: The peripheral nerve adhesion diseases include sciatic nerve adhesions.
5. The use of 3-(methanesulfonyl)propionitrile according to claim 1 in the preparation of a drug for treating peripheral nerve adhesions, characterized in that: The 3-(methylsulfonyl)propionitrile promotes the motor balance and nerve conduction rate in mice, and promotes the recovery of adherent nerves, thereby achieving the therapeutic effect on peripheral nerve adhesion diseases.
6. A drug for treating peripheral nerve adhesions, characterized in that: The drug uses 3-(methylsulfonyl)propionitrile as its active ingredient.
7. A medicament for treating peripheral nerve adhesions according to claim 6, characterized in that: The drug also includes medically acceptable excipients.
8. A medicament for treating peripheral nerve adhesions according to claim 7, characterized in that: The excipients are selected from one or more of the following: diluents, adhesives, disintegrants, lubricants, cosolvents, and emulsifiers.
9. A medicament for treating peripheral nerve adhesions according to claim 8, characterized in that: The dosage form of the drug is one of the following: injection, topical gel, oral preparation, or topical ointment.