A ms2 virus-like particle based on site-directed mutation of coat protein and preparation method and application thereof
By site-directed mutagenesis and expression control of the MS2 phage capsid protein, the problems of expression imbalance and RNA stability in the in vitro self-assembly of MS2 phage were solved, achieving efficient RNA encapsulation and improved stability.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- NINGBO INST OF TECH ZHEJIANG UNIV ZHEJIANG
- Filing Date
- 2026-03-24
- Publication Date
- 2026-06-05
Smart Images

Figure CN122145587A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of molecular biology, specifically to an MS2 virus-like particle based on site-directed mutagenesis of capsid protein, its preparation method, and its application. Background Technology
[0002] MS2 bacteriophage is an icosahedral, positive-sense single-stranded RNA virus. MS2 bacteriophage consists of a capsid protein (CP), a mature protein (MP / A protein), and genomic RNA. In native MS2 bacteriophage, the mature enzyme is located as a single copy at the vertices of the icosahedral capsid; the capsid protein forms a complete capsid with 90 dimers (180 monomers); the MS2 genomic RNA contains multiple packaging signals, which are the initiation sites for viral capsid assembly.
[0003] The assembly of MS2 bacteriophages is highly specific, relying on the precise interaction between capsid proteins and RNA packaging signals. The capsid proteins first recognize and bind to the TR stem-loop structure (assembly initiation site) on the RNA. Using this complex as a core, capsid protein monomers are added stepwise to form a complete icosahedron. Mature proteins are added later in the assembly process to complete viral particle maturation, ultimately leaving only one maturation enzyme molecule in the capsid. The maturation enzyme and capsid proteins assemble into MS2 viral particles at a ratio of 1:180. This ratio is determined by the translational regulation of the viral genome (high expression of capsid proteins and low expression of the maturation enzyme) and assembly kinetics.
[0004] MS2 phage capsid protein (CP) is a 130-amino acid polypeptide that forms a stable dimer as the basic assembly unit, ultimately constructing an icosahedral capsid. The basic structure of the capsid protein includes an N-terminal hairpin, a central β-sheet, and a C-terminal α-helical arm, as shown below. Figure 1 As shown, specifically: N-terminal hairpin: β chains A and B (positions 2-26); central β-sheet: 5 antiparallel β chains CG (positions 27-101), forming a 10-chain β-sheet across the dimer interface; C-terminal α-helical arm: two α-helices (positions 102-130), interlocking to form a dimeric hydrophobic core.
[0005] In vitro, the MS2 capsid protein self-assembles into MS2 viral particles (VLPs) by recognizing the pac packaging signal (19 nt stem-loop structure) on the target RNA, such as... Figure 2 As shown. Taking advantage of this characteristic, virus-like particles encapsulating virus-specific RNA fragments (such as the N gene of SARS-CoV-2, the HA gene of influenza virus, and the gag gene of HIV) have been developed, which can be used as positive control samples for RNA virus nucleic acid detection.
[0006] For example, Qi et al. developed a positive control for SARS-CoV-2 RNA detection using a single plasmid dual expression system, achieving an RNA copy number of up to 6.47 × 10⁻⁶. 12 The MS2 virus-like particles exhibit high stability (copies / μL) and are highly stable (Qi LL, et al. 2023). Stevenson et al. developed a positive control for SARS virus detection using MS2 virus-like particles for RT-PCR detection of SARS virus (Stevenson J, et al. 2008). Qi Lili et al. developed a positive control for SARS-CoV-2 nucleic acid detection using the in vitro assembly characteristics of MS2 bacteriophage (CN114921485A); Qiao Caixia et al. developed a positive control for influenza A virus nucleic acid detection (CN103571865A); Zhang Zhan et al. developed virus-like particles of foot-and-mouth disease virus type O and Seneca virus nucleic acid for use as positive controls for veterinary infectious diseases (CN117304276A).
[0007] Although some studies have developed virus-like particles based on the in vitro self-assembly characteristics of MS2 bacteriophage as quality control materials for RNA virus nucleic acid detection, there are still many problems with MS2 bacteriophage in vitro self-assembly: First, the expression levels of maturation enzymes and capsid proteins are not effectively regulated, resulting in an imbalance between the two and affecting packaging efficiency; second, the capsid protein packaging is not complete, leading to RNA degradation by RNase; and third, a large number of empty viral particles without RNA encapsulation appear during in vitro self-assembly. Summary of the Invention
[0008] The purpose of this invention is to improve the assembly efficiency and stability of capsid protein dimers by site-directed mutagenesis of amino acid sites in capsid proteins, thereby enhancing the integrity of the MS2 virus capsid and improving the RNA encapsulation rate and stability. Furthermore, by designing expression elements for the maturation enzyme and capsid protein, the weak expression of the maturation enzyme and the strong expression of the capsid protein are controlled to improve assembly efficiency.
[0009] To achieve the above objectives, the present invention adopts the following technical solution: This invention involves site-directed mutagenesis of the amino acid sequence of the MS2 bacteriophage capsid protein to obtain a capsid protein mutant that can improve the assembly efficiency of MS2 virus-like particles. Specifically, the mutant is a mutant obtained by amino acid mutation of the MS2 phage capsid protein with the amino acid sequence shown in SEQ ID NO.1. The amino acid mutation is at least one of the following mutations: lysine (K) at position 62 is mutated to arginine (R), tryptophan (W) at position 83 is mutated to phenylalanine (F), glutamic acid (E) at position 103 is mutated to aspartic acid (D), valine (V) at position 76 is mutated to histidine (H), proline (P) at position 79 is mutated to alanine (A), serine (S) at position 85 is mutated to threonine (T), lysine (K) at position 44 is mutated to arginine (R), methionine (M) at position 89 is mutated to leucine (L), glycine (G) at position 128 is mutated to alanine (A), and isoleucine (I) at position 129 is mutated to alanine (A).
[0010] In this invention, site-directed mutagenesis is performed on amino acids at the β-sheet interface of the capsid protein sequence (positions 44, 62, 76, 79, 83, 85, and 89) to enhance dimer stability; site-directed mutagenesis is performed on amino acids at the interface during the assembly of two capsid protein molecules (positions 83, 89, 103, 128, and 129) to improve the assembly of capsid protein monomers; and site-directed mutagenesis is performed on the carboxyl terminus sequence of the capsid protein (positions 103, 128, and 129) to improve capsid conformational stability.
[0011] Specifically, the amino acid sequence of the mutant is shown in any one of SEQ ID NO.6-SEQ ID NO.17.
[0012] Studies have shown that, compared to wild-type MS2 phage capsid proteins, K62R, W83F, and E103D mutations increase the proportion of soluble capsid proteins, reduce monomer degradation or aggregation, and enhance dimer stability; V76H, P79A, and S85T mutations increase the proportion of AB-type dimers with assembly activity, thereby overcoming the rate-limiting step in assembly; K44R and M89L mutations increase the proportion of ordered dimer assembly and reduce random aggregation or mismatch assembly; G128A and I129A stabilize the conformation of the assembled capsid, reduce the risk of depolymerization, and improve particle integrity.
[0013] The assembly efficiency of MS2 pseudoviruses with K62R, P79A, and K44R combined mutations is increased to over 80%, while the assembly efficiency of MS2 pseudoviruses with W83F, E103D, and I129A combined mutations reaches 70%~75%. The capsid thermal stability of the above two combined mutants is improved, with Tm increasing by more than 5°C.
[0014] This invention also provides a coding gene for encoding the capsid protein mutant, wherein the nucleotide sequence of the coding gene is based on the nucleotide sequence shown in SEQ ID NO.2, with codons encoding the corresponding amino acids replaced. This invention can obtain the coding gene artificially; alternatively, it can be obtained through site-directed mutagenesis.
[0015] The present invention also provides the application of the MS2 phage capsid protein mutant in the preparation of MS2 virus-like particles, which can be used as a quality control test for RNA virus nucleic acid detection.
[0016] Furthermore, the MS2 virus-like particle contains the MS2 phage maturation enzyme protein, the MS2 phage capsid protein mutant, and a virus-specific RNA fragment encapsulated within the particle.
[0017] In this invention, the method for preparing the MS2 virus-like particles includes: cloning and recombining the coding sequence of the MS2 phage capsid protein mutant, the coding sequence of the MS2 phage mature enzyme protein, and the coding sequence of the target virus-specific RNA fragment into an expression vector to construct a recombinant plasmid, then transforming it into a host cell to induce the expression of the capsid protein mutant, the mature enzyme protein, and the target virus-specific RNA fragment, and packaging it to form MS2 virus-like particles.
[0018] The target virus-specific RNA fragment contains an MS2 phage packaging site sequence (pac) within its coding sequence. During virus-like particle self-assembly, capsid proteins recognize and bind to the RNA packaging site. Using this site as a core, capsid proteins are gradually added to form a complete icosahedron. Mature proteins are added later in the assembly process to complete virus particle maturation. Utilizing this packaging characteristic of MS2, exogenous RNA sequences can be ligated to the packaging site to prepare MS2 virus-like particles packaged with RNA from different sources.
[0019] Specifically, the pac sequence is inserted downstream of the 3′ end of the target virus-specific RNA coding region. The pac sequence is 5′-ACATGAGGATCACCCATGT-3′.
[0020] In this invention, the MS2 virus-like particles can be used as positive control samples for viral nucleic acid detection. The virus-specific internal reference RNA fragment in the virus-like particles can be replaced according to the specific type of virus to be tested, such as influenza A virus, respiratory syncytial virus, and other RNA viruses.
[0021] Furthermore, in the recombinant plasmid constructed by the above preparation method, the capsid protein mutant, the mature enzyme protein, and the target virus-specific RNA fragment are all expressed by independent operons. Preferably, the capsid protein mutant and the mature enzyme protein are expressed by different operons, with strong expression of the capsid protein and weak expression of the mature enzyme, in order to control the expression ratio of the mature enzyme and the capsid protein.
[0022] Preferably, the expression vector can be, but is not limited to, the pCDFDuet-1 vector.
[0023] Preferably, the host cell can be, but is not limited to, Escherichia coli (E. coli).
[0024] The present invention also provides a capsid protein dimer, wherein the dimer is formed by linking the MS2 phage capsid protein mutant and the wild-type MS2 phage capsid protein with the amino acid sequence shown in SEQ ID NO.1 through a linker.
[0025] Preferably, the linker is a flexible linker, which can improve the assembly efficiency of capsid protein dimers by connecting two capsid protein molecules together.
[0026] Preferably, the sequence of the connector is (GGGGS). n (GGGS) n Or (GGS) n , where n = 2~5.
[0027] The present invention also provides a coding gene for encoding the capsid protein dimer. The coding gene can be obtained artificially; alternatively, it can be obtained by ligating the mutant coding sequence and the wild-type capsid protein coding sequence using overlap PCR technology.
[0028] This invention also provides a method for preparing MS2 virus-like particles, comprising the following steps: (1) The coding sequence A of the capsid protein dimer, the coding sequence B of the mature enzyme protein, and the coding sequence C of the target virus-specific RNA fragment to be detected are cloned and recombined into an expression vector to construct a recombinant plasmid; the coding sequence C consists of an RNA coding region fragment and an MS2 phage packaging site sequence; (2) After the recombinant plasmid is transformed into the host cell, the expression of capsid protein dimer, mature enzyme protein and target virus-specific RNA fragment is induced and packaged to form MS2 virus-like particles.
[0029] In one specific embodiment of the present invention, the expression vector is pCDFDuet-1 vector, and the host cell is Escherichia coli (E. coli).
[0030] In one specific embodiment of the present invention, the recombinant plasmid integrates an arabinose operon sequence upstream of coding sequence B, and the SD sequence adopts a weak ribosome binding site sequence; coding sequences A and C are cloned downstream of different lactose operon regions, and the SD sequence adopts a strong ribosome binding site sequence.
[0031] This invention places the mature enzyme (MP) gene downstream of the arabinose operon promoter, allowing its expression to be induced and controlled by arabinose in the culture medium. The SD sequence uses a weak ribosome binding site. The capsid protein gene is placed downstream of the T7 promoter and the lac operon, allowing its expression to be induced and controlled by IPTG. The SD sequence uses a strong ribosome binding site. A viral RNA coding region fragment and an MS2 RNA packaging recognition site sequence are placed downstream of another T7 promoter and the lac operon, allowing their expression to be induced and controlled by IPTG. The SD sequence uses a strong ribosome binding site. Through the design of these expression elements, weak expression of the mature enzyme and strong expression of the capsid protein are achieved, controlling the expression levels of the mature enzyme and capsid protein to ensure an appropriate ratio and improve packaging efficiency.
[0032] Specifically, the arabinose operon sequence is shown in SEQ ID NO.3.
[0033] Preferably, the weak ribosome binding site sequence is 5′-GGGA-3′, with a 6 bp interval from the start codon, and the interval sequence can be 5′-GCGGCG-3′.
[0034] Preferably, the strong ribosome binding site sequence is 5′-AGGAGG-3′, the start codon interval is 7 bp, and the spacer sequence can be 5′-AATAATA-3′.
[0035] This invention optimizes the expression levels and ratios of mature enzymes and capsid proteins by screening and optimizing conditions such as inducer concentration, induction time, induction interval, and induction temperature, ultimately achieving efficient assembly and long-term stability of MS2 virus-like particles. Preferably, in step (2), the induction conditions are: culturing the recombinant bacterial cells to OD... 600 When the concentration is 0.6~0.8, add L-arabinose to a final concentration of 0.02% by volume, lower the temperature to 30℃, and incubate for 2~4 h; then add IPTG to a final concentration of 0.5~1 mM, maintain the conditions of 30℃ and 220 rpm, and continue to incubate for 4~6 h.
[0036] In step (2), after the induction expression is completed, the bacterial cells are collected, the bacterial cells are sonicated and broken, and the bacterial cell fragments are removed after centrifugation at 5000 rpm to obtain the supernatant. MS2 virus-like particles are separated and purified from the supernatant.
[0037] The present invention also provides MS2 virus-like particles prepared by the above method. These MS2 virus-like particles can be used as a positive control for virus detection.
[0038] The MS2 virus-like particles prepared by this invention are uniform in size, with a stable diameter of about 30 nm, exhibiting a regular spherical shape, a complete capsid, and a clear outline; the RNA purity can reach 99.9968%, and the RNA copy number can reach 5.87 × 10⁻⁶. 11 The RNA copy number remained at 5.43 × 10^6 copies / μL after 90 days of storage at 25°C. 11 It has good stability and meets the standards for quality control products in nucleic acid testing.
[0039] The present invention also provides a virus detection kit, the kit including a positive control, wherein the positive control is MS2 virus-like particles prepared by the preparation method described above.
[0040] In one specific embodiment of the present invention, the kit is an influenza A virus H3N2 detection kit, and when preparing MS2 virus-like particles, the RNA coding region fragment of the coding sequence C adopts the coding sequence of the influenza A virus M gene.
[0041] In one specific embodiment of the present invention, when the kit is used to prepare MS2 virus-like particles from respiratory syncytial virus, the RNA coding region fragment of the coding sequence C adopts the coding sequence of the respiratory syncytial virus N gene.
[0042] The beneficial effects of this invention are as follows: This invention involves site-directed mutagenesis of amino acids at the β-sheet interface of the capsid protein sequence, amino acids at the interface during the assembly of two capsid protein molecules, and the carboxyl terminus of the capsid protein, resulting in mutants that significantly improve the assembly efficiency and stability of capsid protein dimers. MS2 virus-like particles are constructed using these mutants. Further, by designing expression elements for the maturing enzyme and capsid protein, weak expression of the maturing enzyme and strong expression of the capsid protein are controlled, thereby improving assembly efficiency. Through the above strategies, this invention significantly improves the assembly efficiency of MS virus-like particles, increases the proportion of encapsulated RNA, enhances the stability of virus-like particles, significantly extends the stable storage time of RNA, and improves the purity of the encapsulated RNA. Attached Figure Description
[0043] Figure 1 This is a structural diagram of the MS2 virus capsid protein, where A is the capsid protein monomer and B is the capsid protein dimer.
[0044] Figure 2 This refers to the interaction between the MS2 viral capsid protein and the RNA packaging site.
[0045] Figure 3 The spectrum of the pCDFDuet-1-ARA vector.
[0046] Figure 4 The spectrum of the pCDFDuet-1-ARA-Mat vector.
[0047] Figure 5 The spectrum of the pCDFDuet-1-ARA-Mat-CP2 vector.
[0048] Figure 6 The spectrum of the pCDFDuet-1-ARA-Mat-CP2-InfluenzaA M vector.
[0049] Figure 7 The spectrum of the pCDFDuet-1-ARA-Mat-CP2-RSV N vector.
[0050] Figure 8 Assembly efficiency of MS2 particles of different variants: 1 is wild type; 2 is K62R / P79A / K44R; 3 is W83F / E103D / I129A; 4 is WT-Linker-K62R / P79A / K44R; 5 is WT-Linker-W83F / E103D / I129A; 6 is WT-Linker-WT.
[0051] Figure 9 The capsid dissolution temperature curve for the K62R / P79A / K44R mutant MS2.
[0052] Figure 10 The images are transmission electron microscopy (TEM) images of MS2 pseudovirus particles. The left image shows wild-type MS2 particles, and the right image shows K62R / P79A / K44R mutant MS2 particles.
[0053] Figure 11 To assess the stability of wild-type and mutant MS2 virus particle RNA.
[0054] Figure 12 The capsid dissolution temperature curve for the WT-(GGGGS)2-K62R / P79A / K44R mutant MS2.
[0055] Figure 13 Transmission electron microscopy observation of MS2 particles of the WT-(GGGGS)2-K62R / P79A / K44R mutant.
[0056] Figure 14 The capsid dissolution temperature curve for the W83F / E103D / I129A mutant MS2.
[0057] Figure 15Transmission electron microscopy observation of MS2 particles of the W83F / E103D / I129A mutant.
[0058] Figure 16 The capsid dissolution temperature curve for the WT-(GGGGS)2-W83F / E103D / I129A mutant MS2.
[0059] Figure 17 Transmission electron microscopy observation of MS2 particles of the WT-(GGGGS)2-W83F / E103D / I129A mutant.
[0060] Figure 18 The melting temperature curve of the WT-(GGGGS)2-WT MS2 capsid is shown.
[0061] Figure 19 Transmission electron microscopy observation of WT-(GGGGS)2-WT MS2 particles. Detailed Implementation
[0062] The present invention will be further described below with reference to specific embodiments. These embodiments are for illustrative purposes only and are not intended to limit the scope of the invention. Any modifications or substitutions made to the methods, steps, or conditions of the present invention without departing from the spirit and essence of the invention are within the scope of the invention.
[0063] Unless otherwise specified, the experimental methods used in the following examples are conventional methods; the materials and reagents used are commercially available unless otherwise specified.
[0064] The nucleotide sequence is from the 5′ end to the 3′ end from left to right.
[0065] Example 1 1. Site-directed mutagenesis of the amino acid sequence of capsid protein. The amino acid sequence of the wild-type capsid protein (UniProt number: P03612) is shown in SEQ ID NO.1, and the nucleotide sequence encoding the gene is shown in SEQ ID NO.2. In this embodiment, a site-directed mutagenesis was performed on the β-sheet interface of the sequence, specifically: the K at position 62 was mutated to R, and the amino acid sequence is shown in SEQ ID NO.6.
[0066] This embodiment uses overlap PCR for site-directed mutagenesis, and the specific method is as follows: (1) Based on the codon preference of the host cell, four specific primers were designed. Among them, R1 (downstream mutation primer) and F2 (upstream mutation primer) are complementary mutation primer pairs to introduce the K→R codon mutation (AAA→CGT). F1 is the upstream primer on the outer side of the 5′ end of the gene, and R2 is the downstream primer on the outer side of the 3′ end of the gene. The primers cover the entire coding region. The specific design is as follows: N-terminal fragment upstream outer primer F1: ATGGCGTCTAACTTCACCCAGTTCGTTCTGG; N-terminal fragment downstream mutant primer R1: CGGAACTTCAACACGGATGGTGTATTT; C-terminal upstream mutant primer F2: AATACACCATCCGTGTTGAAGTTCCG; C-terminal fragment downstream outer primer R2: TTAGTAGATACCAGAGTTCGCCGCGATCG.
[0067] (2) Overlap extension PCR (SOE-PCR), the process is as follows: First round of PCR: Amplification of two gene fragments containing overlapping mutation regions (fragment 1 and fragment 2). Using plasmids / linear fragments containing wild-type capsid protein encoding genes as templates, N-terminal fragment 1 (F1+R1) and C-terminal fragment 2 (F2+R2) were amplified, respectively. The two fragments have a 20-30 bp overlap in the mutation site region. The reaction system was 25 μL (which can be scaled up proportionally), for a total of 2 reaction systems.
[0068] Reaction system (25 μL): 10×Buffer 2.5 μL, dNTP Mix (2.5 mM) 2.0 μL, upstream primer (10 μM) 1.0 μL, downstream primer (10 μM) 1.0 μL, template DNA (10 ng / μL) 1.0 μL, Taq enzyme 0.5 μL, sterile ddH2O 17.0 μL.
[0069] PCR amplification program (adapted to Q5 / PrimeSTAR high-fidelity enzyme): 1. Pre-denaturation: 98℃ for 30 s; 2. Amplification reaction: 95℃ for 30 s, 63℃ for 1 min, 72℃ for 1 min, for a total of 30 cycles; 3. Final extension: 72℃ for 10 min; 4. Incubation: 4℃.
[0070] Product processing: Take 5 μL of the first round PCR product for agarose gel electrophoresis to verify the size of fragment 1 and fragment 2 (consistent with expectations). Then, purify the two fragments using a gel extraction kit to remove impurities such as primers and dNTPs, and obtain purified fragment 1 and fragment 2.
[0071] Second round PCR: overlap extension amplification of the complete mutant gene Using the purified fragment 1 + fragment 2 as a mixed template, only the outer primers F1 + R2 were added, and the full-length mutant target gene was obtained by annealing the overlapping region of the two fragments.
[0072] Reaction system (25 μL): 10×Buffer 2.5 μL, dNTP Mix (2.5 mM) 2.0 μL, outer primer F1 (10 μM) 1.0 μL, outer primer R2 (10 μM) 1.0 μL, fragment 1 + fragment 2 (50 ng each) 2.0 μL, Taq enzyme 0.5 μL, sterile ddH2O 16.0 μL.
[0073] PCR amplification: 1. Pre-denaturation: 98℃ for 30 s; 2. Denaturation-annealing-extension: 98℃ for 10 s, 60~65℃ for 15 s, 72℃ for 1~2 min, for a total of 30 cycles; 3. Final extension: 72℃ for 5 min; 4. Incubation: 4℃.
[0074] Product validation: Take 5 μL of the second round PCR product and perform agarose gel electrophoresis. If the band size is consistent with the full length of the target gene, it is considered a preliminary success.
[0075] 2. Linker expression strategy for capsid protein dimers In this embodiment, a K62R mutant capsid protein molecule and a wild-type capsid protein molecule are linked together using a flexible linker (GGGGS)2. Specifically, overlapping PCR is used for the ligation, as follows: (1) Design 4 specific primers, of which R3 and F4 contain the (GGGGS)2 coding sequence. F3 is the upstream primer on the outer side of the 5′ end of the gene, and R4 is the downstream primer on the outer side of the 3′ end of the gene. The primers cover the entire coding region. The specific design is as follows: Upstream outer primer F3: ATGGCGTCTAACTTCACCCAGTTCGT; Downstream primer R3: AGAACCACCACCACCAGAACCACCACCACCATAAATACCGCTGTTCGCCGCAATC; Upstream primer F4: GGTGGTGGTGGTTCTGGTGGTGGTGGTTCTGCGTCTAACTTCACCCAGTTCGT; Downstream outer primer R4: TTAGTAGATACCAGAGTTCGCCGCGAT.
[0076] (2) Perform overlap extension PCR (SOE-PCR), the process is as follows: First round of PCR: Amplification of the K62R mutant sequence (F3+R3) and the wild-type capsid protein sequence (F4+R4) (fragments 3 and 4). The amplification products from step 1 and the plasmid / linear fragment containing the wild-type capsid protein encoding gene were used as templates to amplify the K62R mutant sequence and the wild-type capsid protein sequence, respectively. The system was 25 μL (which can be scaled up proportionally), for a total of 2 reaction systems.
[0077] Reaction system (25 μL): 10×Buffer 2.5 μL, dNTP Mix (2.5 mM) 2.0 μL, upstream primer (10 μM) 1.0 μL, downstream primer (10 μM) 1.0 μL, template DNA (10 ng / μL) 1.0 μL, Taq enzyme 0.5 μL, sterile ddH2O 17.0 μL.
[0078] PCR amplification program (adapted to Q5 / PrimeSTAR high-fidelity enzyme): 1. Pre-denaturation: 98℃ for 30 s; 2. Amplification reaction: 95℃ for 30 s, 65℃ for 1 min, 72℃ for 1 min, for a total of 30 cycles; 3. Final extension: 72℃ for 10 min; 4. Incubation: 4℃.
[0079] Product processing: Take 5 μL of the first-round PCR product and perform agarose gel electrophoresis to verify the size of fragment 3 and fragment 4 (consistent with expectations). Then, purify the two fragments using a gel extraction kit to remove impurities such as primers and dNTPs, and obtain purified fragment 3 and fragment 4.
[0080] Second round PCR: overlap extension amplification of capsid protein dimer Using the purified fragment 3+ fragment 4 as a mixed template, only the outer primer F3+R4 was added, and the full-length sequence (K62Rmutant-(GGGGS)4-WT) was obtained by annealing the overlapping region of the two fragments.
[0081] Reaction system (25 μL): 10×Buffer 2.5 μL, dNTP Mix (2.5 mM) 2.0 μL, outer primer F3 (10 μM) 1.0 μL, outer primer R4 (10 μM) 1.0 μL, fragment 3 + fragment 4 (50 ng each) 2.0 μL, Taq enzyme 0.5 μL, sterile ddH2O 16.0 μL.
[0082] PCR amplification: 1. Pre-denaturation: 98℃ for 30 s; 2. Denaturation-annealing-extension: 98℃ for 10 s, 60~65℃ for 15 s, 72℃ for 1~2 min, for a total of 30 cycles; 3. Final extension: 72℃ for 5 min; 4. Incubation: 4℃.
[0083] Product validation: Take 5 μL of the second round PCR product and perform agarose gel electrophoresis. If the band size is consistent with the full length of the target gene, it is considered a preliminary success.
[0084] 3. Co-expression strategy of maturation enzyme and capsid protein 3.1 Construction of Dual Expression Vectors The arabinose operon sequence (as shown in SEQ ID NO.3) was recombined into the pCDFDuet-1 vector using the single plasmid dual expression vector pCDFDuet-1. Specifically, the pCDFDuet-1 vector and the arabinose operon sequence were digested with EcoRI and HindIII, respectively, and then ligated with T4 DNA ligase to construct the pCDFDuet-1-ARA vector. Figure 3 ).
[0085] The pCDFDuet-1-ARA vector and the coding sequence of the mature enzyme (MP) were digested with Hind III and Not I (as shown in SEQ ID NO. 4). The mature enzyme (MP) gene was placed downstream of the arabinose operon promoter, and its expression was controlled by arabinose induction in the culture medium. The weak ribosome binding site (GGGA) was selected as the SD sequence. This SD sequence is located 10 to 7 positions upstream of the start codon sequence of the MP coding sequence, with a 6 bp gap from the start codon +1. The spacer sequence is GCGGCG. The pCDFDuet-1-ARA-Mat vector was constructed. Figure 4 ).
[0086] The coding sequences of the pCDFDuet-1-ARA-Mat vector and the capsid protein dimer were digested with Nco I and EcoRI. The capsid protein dimer coding gene constructed in step 2 was placed downstream of the T7 promoter and the lac operator region, and its expression was controlled by IPTG induction. The SD sequence was selected from the strong ribosome binding site (AGGAGG), which is located 13 to 8 positions upstream of the translation start codon of the capsid protein dimer coding sequence, with a 7 bp spacer. The spacer sequence is AATAATA. The pCDFDuet-1-ARA-Mat-CP2 vector was constructed. Figure 5 Simultaneously, the coding sequence for the wild-type capsid protein monomer was replaced with the coding sequence for the capsid protein dimer to construct the pCDFDuet-1-ARA-Mat-CP(W) vector as a control group.
[0087] The viral RNA coding region fragment and the MS2 RNA packaging recognition site sequence were placed downstream of another T7 promoter and lac operator region, and their expression was controlled by IPTG induction. The SD sequence was selected from a strong ribosome binding site (AGGAGG), and the SD sequence was separated from the viral RNA coding sequence by a 7 bp start codon (AATAATA).
[0088] In this embodiment, the coding sequence of the H1N1 influenza virus M gene (Sequence ID: PP929893.1) and the coding sequence of the respiratory syncytial virus N gene (Sequence ID: AF013255.1) were used as internal references for positive results in the two viral nucleic acid tests. Figure 6 , Figure 7 Both fragments contain the MS2 capsid protein packaging signal sequence (pac), the sequence of which is shown in SEQ ID NO.5. Vectors were constructed to prepare positive internal reference MS2 pseudovirus particles for the above-mentioned viral nucleic acid detection.
[0089] Specifically: The coding sequence of the H1N1 influenza virus M gene was artificially synthesized. From the 5′ end to the 3′ end, this sequence consists of the NdeI restriction site sequence (CATATG), the H1N1 influenza virus M gene, the packaging site sequence, and the AvrII restriction site sequence (CCTAGG). Then, the pCDFDuet-1-ARA-Mat-CP2 plasmid and the target gene were digested with NdeI and AvrII, respectively. After the target fragment was recovered, it was ligated using T4 DNA ligase to construct the pCDFDuet-1-ARA-Mat-CP2-InfluenzaA M vector. Figure 6 ).
[0090] The coding sequence of the respiratory syncytial virus (RSV) N gene was artificially synthesized. From the 5′ to the 3′ end, this sequence contains the NdeI restriction site sequence (CATATG), the RSV N gene, the packaging site sequence, and the AvrII restriction site sequence (CCTAGG). Then, the pCDFDuet-1-ARA-Mat-CP2 plasmid and the target gene were digested with NdeI and AvrII, respectively. After the target fragment was recovered, it was ligated using T4 DNA ligase to construct the pCDFDuet-1-ARA-Mat-CP2-RSV N vector. Figure 7 ).
[0091] Meanwhile, the pCDFDuet-1-ARA-Mat-CP(W)-InfluenzaAM / RSVN vector was constructed as a control group, relying on the natural assembly ability of the capsid protein to form a dimer and thus complete the assembly of the virus-like organism.
[0092] 3.2 Plasmid Transformation of Host Bacteria Take one tube containing 50-100 μL of BL21(DE3) competent cells from -80℃ and immediately place it on ice. After complete thawing (about 3-5 min), gently tap the tube wall to mix. Add 1-5 μL of the plasmid DNA prepared in step 3.1 to the competent cells and gently tap to mix. Let it stand on ice for 25-30 min. Quickly place it in a 42℃ water bath for precise heat shock for 90 s. Immediately after heat shock, return it to the ice bath and let it stand for 2-3 min. Add 900 μL of antibiotic-free LB medium preheated to 37℃ to the tube and place it on a 37℃ shaker at 200-220 rpm for 45-60 min to recover. Take 100-200 μL of bacterial culture and spread it evenly on an LB agar plate containing chloramphenicol. Place the plate face up for 10-15 min to allow the liquid to be fully absorbed. Invert the plate and incubate at 37℃ for 12-16 h. Pick single colonies and sequence them to screen for target strains.
[0093] 3.3 Induced Expression To ensure the ratio of mature enzyme molecules to capsid protein molecules is controlled at 1:180, strain BL21 was cultured in LB medium. When the OD of the bacterial culture reached a certain level... 600 When the concentration of the enzyme is 0.6–0.8, L-arabinose is added to the culture medium to a final concentration of 0.02% (w / v), the temperature is lowered to 30°C, and the culture is carried out for 2–4 h to induce low expression of the mature enzyme gene. After the first stage of induction, IPTG is added to the culture medium to a final concentration of 0.5–1 mM, and the culture is carried out at 30°C and 220 rpm for another 4–6 h to induce high expression of the capsid protein. The capsid protein recognizes the transcriptional RNA packaging sequence, which is then assembled into virus-like particles that encapsulate the viral internal reference RNA. Through the above procedure, the appropriate ratio of mature enzyme to capsid protein molecules is ensured, packaging efficiency is improved, and thus the yield of viral particles is increased.
[0094] Then collect the fermentation broth, centrifuge at 5000 rpm to remove the supernatant; suspend the bacterial precipitate in double-distilled water, wash 3 times to remove the culture medium components; add 10 times the volume of double-distilled water, and sonicate to break up the bacterial cells; centrifuge at 5000 rpm to remove bacterial fragments and obtain the supernatant; this supernatant contains assembled and expressed MS2-like viruses, which is the initial extract.
[0095] 4. Assembly efficiency was determined using the ultracentrifugation (UC) method. The principle of ultracentrifugation for separating viral particles is to utilize the powerful centrifugal force. Based on the differences in the physical properties of viral particles, such as size, density, and shape, they settle at different speeds in the centrifugal field, thus achieving separation from other components. Viral particles are extremely small (typically 20-300 nanometers) and settle very slowly under natural gravity, and are easily affected by Brownian motion (diffusion). Ultracentrifuges can generate centrifugal forces of hundreds of thousands to millions of times the acceleration due to gravity (RCF can reach 100,000-150,000 × g), forcing viral particles to overcome diffusion effects and settle rapidly to the bottom of the centrifuge tube. The settling speed is directly proportional to the mass, density, and shape of the particle, and inversely proportional to the viscosity of the surrounding medium. The capsid proteins that assemble into viral particles settle to the bottom of the tube, forming a precipitate, while unassembled capsid proteins remain in the solution. This principle can be used to determine the assembly efficiency of viral particles.
[0096] The detection method is as follows: (1) Sample preparation: Take the initial extract purified by centrifugation in step 3, which contains assembled capsids, unassembled dimers / monomers and a small amount of impurities.
[0097] (2) The protein concentration was adjusted to 0.5~2 mg / mL (too low a concentration results in a weak signal, too high a concentration results in easy aggregation), and the volume was 100~500μL.
[0098] (3) Add ultracentrifuge tubes (such as Beckman SW55Ti adapter tubes) and balance the weight difference between tubes ≤0.1 mg.
[0099] (4) Centrifugation conditions: Temperature: 4℃ (to prevent protein denaturation); Rotation speed: 35,000~45,000 rpm (corresponding to centrifugal force of 100,000~150,000×g); Time: 2~4 h (to ensure complete settling of the assembled capsid, and to determine the saturation time through preliminary experiments).
[0100] (5) Sample separation and resuspension: Carefully aspirate all the supernatant (unassembled product), transfer it to a new tube, and record the volume. V 上清 Resuspend the precipitate (to assemble the capsid) in pre-cooled buffer (consistent with the sample buffer, such as 20 mM Tris-HCl, 150 mM NaCl, pH 7.4), with the resuspended volume equal to the supernatant volume. V 沉淀 = V 上清 This ensures volume consistency in concentration calculations.
[0101] (6) Protein concentration quantification: The concentration of the supernatant was determined using the BCA method. C 上清 ) and resuspension precipitate concentration ( C沉淀 ).
[0102] (7) Calculation formula: Assembly efficiency (%) = [ C 沉淀 × V 沉淀 ) / ( C 上清 × V 上清 + C 沉淀 × V 沉淀 )]×100%.
[0103] Calculations and analysis showed that the packaging efficiency of wild-type MS2 virus was 60.2%, while that of the capsid protein K62R mutant MS2 virus was 71.5%, an increase of 11.3 percentage points compared to the wild type. This suggests that site-directed mutagenesis significantly improves the assembly efficiency of the capsid protein.
[0104] 5. The Tm value of the MS2 shell was determined using fluorescent thermal drift technique. Detection principle: Protein Tm (thermal melting point) detection is a key technology for assessing protein thermal stability. By monitoring the conformational changes (such as denaturation) of proteins at different temperatures, the fluorescence signal increases with increasing temperature, as the hydrophobic groups in the protein molecule are exposed and their binding to the dye is enhanced. The melting point temperature (Tm) of the protein can be measured in real time.
[0105] The detection method for the fluorescent dye SYPRO Orange is as follows: 1) Prepare the TM reaction solution according to the following composition. To ensure the accuracy of the reaction solution preparation and reduce errors caused by dispensing, prepare the reaction solution by a slightly larger volume than the actual amount needed, and add the sample last.
[0106] TM reaction solution: DSF buffer 5 μL, virus particles 10 μL, water 5 μL.
[0107] 2) Perform the pre-reaction using a quantitative PCR instrument (CFX Duet quantitative PCR system) as follows: 25℃, 15 min; 3) Add 5 μL of SYPRO® Orange to the above system.
[0108] 4) Detection using the melting curve method: Temperature: 25℃ / 2 min, 0.05℃ / s (continuous signal acquisition), 95℃ / 2 min.
[0109] Calculations and analysis showed that the Tm value of the wild-type MS2 virus was 63℃, while the Tm value of the K62R mutant MS2 virus was 67.1℃, which was 4.1℃ higher than that of the wild type. This suggests that after the K62R mutation, the assembly of the capsid protein molecule is more robust and the outer shell is more stable. This makes the encapsulated RNA molecule less susceptible to degradation by external RNase, thus making it more stable.
[0110] Example 2 1. Site-directed mutagenesis of the amino acid sequence of capsid protein. This embodiment involves site-directed mutagenesis of amino acids at the β-sheet interface and dimer assembly interface of the capsid protein. Specifically, tryptophan (W) at position 83 is mutated to phenylalanine (F), and the amino acid sequence is shown in SEQ ID NO.7. Overlap PCR was used for site-directed mutagenesis, the method being the same as in Example 1, except that the site-directed mutagenesis primers R1 (downstream mutagenesis primer) and F2 (upstream mutagenesis primer) were used. The specific design is as follows: Downstream mutant primer R1: CAGGTAAGAACGGAACGCCGCAACCGG; Upstream mutant primer F2: CCGGTTGCGGCGTTCCGTTCTTACCTG; R1 (downstream mutant primer) and F2 (upstream mutant primer) are complementary mutant primer pairs, introducing a codon mutation of W→F (TGG→TTC). The sequences of primers F1 and R2 are the same as in Example 1. The four specific primers cover the full length of the coding region.
[0111] 2. Linker expression strategy for capsid protein dimers: In this embodiment, a W83F mutant capsid protein molecule and a wild-type capsid protein molecule are linked by a flexible linker (GGGGS)2, in the same way as in Example 1.
[0112] 3. The maturation enzyme and capsid protein are expressed in a synergistic manner, using the same method as in Example 1.
[0113] 4. Assembly efficiency was determined using ultracentrifugation (UC), the same method as in Example 1. Calculations and analysis showed that the packaging efficiency of the capsid protein W83F mutant MS2 virus-like organism was 69.6%, an increase of 9.4 percentage points compared to the wild type. This indicates that site-directed mutagenesis significantly improves the assembly efficiency of the capsid protein.
[0114] 5. The Tm value of the MS2 capsid was determined using fluorescence thermal drift technique, the same method as in Example 1. Calculations and analysis showed that the Tm value of the MS2 capsid protein W83F mutant was 66.2℃, 3.2℃ higher than the wild type. This suggests that after the W83F mutation, the capsid protein molecules are more firmly assembled, and the capsid is more stable.
[0115] Example 3 1. Site-directed mutagenesis of the amino acid sequence of capsid protein. This embodiment involves site-directed mutagenesis of the coding sequence of the capsid protein. Specifically, glutamic acid (E) at position 103 is mutated to aspartic acid (D), and the amino acid sequence is shown in SEQ ID NO. 8. Overlap PCR is used for site-directed mutagenesis, the method being the same as in Example 1, except that the site-directed mutagenesis primers R1 (downstream mutagenesis primer) and F2 (upstream mutagenesis primer) are different. The specific design is as follows: Downstream mutant primer R1: TTTAACGATCAGGTCGCAGTCAGAGTT; Upstream mutant primer F2: AACTCTGACTGCGACCTGATCGTTAAA; R1 (downstream mutant primer) and F2 (upstream mutant primer) are complementary mutant primer pairs, introducing an E→D codon mutation (GAA→GAC). The sequences of primers F1 and R2 are the same as in Example 1. The four specific primers cover the full length of the coding region.
[0116] 2. Linker expression strategy for capsid protein dimers: In this embodiment, a capsid protein E103D mutant molecule and a wild-type capsid protein molecule are linked by a flexible linker (GGGGS)2, in the same way as in Example 1.
[0117] 3. The maturation enzyme and capsid protein are expressed in a synergistic manner, using the same method as in Example 1.
[0118] 4. The assembly efficiency was determined using ultracentrifugation (UC), the same method as in Example 1. Calculations and analysis showed that the packaging efficiency of the capsid protein E103D mutant MS2 virus was 70.3%, an increase of 10.1 percentage points compared to the wild type. This indicates that site-directed mutagenesis significantly improves the assembly efficiency of the capsid protein.
[0119] 5. The Tm value of the MS2 capsid was determined using fluorescence thermal drift technique, the same method as in Example 1. Calculations and analysis showed that the Tm value of the MS2 capsid protein E103D mutant was 66.7℃, 3.7℃ higher than the wild type. This suggests that after the E103D mutation, the capsid protein molecules are more firmly assembled, and the capsid is more stable.
[0120] Example 4 1. Site-directed mutagenesis of the amino acid sequence of capsid protein. This embodiment involves site-directed mutagenesis of the coding sequence of the capsid protein. Specifically, the valine (V) at position 76 is mutated to histidine (H), and the amino acid sequence is shown in SEQ ID NO. 9. Overlap PCR was used for site-directed mutagenesis, the method being the same as in Example 1, except that the site-directed mutagenesis primers R1 (downstream mutagenesis primer) and F2 (upstream mutagenesis primer) were used. The specific design is as follows: Downstream mutant primer R1: AACCGGCAGTTCGTGACCACCAACGGT; Upstream mutant primer F2: ACCGTTGGTGGTCACGAACTGCCGGTT; R1 (downstream mutant primer) and F2 (upstream mutant primer) are complementary mutant primer pairs, introducing a V→H codon mutation (GTT→CAC). The sequences of primers F1 and R2 are the same as in Example 1. The four specific primers cover the full length of the coding region.
[0121] 2. Linker expression strategy for capsid protein dimers: In this embodiment, a V76H mutant molecule of capsid protein is linked to a wild-type capsid protein molecule through a flexible linker (GGGGS)2, in the same way as in Example 1.
[0122] 3. The maturation enzyme and capsid protein are expressed in a synergistic manner, using the same method as in Example 1.
[0123] 4. Assembly efficiency was determined using ultracentrifugation (UC), following the same method as in Example 1. Calculations and analysis showed that the packaging efficiency of the capsid protein V76H mutant MS2 virus-like organism was 66.3%, an increase of 6.1 percentage points compared to the wild type. This indicates that site-directed mutagenesis significantly improves the assembly efficiency of the capsid protein.
[0124] 5. The Tm value of the MS2 capsid was determined using fluorescence thermal drift technique, the same method as in Example 1. Calculations and analysis showed that the Tm value of the V76H mutant MS2 viroid was 66.1℃, 3.1℃ higher than the wild type. This suggests that after the V76H mutation, the capsid protein molecules are more firmly assembled, and the capsid is more stable.
[0125] Example 5 1. Site-directed mutagenesis of the amino acid sequence of capsid protein. MS2 capsid protein dimers exist in two structural isomers, with the core difference being the conformation and symmetry of the FG ring. The inactive dimer is called the CC type, and the active dimer is called the AB type. The key difference between the two lies in the conformation of Pro (P79) at position 79. In the CC type, P79 is in the trans conformation, and the FG ring is in an "outward extension" conformation. The dimer is symmetrical and has no assembly activity. In the AB type, P79 is in the cis conformation, and the FG ring undergoes approximately 180° flipping, resulting in an "inward folding" conformation that exposes the active site necessary for assembly.
[0126] This embodiment targets the FG ring of the capsid protein and performs site-directed mutagenesis. Specifically, proline (Pro) at position 79 is mutated to alanine (A), with the amino acid sequence shown in SEQ ID NO. 10. Overlap PCR is used for site-directed mutagenesis, the method being the same as in Example 1, except that the site-directed mutagenesis primers R1 (downstream mutagenesis primer) and F2 (upstream mutagenesis primer) are different. The specific design is as follows: Downstream mutant primer R1: CCACGCCGCAACCGCCAGTTCAACACC; Upstream mutant primer F2: GGTGTTGAACTGGCGGTTGCGGCGTGG; R1 (downstream mutant primer) and F2 (upstream mutant primer) are complementary mutant primer pairs, introducing a P→A codon mutation (CCG→GCG). The sequences of primers F1 and R2 are the same as in Example 1. The four specific primers cover the full length of the coding region.
[0127] 2. Linker expression strategy for capsid protein dimers: In this embodiment, a capsid protein P79A mutant molecule and a wild-type capsid protein molecule are linked by a flexible linker (GGGGS)2, in the same way as in Example 1.
[0128] 3. The maturation enzyme and capsid protein are expressed in a synergistic manner, using the same method as in Example 1.
[0129] 4. Assembly efficiency was determined using ultracentrifugation (UC), the same method as in Example 1. Calculations and analysis showed that the packaging efficiency of the capsid protein P79A mutant MS2 virus was 67.9%, an increase of 7.7 percentage points compared to the wild type. This indicates that site-directed mutagenesis significantly improves the assembly efficiency of the capsid protein.
[0130] 5. The Tm value of the MS2 capsid was determined using fluorescence thermal drift technique, the same method as in Example 1. Calculations and analysis showed that the Tm value of the MS2 capsid protein P79A mutant was 66.4℃, 3.4℃ higher than the wild type. This suggests that after the P79A mutation, the capsid protein molecules are more firmly assembled, and the capsid is more stable.
[0131] Example 6 1. Site-directed mutagenesis of the amino acid sequence of capsid protein. This embodiment involves site-directed mutagenesis of the capsid protein, specifically: the serine (S) at position 85 is mutated to threonine (T), with the amino acid sequence shown in SEQ ID NO. 11. Overlap PCR was used for site-directed mutagenesis, the method being the same as in Example 1, except that the site-directed mutagenesis primers R1 (downstream mutagenesis primer) and F2 (upstream mutagenesis primer) were used. The specific design is as follows: Downstream mutant primer R1: CATGTTCAGGTAGGTACGCCACGCCGC; Upstream mutant primer F2: GCGGCGTGGCGTACCTACCTGAACATG; R1 (downstream mutant primer) and F2 (upstream mutant primer) are complementary mutant primer pairs, introducing an S→T codon mutation (TCT→ACC). The sequences of primers F1 and R2 are the same as in Example 1. The four specific primers cover the full length of the coding region.
[0132] 2. Linker expression strategy for capsid protein dimers: In this embodiment, a capsid protein S85T mutant molecule and a wild-type capsid protein molecule are linked by a flexible linker (GGGGS)2, in the same way as in Example 1.
[0133] 3. The maturation enzyme and capsid protein are expressed in a synergistic manner, using the same method as in Example 1.
[0134] 4. Assembly efficiency was determined using ultracentrifugation (UC), the same method as in Example 1. Calculations and analysis showed that the packaging efficiency of the capsid protein S85T mutant MS2 virus-like organism was 69.4%, an increase of 9.2 percentage points compared to the wild type. This indicates that site-directed mutagenesis significantly improves the assembly efficiency of the capsid protein.
[0135] 5. The Tm value of the MS2 capsid was determined using fluorescence thermal drift technique, the same method as in Example 1. Calculations and analysis showed that the Tm value of the S85T mutant MS2 viroid was 67.0℃, 4.0℃ higher than the wild type. This suggests that after the S85T mutation, the capsid protein molecules are more firmly assembled, and the capsid is more stable.
[0136] Example 7 1. Site-directed mutagenesis of the amino acid sequence of capsid protein. This embodiment involves site-directed mutagenesis of the capsid protein, specifically: lysine (K) at position 44 is mutated to arginine (R), with the amino acid sequence shown in SEQ ID NO. 12. Overlap PCR was used for site-directed mutagenesis, the method being the same as in Example 1, except that the site-directed mutagenesis primers R1 (downstream mutagenesis primer) and F2 (upstream mutagenesis primer) were used. The specific design is as follows: Downstream mutant primer R1: AGAGCAGGTAACACGGTACGCCTGAGA; Upstream mutant primer F2: TCTCAGGCGTACCGTGTTACCTGCTCT; R1 (downstream mutant primer) and F2 (upstream mutant primer) are complementary mutant primer pairs, introducing a K→R codon mutation (AAA→CGT). The sequences of primers F1 and R2 are the same as in Example 1. The four specific primers cover the full length of the coding region.
[0137] 2. Linker expression strategy for capsid protein dimers: In this embodiment, a capsid protein K44R mutant molecule and a wild-type capsid protein molecule are linked by a flexible linker (GGGGS)2, in the same way as in Example 1.
[0138] 3. The maturation enzyme and capsid protein are expressed in a synergistic manner, using the same method as in Example 1.
[0139] 4. The assembly efficiency was determined using ultracentrifugation (UC), the same method as in Example 1. Calculations and analysis showed that the packaging efficiency of the capsid protein K44R mutant MS2 virus was 71.4%, an increase of 11.2 percentage points compared to the wild type. This indicates that site-directed mutagenesis significantly improves the assembly efficiency of the capsid protein.
[0140] 5. The Tm value of the MS2 capsid was determined using fluorescence thermal drift technique, the same method as in Example 1. Calculations and analysis showed that the Tm value of the MS2 capsid protein K44R mutant was 67.3℃, 4.3℃ higher than the wild type. This suggests that after the K44R mutation, the capsid protein molecules are more firmly assembled, and the capsid is more stable.
[0141] Example 8 1. Site-directed mutagenesis of the amino acid sequence of capsid protein. This embodiment involves site-directed mutagenesis of the capsid protein, specifically: methionine (M) at position 89 is mutated to leucine (L), with the amino acid sequence shown in SEQ ID NO. 13. Overlap PCR was used for site-directed mutagenesis, the method being the same as in Example 1, except that the site-directed mutagenesis primers R1 (downstream mutagenesis primer) and F2 (upstream mutagenesis primer) were used. The specific design is as follows: Downstream mutant primer R1: GATGGTCAGTTCCAGGTTCAGGTAAGA; Upstream mutant primer F2: TCTTACCTGAACCTGGAACTGACCATC; R1 (downstream mutant primer) and F2 (upstream mutant primer) are complementary mutant primer pairs, introducing a codon mutation from M to L (ATG to CTG). The sequences of primers F1 and R2 are the same as in Example 1. The four specific primers cover the full length of the coding region.
[0142] 2. Linker expression strategy for capsid protein dimers: In this embodiment, a capsid protein M89L mutant molecule and a wild-type capsid protein molecule are linked by a flexible linker (GGGGS)2, in the same way as in Example 1.
[0143] 3. The maturation enzyme and capsid protein are expressed in a synergistic manner, using the same method as in Example 1.
[0144] 4. Assembly efficiency was determined using ultracentrifugation (UC), the same method as in Example 1. Calculations and analysis showed that the packaging efficiency of the capsid protein M89L mutant MS2 virus-like organism was 65.5%, an increase of 5.3 percentage points compared to the wild type. This suggests that site-directed mutagenesis significantly improves the assembly efficiency of the capsid protein.
[0145] 5. The Tm value of the MS2 capsid was determined using fluorescence thermal drift technique, the same method as in Example 1. Calculations and analysis showed that the Tm value of the MS2 capsid protein M89L mutant was 65.0℃, 2.0℃ higher than the wild type. This suggests that after the M89L mutation, the capsid protein molecules are more firmly assembled, and the capsid is more stable.
[0146] Example 9 1. Site-directed mutagenesis of the amino acid sequence of capsid protein. This embodiment involves site-directed mutagenesis of the capsid protein, specifically by mutating glycine (G) at position 128 to alanine (A), as shown in SEQ ID NO. 14. Since this mutation site is located at the 3′ end, overlapping PCR with two pairs of primers is not required; only one PCR step is needed to complete the site-directed mutagenesis. Details are as follows: Design a pair of specific primers to introduce a G→A codon mutation (GGT→GCG) into the downstream mutant primer R1, as detailed below: Upstream outer primer F1: GCGTCTAACTTCACCCAGTTCGTTCTGG; Downstream mutant primer R1: GTAGATCGCAGAGTTCGCCGC.
[0147] The PCR amplification reaction system and reaction procedure are the same as in Example 1.
[0148] 2. Linker expression strategy for capsid protein dimers: In this embodiment, a capsid protein G128A mutant molecule and a wild-type capsid protein molecule are linked by a flexible linker (GGGGS)2, in the same way as in Example 1.
[0149] 3. The maturation enzyme and capsid protein are expressed in a synergistic manner, using the same method as in Example 1.
[0150] 4. Assembly efficiency was determined using ultracentrifugation (UC), the same method as in Example 1. Calculations and analysis showed that the packaging efficiency of the capsid protein G128A mutant MS2 virus was 66.1%, an increase of 5.9 percentage points compared to the wild type. This indicates that site-directed mutagenesis significantly improves the assembly efficiency of the capsid protein.
[0151] 5. The Tm value of the MS2 capsid was determined using fluorescence thermal drift technique, the same method as in Example 1. Calculations and analysis showed that the Tm value of the MS2 capsid protein G128A mutant was 66.4℃, 3.4℃ higher than the wild type. This suggests that after the G128A mutation, the capsid protein molecules are more firmly assembled, and the capsid is more stable.
[0152] Example 10 1. Site-directed mutagenesis of the amino acid sequence of capsid protein. This embodiment involves site-directed mutagenesis of the capsid protein, specifically: isoleucine (I) at position 129 is mutated to alanine (A), with the amino acid sequence shown in SEQ ID NO. 15. The method is the same as in Example 9, except that the downstream mutagenesis primer R1 is different, and its specific design is as follows: Downstream mutant primer R1: GTACGCACCAGAGTTCGCCGC.
[0153] A codon mutation of I→A (ATC→GCG) was introduced into the downstream mutation primer R1, and the F1 sequence was the same as in Example 9.
[0154] 2. Linker expression strategy for capsid protein dimers: In this embodiment, a capsid protein I129A mutant molecule and a wild-type capsid protein molecule are linked by a flexible linker (GGGGS)2, in the same way as in Example 1.
[0155] 3. The maturation enzyme and capsid protein are expressed in a synergistic manner, using the same method as in Example 1.
[0156] 4. Assembly efficiency was determined using ultracentrifugation (UC), the same method as in Example 1. Calculations and analysis showed that the packaging efficiency of the capsid protein I129A mutant MS2 virus was 70.1%, an increase of 9.9 percentage points compared to the wild type. This indicates that site-directed mutagenesis significantly improves the assembly efficiency of the capsid protein.
[0157] 5. The Tm value of the MS2 capsid was determined using fluorescence thermal drift technique, the same method as in Example 1. Calculations and analysis showed that the Tm value of the MS2 capsid protein I129A mutant was 68.9℃, 5.9℃ higher than the wild type. This suggests that after the I129A mutation, the capsid protein molecules are more firmly assembled, and the capsid is more stable.
[0158] Example 11 1. Site-directed mutagenesis of the amino acid sequence of capsid protein. This embodiment involves a combination of mutations targeting the capsid protein. Specifically, lysine (K) at position 44 is mutated to arginine (R), lysine (K) at position 62 is mutated to arginine (R), and proline (P) at position 79 is mutated to alanine (A), with the amino acid sequence shown in SEQ ID NO. 16. Site-directed mutagenesis was performed using overlap PCR, as detailed below: Using the full-length fragment of the K62R mutant obtained by overlapping PCR amplification in Example 1 as a template, mutations were performed at two sites: K44R and P79A. Six specific primers were designed, where R1 and F2 are complementary mutation primer pairs to introduce a codon mutation from K to R (AAA to CGT), R2 and F3 are complementary mutation primer pairs to introduce a codon mutation from P to A (CCG to GCG), F1 is the upstream primer outside the 5′ end of the gene, and R3 is the downstream primer outside the 3′ end of the gene. The primers cover the entire coding region, and the specific design is as follows: F1: GCGTCTAACTTCACCCAGTTCGTTCTGG; R1: AGAGCAGGTAACACGGTACGCCTGAGA; F2:TCTCAGGCGTACCGTGTTACCTGCTCT; R2: CCACGCCGCAACCGCCAGTTCAACAC; F3: GTGTTGAACTGGCGGTTGCGGCGTGG; R3: GTAGATACCAGAGTTCGCCGCGATCG.
[0159] The overlap extension PCR (SOE-PCR) procedure is as follows: First round of PCR: Amplification of three gene fragments containing overlapping mutation regions (fragment 1, fragment 2, and fragment 3). Using plasmids containing the coding strand of the K62R mutant as templates, PCR amplification was performed using the three pairs of primers described above, with each system consisting of 25 μL (which can be scaled up proportionally), for a total of three reaction systems. The PCR reaction system and amplification procedure were the same as in Example 1.
[0160] Product processing: Take 5 μL of the first round PCR product and perform agarose gel electrophoresis to verify the size of fragment 1, fragment 2, and fragment 3 (consistent with expectations). Then, purify the two fragments using a gel extraction kit to remove impurities such as primers and dNTPs, and obtain purified fragment 1, fragment 2, and fragment 3.
[0161] Second round PCR: overlap extension amplification of the complete mutant gene Using purified fragments 1, 2, and 3 as a mixed template, and adding only the outer primer F1+R3, the full-length sequence was obtained by annealing the overlapping region of the three fragments.
[0162] Reaction system (25 μL): 10×Buffer 2.5 μL, dNTP Mix (2.5 mM) 2.0 μL, outer primer F1 (10 μM) 1.0 μL, outer primer R3 (10 μM) 1.0 μL, fragment 1 + fragment 2 + fragment 3 (50 ng each) 2.0 μL, Taq enzyme 0.5 μL, sterile ddH2O 16.0 μL.
[0163] PCR amplification program: Pre-denaturation: 98℃ for 30 s; Denaturation-annealing-extension: 98℃ for 10 s, 60~65℃ for 15 s, 72℃ for 1~2 min, for a total of 30 cycles; Final extension: 72℃ for 5 min; Incubation: 4℃.
[0164] Product validation: Take 5 μL of the second round PCR product and perform agarose gel electrophoresis. If the band size is consistent with the full length of the target gene, it is considered a preliminary success.
[0165] 2. Linker expression strategy for capsid protein dimers In this embodiment, a capsid protein K44R, K62R, P79A combined mutant molecule was linked to a wild-type capsid protein molecule via a His Tag (6 histidine residues). Overlap PCR was used for the ligation.
[0166] 3. The maturation enzyme and capsid protein were co-expressed using the same method as in Example 1 to obtain MS2 pseudovirus particles K62R / P79A / K44R.
[0167] 4. The assembly efficiency was determined by ultracentrifugation (UC), using the same method as in Example 1.
[0168] The results are as follows Figure 8 As shown, the assembly efficiency of wild-type MS2 is 60.2%, and the assembly efficiency of K62R / P79A / K44R is 82.5%.
[0169] 5. The Tm value of the MS2 shell was determined using fluorescent thermal drift technology, in the same way as in Example 1.
[0170] As shown in Figure 9, the dissolution temperature of K62R / P79A / K44R increased from 62.2℃ to 67.7℃ compared to the wild type.
[0171] 6. Observation using transmission electron microscopy The results are as follows Figure 10 As shown, under transmission electron microscopy, MS2 pseudovirus particles exhibit a typical "hollow ring" appearance. This is due to the negative staining technique, which results in darker staining at the particle edges and lighter staining inside, revealing a complete capsid structure. MS2 pseudovirus particles are uniform in size, with a stable diameter of about 30 nm, exhibiting a regular spherical shape, a complete capsid, and a clear outline. In contrast, the background contains a large number of smaller, irregularly shaped amorphous particles, which may be unassembled capsid protein monomers, aggregates, or cell lysis fragments. These particles are typically less than 10 nm in size and lack clear boundaries and structure.
[0172] 7. Calculation of RNA purity in pseudovirus particles The mean Ct value of the qPCR reaction in the test group after reverse transcription of viral particles is A, and the mean Ct value of the qPCR reaction in the control group without reverse transcription is B. The sample RNA purity is calculated as follows: Sample RNA purity (%) = 100 × (1 - 2) A-B ).
[0173] The RNA purity in this embodiment was calculated to be 99.9926%.
[0174] 8. Stability of MS2 viral particle RNA The concentrations of each constructed pseudovirus plasmid were determined, and the corresponding plasmids were used as external standards to dilute the plasmid concentrations to 10⁻⁶. 6 copies / mL, 10 5 copies / mL, 10 4 copies / mL, 10 3 copies / mL, 10 2 copies / mL, 10 1 A standard curve was established using qPCR with copies / mL, and the nucleic acid copy number of the sample was calculated based on the Ct value.
[0175] Sample RNA copy number (copies / mL) = Sample nucleic acid copy number (copies / mL) × Sample RNA purity The pseudovirus samples were aliquoted into 100 μL tubes, with three tubes per group in parallel. After storage at 25°C for 5, 10, 25, 45, 75, and 90 days, RNA was extracted for RT-qPCR, and the Ct value was measured to calculate the copy number. A higher copy number indicates better stability.
[0176] The results are as follows Figure 11 As shown, the initial copy number of wild-type viroid particles is 0.81 × 10⁻⁶. 11 After being stored at 25°C for 90 days, the concentration of copies / μL decreased to 0.06 × 10⁻⁶. 11 The initial copy number and preservation stability of the modified group were significantly higher than those of the wild-type virus, with the initial copy number of MS2 pseudovirus particles K62R / P79A / K44R reaching 4.62 × 10⁻⁶ copies / μL. 11 The copy number remained at 3.15 × 10⁻⁶ copies / μL after 90 days. 11 copies / μL.
[0177] Example 12 1. Site-directed mutagenesis of the amino acid sequence of capsid protein. This embodiment involves a combination of mutations in the capsid protein, specifically: lysine (K) at position 44 is mutated to arginine (R), lysine (K) at position 62 is mutated to arginine (R), and proline (P) at position 79 is mutated to alanine (A). The method is the same as in Example 11.
[0178] 2. Linker expression strategy for capsid protein dimers In this embodiment, a capsid protein K44R, K62R, P79A combined mutant molecule was linked to a wild-type capsid protein molecule via a flexible linker (GGGGS)2, and the amino acid sequence is shown in SEQ ID NO.18. The method is the same as in Example 1.
[0179] 3. The maturation enzyme and capsid protein were co-expressed using the same method as in Example 1 to obtain MS2 pseudovirus particles WT-Linker-K62R / P79A / K44R.
[0180] 4. The assembly efficiency was determined by ultracentrifugation (UC), using the same method as in Example 1.
[0181] The results are as follows Figure 8 As shown, the assembly efficiency of wild-type capsid protein and K62R / P79A / K44R mutant dimers via linker is 92.3%.
[0182] 5. The Tm value of the MS2 shell was determined using fluorescent thermal drift technology, in the same way as in Example 1.
[0183] As shown in Figure 12, compared with the wild type, the dissolution temperature Tm of the MS2 pseudovirus particles WT-Linker-K62R / P79A / K44R increased from 62.8℃ to 73.7℃.
[0184] 6. Observation using transmission electron microscopy The results are as follows Figure 13 As shown, under transmission electron microscopy, the MS2 pseudovirus particles WT-Linker-K62R / P79A / K44R exhibit a typical "hollow ring" appearance, displaying a complete capsid structure. The MS2 pseudovirus particles are uniform in size, with a stable diameter of about 30 nm, and are regular spherical with a complete capsid and clear outline.
[0185] 7. Calculation of RNA purity in pseudovirus particles The method is the same as in Example 11. The RNA purity in this example is calculated to be 99.9921%.
[0186] 8. Stability of MS2 viral particle RNA The method is the same as in Example 11, and the results are as follows: Figure 11 As shown, the initial copy number of the MS2 pseudovirus particle WT-Linker-K62R / P79A / K44R is 5.87 × 10⁻⁶. 11 The copy number remained at 5.43 × 10⁻⁶ copies / μL after 90 days. 11 The number of copies / μL of the modified virus was significantly higher than that of the wild-type virus.
[0187] Example 13 1. Site-directed mutagenesis of the amino acid sequence of capsid protein. This embodiment involves a combination of mutations targeting the capsid protein: mutation of W at position 83 to F, E at position 103 to D, and I at position 129 to A, with the amino acid sequence shown in SEQ ID NO. 17. Site-directed mutagenesis was performed using overlap PCR, similar to Example 11, except for the template and PCR primers used, as detailed below: Using the full-length fragment of the E103D mutant obtained by overlapping PCR amplification in Example 3 as a template, mutations were performed at two sites: W83F and I129A. Four specific primers were designed, with R1 and F2 being complementary mutation primer pairs to introduce a codon mutation from W to F (TGG to TTC); and R2 to introduce a codon mutation from I to A (ATC to GCG). The primers covered the entire coding region, and the specific design is as follows: F1: GCGTCTAACTTCACCCAGTTCGTTCTGG; R1: CAGGTAAGAACGGAACGCCGCAACCGG; F2: CCGGTTGCGGCGTTCCGTTCTTACCTG; R2: GTACGCACCAGAGTTCGCCGC.
[0188] Note: Although this mutant is a 3-site mutation, since the full-length fragment of the E103D mutant obtained by overlapping PCR amplification in Example 3 is used as a template, it is not necessary to perform this site mutation; at the same time, since the I129A site is located at the 3′ end of the capsid protein coding sequence (the full length of this sequence is 130 amino acids), it is only necessary to design a mutation primer for the 3′ end.
[0189] 2. Linker expression strategy for capsid protein dimers In this embodiment, a combined mutant molecule of capsid protein W83F, E103D, I129A is linked to a wild-type capsid protein molecule via a His Tag (6 histidine residues), in the same way as in Example 11.
[0190] 3. The maturation enzyme and capsid protein were co-expressed using the same method as in Example 1, and the resulting MS2 pseudovirus particles were named W83F / E103D / I129A.
[0191] 4. The assembly efficiency was determined by ultracentrifugation (UC), using the same method as in Example 1.
[0192] The results are as follows Figure 8 As shown, the assembly efficiency of W83F / E103D / I129A is 74.7%.
[0193] 5. The Tm value of the MS2 shell was determined using fluorescent thermal drift technology, in the same way as in Example 1.
[0194] The results are as follows Figure 14 As shown, compared with the wild type, the dissolution temperature of W83F / E103D / I129A increased from 62.2℃ to 68.2℃.
[0195] 6. Observation using transmission electron microscopy The results are as follows Figure 15 As shown, under transmission electron microscopy, the MS2 pseudovirus particles W83F / E103D / I129A exhibit a typical "hollow ring" appearance, displaying a complete capsid structure. The MS2 pseudovirus particles are uniform in size, with a stable diameter of about 30 nm, and are regular spherical with a complete capsid and clear outline.
[0196] 7. Calculation of RNA purity in pseudovirus particles The method is the same as in Example 11. The RNA purity in this example was calculated to be 99.9963%.
[0197] 8. Stability of MS2 viral particle RNA The method is the same as in Example 11, and the results are as follows: Figure 11 As shown, the initial copy number of W83F / E103D / I129A reaches 3.79 × 10⁻⁶. 11The copy number remained at 2.35 × 10⁻⁶ copies / μL after 90 days. 11 copies / μL.
[0198] Example 14 1. Site-directed mutagenesis of the amino acid sequence of capsid protein. This embodiment involves a combination mutation of the capsid protein, specifically: the W at position 83 is mutated to F, the E at position 103 is mutated to D, and the I at position 129 is mutated to A, using the same method as in Example 13.
[0199] 2. Linker expression strategy for capsid protein dimers In this embodiment, a combined mutant molecule of capsid protein W83F, E103D, I129A was linked to a wild-type capsid protein molecule via a flexible linker (GGGGS)2. The amino acid sequence is shown in SEQ ID NO.19. The method is the same as in Example 1.
[0200] 3. The maturation enzyme and capsid protein were co-expressed using the same method as in Example 1, and the resulting MS2 pseudovirus particles were named WT-Linker-W83F / E103D / I129A.
[0201] 4. The assembly efficiency was determined by ultracentrifugation (UC), using the same method as in Example 1.
[0202] The results are as follows Figure 8 As shown, the assembly efficiency of WT-Linker-W83F / E103D / I129A is 90.4%.
[0203] 5. The Tm value of the MS2 shell was determined using fluorescent thermal drift technology, in the same way as in Example 1.
[0204] The results are as follows Figure 16 As shown, compared with the wild type, the melting temperature of WT-Linker-W83F / E103D / I129A increased from 63.2℃ to 71.4℃.
[0205] 6. Observation using transmission electron microscopy The results are as follows Figure 17 As shown, under transmission electron microscopy, the MS2 pseudovirus particles WT-Linker-W83F / E103D / I129A exhibit a typical "hollow ring" appearance, displaying a complete capsid structure. The MS2 pseudovirus particles are uniform in size, with a stable diameter of about 30 nm, and are regular spherical with a complete capsid and clear outline.
[0206] 7. Calculation of RNA purity in pseudovirus particles The method is the same as in Example 11. The RNA purity in this example was calculated to be 99.9968%.
[0207] 8. Stability of MS2 viral particle RNA The method is the same as in Example 11, and the results are as follows: Figure 11 As shown, the initial copy number of WT-Linker-W83F / E103D / I129A reaches 5.11 × 10⁻⁶. 11 The copy number remained at 4.61 × 10⁻⁶ copies / μL after 90 days. 11 copies / μL.
[0208] Example 15 In this embodiment, two wild-type capsid protein molecules are linked via a flexible linker (GGGGS)2, as in Example 1. The maturation enzyme and capsid protein are co-expressed using a single-plasmid dual-expression vector, as in Example 1. MS2 pseudovirus particles WT-Linker-WT are obtained.
[0209] The Tm value of the MS2 shell was determined using fluorescent thermal drift spectroscopy, following the same method as in Example 1. The results are as follows: Figure 18 As shown, the wild-type capsid protein is linked via the (GGGGS)2 linker, and its MS2 capsid dissolution temperature increases from 61.8℃ to 67.5℃. Assembly efficiency was determined using ultracentrifugation (UC), following the same method as in Example 1. The results are as follows: Figure 8 As shown, the assembly efficiency of two wild-type capsid protein molecules forming a dimer via the linker is 78.9%.
[0210] Transmission electron microscopy was performed, using the same method as in Example 11. The results are as follows: Figure 19 As shown, The method for determining the stability of MS2 virus-like particle RNA was the same as in Example 11, and the results are as follows: Figure 11 As shown, a virus-like particle formed by linking two wild-type capsid protein molecules via a -(GGGGS)n linker has an initial copy number of 1.17 × 10⁻⁶. 11 The copy number remained at 0.81 × 10⁻⁶ copies / μL after 90 days. 11 copies / μL. It is evident that flexible linker ligation significantly improves RNA stability.
[0211] In summary, the K62R, W83F, and E103D mutations increase the proportion of soluble capsid proteins, reduce monomer degradation or aggregation, and enhance dimer stability; the V76H, P79A, and S85T mutations increase the proportion of AB-type dimers with assembly activity, thereby overcoming the rate-limiting step in assembly; the K44R and M89L mutations increase the proportion of ordered dimer assembly and reduce random aggregation or mismatch assembly; and the G128A and I129A mutations stabilize the conformation of the assembled capsid, reduce the risk of depolymerization, and improve particle integrity.
[0212] Combining mutations at the above sites can synergistically enhance the activity of the FG region of capsid protein dimer stability, the efficiency of dimer orderly assembly, and the integrity of pseudovirus particles, thereby producing virus-like particles with good integrity, high packaging efficiency, strong RNA stability, and high purity.
[0213] The above description is merely a specific embodiment of the present invention, intended to enable those skilled in the art to understand the content of the present invention and implement it accordingly, and should not be construed as limiting the scope of protection of the present invention. All equivalent modifications or substitutions made based on the essence of the present invention should be covered within the scope of protection of the present invention.
Claims
1. A mutant of MS2 phage capsid protein, characterized in that, The mutant is a mutant obtained by amino acid mutation of the MS2 phage capsid protein with the amino acid sequence shown in SEQ ID NO.
1. The amino acid mutation is at least one of the following mutations: lysine at position 62 is mutated to arginine, tryptophan at position 83 is mutated to phenylalanine, glutamic acid at position 103 is mutated to aspartic acid, valine at position 76 is mutated to histidine, proline at position 79 is mutated to alanine, serine at position 85 is mutated to threonine, lysine at position 44 is mutated to arginine, methionine at position 89 is mutated to leucine, glycine at position 128 is mutated to alanine, and isoleucine at position 129 is mutated to alanine.
2. The MS2 phage capsid protein mutant as described in claim 1, characterized in that, The amino acid sequence of the mutant is shown in any one of SEQ ID NO.6-SEQ ID NO.
17.
3. The application of the MS2 phage capsid protein mutant as described in claim 1 or 2 in the preparation of MS2 virus-like particles, characterized in that, The MS2 virus-like particles are used as quality control samples for RNA virus nucleic acid detection.
4. The application as described in claim 3, characterized in that, The MS2 virus-like particle comprises the MS2 phage maturation enzyme protein, the MS2 phage capsid protein mutant as described in claim 1 or 2, and a virus-specific RNA fragment encapsulated within the particle.
5. A capsid protein dimer, characterized in that, The dimer is formed by linking the MS2 phage capsid protein mutant as described in claim 1 or 2 with the wild-type MS2 phage capsid protein with the amino acid sequence shown in SEQ ID NO. 1 via a linker.
6. The capsid protein dimer as described in claim 5, characterized in that, The sequence of the linkers is (GGGGS) n (GGGS) n Or (GGS) n , where n = 2~5.
7. A method for preparing MS2 virus-like particles, characterized in that, Includes the following steps: (1) The coding sequence A of the capsid protein dimer as described in claim 5 or 6, the coding sequence B of the mature enzyme protein, and the coding sequence C of the target virus-specific RNA fragment to be detected are cloned and recombined into an expression vector to construct a recombinant plasmid; the coding sequence C consists of an RNA coding region fragment and an MS2 phage packaging site sequence; (2) After the recombinant plasmid is transformed into the host cell, the expression of capsid protein dimer, mature enzyme protein and target virus-specific RNA fragment is induced and packaged to form MS2 virus-like particles.
8. The preparation method according to claim 7, characterized in that, In step (1), the upstream of coding sequence B in the recombinant plasmid is an arabinose operon sequence, and the SD sequence is a weak ribosome binding site sequence; coding sequences A and C are cloned downstream of different lactose operon regions, and the SD sequence is a strong ribosome binding site sequence.
9. The preparation method according to claim 8, characterized in that, In step (2), the conditions for inducing expression are: culturing the recombinant bacterial cells to OD200. 600 When the concentration is 0.6~0.8, add L-arabinose to a final concentration of 0.02% by volume, lower the temperature to 30℃, and incubate for 2~4 h; then add IPTG to a final concentration of 0.5~1 mM, maintain the conditions of 30℃ and 220 rpm, and continue to incubate for 4~6 h.
10. A virus detection kit, characterized in that, The kit includes a positive control, which is an MS2 virus-like particle prepared by the preparation method according to any one of claims 7-9.
Citation Information
Patent Citations
CN103571865A
CN114921485A
CN117304276A