A method for quickly reconstituting an l-alanine high-yield strain

Abstract

The application discloses a kind of modified bacteria for producing L-alanine, compared with wild type bacteria, the genome is integrated with pyruvate dehydrogenase alaD coding gene of bacillus stearothermophilus origin and the coding gene of mutant alaE (A48S / A149D) of alanine export protein alaE, and the expression of gene ldhA, mgsA, pflB, adhE, ackA and frdB in chassis bacterial genome is interrupted.The application also discloses a kind of method for quickly constructing recombinant escherichia coli for producing L-alanine, the method is suitable for multiple escherichia coli subspecies including MG1655, BL21 and ATCC8739, has universality and popularization and application value.

Description

Technical Field

[0001] This invention belongs to the field of metabolic engineering technology and relates to a method for rapidly reconstructing high-yield L-alanine strains. Background Technology

[0002] L-alanine is one of the smallest chiral compounds and is widely used in industries such as food, pharmaceuticals, and personal care. Recently, L-alanine has been discovered to be used in the production of methylglycinediacetic acid (MGDA), a novel, environmentally friendly, and biodegradable chelating agent that is showing great potential in various fields, including detergents and cleaning products. Currently, the global annual demand for L-alanine is over 5,000 tons.

[0003] The main production method for L-alanine is enzymatic conversion, which starts with L-aspartic acid and catalyzes the process using microorganisms containing L-aspartic acid-β-decarboxylase to obtain L-alanine. This method is relatively efficient, with a conversion rate of over 90%. However, since L-aspartic acid is mainly obtained from petroleum cracking, it requires sophisticated equipment and causes environmental pollution. Compared to enzymatic conversion, microbial fermentation uses inexpensive and renewable glucose as a raw material, saving costs. Furthermore, the fermentation process is simpler and more environmentally friendly, making it more suitable for large-scale industrial production. With the continuous development of synthetic biology technology, the discovery of high-yield targets in microorganisms provides a technological foundation and important pathway for constructing high-yield amino acids such as L-alanine.

[0004] The mainstream method for constructing traditional L-alanine reconstructed strains combines rational construction with anaerobic domestication. However, this can lead to strains with complex and uncontrollable genetic backgrounds. Therefore, to date, no de novo engineered E. coli strain with a clear genetic background for producing L-alanine has been reported. Summary of the Invention

[0005] In their research on L-alanine production by *E. coli* fermentation, the inventors decided to develop a rapid reconstruction method for high-yield L-alanine strains. This reconstruction method is based on two previous findings from their laboratory. One finding was that genome sequencing of anaerobic domesticated *E. coli* strains revealed that a double mutation of the A48S / A149D gene encoding the alanine export protein, alaE, significantly increased the L-alanine yield of the reconstructed *E. coli* strains. The other finding was that the alanine dehydrogenase encoded by the alaD gene is a key rate-limiting enzyme in the L-alanine synthesis pathway, but its optimal integration copy number is still unclear, and the integration operation is cumbersome and time-consuming. Utilizing the MUCICAT high-efficiency gene editing tool (Multi-copy chromosomal integration by CRISPR-associated transposase, a bacterial chromosomal multi-copy integration technology based on CRISPR-associated transposases CASTs), the target gene can be simultaneously integrated at multiple target sites in different *E. coli* chassis, greatly saving construction time and reducing workload, enabling rapid construction of multi-chassis strains. Based on this new discovery, this invention provides the following technical solution.

[0006] A first aspect of the present invention provides a modified bacterium that produces L-alanine, wherein the genome of the modified bacterium integrates a heterologous pyruvate dehydrogenase (alaD) encoding gene, compared to unmodified wild-type bacteria.

[0007] Preferably, the bacteria are Corynebacterium, more preferably Escherichia coli, and even more preferably Escherichia coli ATCC8739, Escherichia coli BL21 or Escherichia coli MG1655.

[0008] In one embodiment, the pyruvate dehydrogenase is a pyruvate dehydrogenase derived from *Geobacillus stearothermophilus* or a mutant with enhanced enzyme activity. Preferably, the pyruvate dehydrogenase is alaD, version 2007, GeneBank number: EF154460.1. More preferably, the coding gene is a polynucleotide with a nucleotide sequence as shown in SEQ ID NO: 2, or the coding gene is a polynucleotide with a nucleotide sequence having 70% or more, preferably 80% or more, preferably 85% or more, preferably 90% or more, preferably 95% or more homology to SEQ ID NO: 2.

[0009] The modified bacterial genome integrates one or more copies, preferably 3-11 copies, and more preferably five or more copies of the alaD coding gene derived from Geobacillus stearothermophilus.

[0010] Furthermore, the genome of the modified bacteria also integrates the alaE mutant encoding gene, which has enhanced function compared to the wild-type alanine efflux protein alaE.

[0011] In one embodiment, the wild-type alanine efflux protein alaE is the alaE version with GeneBank number AAC75717.1 from 2025 for Escherichia coli MG1655; the alaE version with GeneBank number QNG33491.1 from 2020 for Escherichia coli BL21; and the alaE version with GeneBank number UZF39531.1 from 2022 for Escherichia coli ATCC8739. Preferably, the mutant is alaE(A48S / A149D). Accordingly, the gene encoding the mutant alaE(A48S / A149D) is a polynucleotide with a nucleotide sequence as shown in SEQ ID NO: 1, or the gene encoding the mutant alaE(A48S / A149D) is a polynucleotide with a nucleotide sequence having 70% or more, preferably 80% or more, preferably 85% or more, preferably 90% or more, preferably 95% or more homology to SEQ ID NO: 1.

[0012] Furthermore, in the genome of the modified bacteria described above, any one, two, three, four, five, or six genes selected from the following are downregulated, inactivated, weakened in function, or knocked out:

[0013] ldhA (MG1655 in 2025 GeneBank version: AAC74462.1; BL21 in 2020 GeneBank version: QNG32383.1; ATCC8739 in 2022 GeneBank version: UZF39994.1).

[0014] mgsA (MG1655 in GeneBank version AAC74049.2 in 2025; BL21 in GeneBank version QNG31997.1 in 2020; ATCC8739 in GeneBank version UZF41072.1 in 2022).

[0015] pflB (MG1655 in 2025 GeneBank version: AAC73989.1; BL21 in 2020 GeneBank version: QNG31937.1; ATCC8739 in 2022 GeneBank version: UZF39092.1),

[0016] adhE (MG1655 in 2025 GeneBank version: AAC74323.1; BL21 in 2020 GeneBank version: QNG32244.1; ATCC8739 in 2021 GeneBank version: QRM73733.1).

[0017] ackA (MG1655, GeneBank version AAC75356.1, 2025; BL21, GeneBank version QNG33187.1, 2020; ATCC8739, GeneBank version UZF39846.1, 2022), and

[0018] frdB (MG1655 in 2025 GeneBank version: AAC77113.1; BL21 in 2020 GeneBank version: QNG34975.1; ATCC8739 in 2022 GeneBank version: UZF42248.1).

[0019] Preferably, the modified bacteria, i.e. recombinant Escherichia coli, do not substantially alter the original biological characteristics of the wild-type strain / original strain, including cell morphology and habits, growth cycle, proliferation rate, fermentation density, and other original features.

[0020] A second aspect of the present invention provides a method for constructing the modified bacteria, namely L-alanine-producing bacteria, as described above, comprising the following steps:

[0021] (1) Using Escherichia coli as the substrate bacteria, downregulate, inactivate, weaken, or knock out any one, two, three, four, five, or six of the following genes in its genome:

[0022] ldhA (MG1655 in 2025 GeneBank version: AAC74462.1; BL21 in 2020 GeneBank version: QNG32383.1; ATCC8739 in 2022 GeneBank version: UZF39994.1).

[0023] mgsA (MG1655 in GeneBank version AAC74049.2 in 2025; BL21 in GeneBank version QNG31997.1 in 2020; ATCC8739 in GeneBank version UZF41072.1 in 2022).

[0024] pflB (MG1655 in 2025 GeneBank version: AAC73989.1; BL21 in 2020 GeneBank version: QNG31937.1; ATCC8739 in 2022 GeneBank version: UZF39092.1),

[0025] adhE (MG1655 in 2025 GeneBank version: AAC74323.1; BL21 in 2020 GeneBank version: QNG32244.1; ATCC8739 in 2021 GeneBank version: QRM73733.1).

[0026] ackA (MG1655, GeneBank version AAC75356.1, 2025; BL21, GeneBank version QNG33187.1, 2020; ATCC8739, GeneBank version UZF39846.1, 2022), and

[0027] frdB (MG1655, GeneBank version AAC77113.1, 2025; BL21, GeneBank version QNG34975.1, 2020; ATCC8739, GeneBank version UZF42248.1, 2022); and

[0028] (2) Cause the strain to overexpress the following genes:

[0029] The coding gene of the mutant alaE (A48S / A149D) of the alanine efflux protein alaE (MG1655, GeneBank version AAC75717.1, 2025; BL21, GeneBank version QNG33491.1, 2020; ATCC8739, GeneBank version UZF39531.1, 2022), preferably with the nucleotide sequence shown in SEQ ID NO: 1.

[0030] The L-alanine-producing bacterium was obtained by selecting for resistance and verifying the nucleotide sequence of the pyruvate dehydrogenase alaD (GeneBank version EF154460.1 in 2007) from *Geobacillus stearothermophilus*, preferably with one or more copies, preferably 3-11 copies, and more preferably 5 or more copies, with the nucleotide sequence of the encoded gene as shown in SEQ ID NO: 2.

[0031] Optionally, the Escherichia coli mentioned in step (1) above is Escherichia coli MG1655, Escherichia coli BL21 or Escherichia coli ATCC8739, preferably Escherichia coli ATCC8739.

[0032] In one embodiment, the above method includes the following steps:

[0033] A. Using Escherichia coli as the substrate bacteria, the expression, inactivation, weakening, or knockout of the ldhA gene in the genome was downregulated; the mutant alaE(A48S / A149D) gene was integrated into the genome, and strain A was obtained through resistance screening and genotype verification.

[0034] B. The expression, inactivation, weakening or knockout of genes mgsA, pflB, adhE, ackA and frdB in the genome of strain A were downregulated, and strain B was obtained through resistance screening and genotype verification.

[0035] C. Integrate one or more copies, preferably 3-11 copies, and more preferably 5 or more copies of the gene alaD from Bacillus stearothermophilus into the genome of strain B, and obtain an L-alanine-producing strain through resistance screening and genotype verification.

[0036] The L-alanine-producing bacteria constructed by AC according to the above steps have good genetic stability and basically do not change the original biological characteristics of the wild-type strain / original strain, including cell morphology and habits, growth cycle, proliferation rate, fermentation density and other original features.

[0037] Optionally, the expression downregulation, inactivation, functional attenuation, or knockout of the above genes ldhA, mgsA, pflB, adhE, ackA, and frdB are implemented in the following ways:

[0038] (1) Knock out the ldhA, mgsA, pflB, adhE, ackA and frdB genes in the chromosome of the starting strain;

[0039] (2) Downregulate or interfere with the expression of ldhA, mgsA, pflB, adhE, ackA and frdB genes in the chromosome of the strain;

[0040] (3) Replace the ldhA, mgsA, pflB, adhE, ackA and frdB gene mutants in the chromosome of the starting strain with the gene mutants whose coding functions are lost or downregulated.

[0041] Furthermore, the above method (2) can be selected from the following group:

[0042] (2-1) Mutations in the promoter and / or coding regions of the ldhA, mgsA, pflB, adhE, ackA and frdB genes resulted in downregulation of the expression levels of the ldhA, mgsA, pflB, adhE, ackA and frdB genes.

[0043] (2-2) Mutations in the upstream regulatory factors of the ldhA, mgsA, pflB, adhE, ackA, and frdB genes lead to downregulation of the expression levels of these genes; or

[0044] (2-3) The interaction proteins of the ldhA, mgsA, pflB, adhE, ackA and frdB genes were introduced into wild-type strains to alter the function of the ldhA, mgsA, pflB, adhE, ackA and frdB genes.

[0045] (2-4) Silencing of the ldhA, mgsA, pflB, adhE, ackA and frdB genes by using siRNA or dsRNA through RNAi technology.

[0046] Optionally, the mutation in the coding region described in the above method (2-1) is a frameshift mutation, which leads to the inactivation or loss of function of the ldhA, mgsA, pflB, adhE, ackA and frdB genes.

[0047] The above methods (1), (2) and / or (3) are implemented through gene editing technology, antisense nucleic acid, and transcriptional regulation.

[0048] In one embodiment, the gene editing technology for gene knockout described above may be selected from the group consisting of: homologous double crossover, Red homologous recombination, TALEN system, CRISPR-Cas9 system, CRISPR-Cpf1 system, CRISPR-Cas12 system, MuGENT (multiplex genome editing by natural transformation), CRISPRi, RAD system, with CRISPR-Cas9 gene editing system being preferred.

[0049] In the above method, the strain overexpresses the genes alaE and alaD by integrating them into the strain genome. The integration method is selected from gene editing technology or positive transformants obtained by transforming the alaE / alaD gene overexpression plasmid.

[0050] Optionally, the gene editing technologies used for gene integration described above may be selected from the group consisting of: homologous double crossover, Red homologous recombination, TALEN system, CRISPR-Cpf1 system, CRISPR-Cas12a system, MuGENT, MUCICAT, with MUCICAT being preferred.

[0051] The plasmid transformations described above were selected from traditional electrochemical transformation, chemical transformation, and thermal shock methods.

[0052] A third aspect of the invention provides the use of the above-described modified bacteria, namely recombinant Escherichia coli, in the fermentation production of L-alanine.

[0053] As an application, the above-mentioned recombinant Escherichia coli is cultured in a culture medium under fermentation conditions, and L-alanine is extracted from the fermentation broth and / or bacterial cells.

[0054] In one embodiment, the carbon source used in the fermentation includes glucose.

[0055] During fermentation, the pH should be controlled between 6 and 8, with a preferred pH of around 7.0.

[0056] This invention develops a method for rapidly constructing high-yielding L-alanine strains with a clear genetic background, comprising the following steps: using *E. coli* as the substrate bacteria, interrupting the ldhA gene in the genome, ectopically integrating the alaE mutant gene alaE (A48S / A149D), then interrupting mgsA, pflB, adhE, ackA, and frdB, followed by integrating 5 copies of the alaD gene from *Bacillus stearothermophilus*, ultimately obtaining a reconstructed *E. coli* engineered strain with high L-alanine production. This method can rapidly construct high-yielding L-alanine strains in substrate bacteria such as MG1655, BL21, and ATCC8739, and has certain universality, providing a new genetic engineering strategy for creating high-yielding L-alanine-producing *E. coli* engineered strains. Attached Figure Description

[0057] Figure 1 The diagram shows a schematic of the L-alanine biosynthetic metabolic pathway in recombinant Escherichia coli constructed according to the present invention. Detailed Implementation

[0058] This invention develops a rapid reconstruction scheme for L-alanine-producing bacteria applicable to multiple Escherichia coli subspecies, including MG1655, BL21, and ATCC8739. This involves the disruption of expression of six endogenous genes from the wild-type strain: ldhA, mgsA, pflB, adhE, ackA, and frdB; ectopic integration of an A48S / A149D mutant of the endogenous gene alaE; and multiple copy integration of the exogenous gene alaD.

[0059] The preferred method for multi-copy integration of the exogenous gene alaD is to use the gene editing technology MUCICAT developed by our research group. This technology can achieve multi-copy integration at multiple sites on the bacterial chromosome in one go, which greatly improves the construction speed and efficiency of genetically engineered bacteria.

[0060] It should be understood that the genetic engineering strategy of the present invention is not only applicable to wild-type Escherichia coli such as MG1655, BL21 and ATCC8739 that produce little or no L-alanine, but also applicable to the modification of existing Escherichia coli-derived bacteria that produce L-alanine through fermentation, in order to increase the fermentation yield of existing L-alanine-producing bacteria and construct recombinant Escherichia coli engineered bacteria that produce high levels of L-alanine.

[0061] As used herein, the terms “(L-alanine fermentation yield) increase,” “enhancement,” or “enhancement” can mean an increase of at least 10% compared to a reference level (such as a base strain / originating strain), for example, an increase of at least about 20%, or at least about 30%, or at least about 40%, or at least about 50%, or at least about 60%, or at least about 70%, or at least about 80%, or at least about 90%, or up to and including 100%, or any increase between 10% and 100%.

[0062] In this article, the terms “(Escherichia coli) genetically engineered bacteria,” “engineered bacteria (strain),” “reconstructed bacteria,” and “recombinant bacteria (strain)” have the same meaning and can be used interchangeably.

[0063] Correspondingly, for ease of description, Escherichia coli MG1655, BL21, and ATCC8739 can be referred to as "wild-type" or "original strains".

[0064] The present invention will be further described in detail below with reference to specific embodiments. It should be understood that the following embodiments are for illustrative purposes only and are not intended to limit the scope of the invention.

[0065] Example

[0066] The embodiments in this article involve the addition amount, content and concentration of various substances. Unless otherwise specified, the percentage content mentioned refers to the mass percentage content.

[0067] In the embodiments described herein, unless otherwise specified, the temperature generally refers to room temperature (15-35°C).

[0068] For experimental methods where specific conditions are not specified in the examples, follow the standard conditions or the manufacturer's recommended conditions.

[0069] Materials and methods

[0070] In the following examples, all primers were synthesized by Sangon Biotech (Shanghai) Co., Ltd.; gene sequencing in the examples was performed by Beijing Qingke Biotechnology Co., Ltd.

[0071] The molecular biology experiments in the examples included plasmid construction, enzyme digestion, ligation, preparation of competent cells, transformation, and culture medium preparation, etc., mainly referring to "Molecular Cloning: A Laboratory Manual" (4th Edition), edited by M.R. Green and J. Sambrook (USA), translated by He Fuchu, Science Press, Beijing, 2017. Specific experimental conditions can be determined through simple experiments if necessary.

[0072] PCR amplification experiments should be performed according to the reaction conditions provided by the plasmid or DNA template supplier or the kit instructions. Adjustments can be made through simple experiments if necessary.

[0073] LB medium: 10 g / L tryptone, 5 g / L yeast extract, 10 g / L sodium chloride, pH 7.2 (solid medium with an additional 20 g / L agar powder).

[0074] The PCR identification method in this example is as follows: ddH2O is added to 25 μL, primer F (10mM) 0.5 μL, primer R (10mM) 0.5 μL, plasmid template 50 μg, and 2×Rapid Taq Master Mix high-fidelity enzyme 12.5 μL; the PCR program is as follows: 95℃, 3 min; 95℃, 15 s; Tm ℃, 10 s; 72℃, 30 s / kb; repeat 30 cycles; 72℃, 5 min; store the product at 4℃.

[0075] The high-fidelity fragment amplification method was as follows: ddH2O was added to 50 μL, primer F (10mM) 1 μL, primer R (10mM) 1 μL, plasmid template 100 μg, and 2×TOROBlue® Flash KOD DyeMix high-fidelity enzyme 25 μL. The PCR program was as follows: 98℃, 3 min; 98℃, 10 s; (Tm-5)℃, 5 s; 68℃, 10 s / kb; repeat for 40 cycles; 68℃, 5 min; store the product at 4℃.

[0076] The Gibson preparation method is as follows: 2×CE Mix V3 5μL; add 500μg of one or more fragments; add water to 10μL; react at 50℃ for 30min, then place at 4℃; add the reaction mixture to the Top10 of the drug, incubate on ice for 30min, heat shock at 42℃ for 90s, incubate on ice for 5min, finally add 900μL of antibiotic-free LB, then recover at 37℃ for 1h, and then take 100-500μL to spread on the corresponding antibiotic plate.

[0077] As antibiotics in the culture medium, the working concentrations are as follows: kanamycin 50 μg / mL, spectinomycin 100 μg / mL, apramycin 100 μg / mL; L-arabinose 10 mM; dehydrated tetracycline 200 ng / mL; rhamnose 10 mM; and bleomycin 100 μg / mL.

[0078] The strain plasmids used in the examples are shown in Table 1.

[0079] Table 1. Strains and plasmids used in this study

[0080] strain name describe source ATCC8739 Wild-type E.coli Crooks ATCC BL21 <![CDATA[F - dcm ompT hsdS(rB - mB - ) gal λ s ]]> Novagen MG1655 Wild-type E.coli K-12 strain CGSC TOP10 Used for constructing plasmids Shanghai Weidi Biotechnology plasmid pMDIAI Plasmid containing the AMP resistance gene addgene:#51655 pISFba1 pSC101 replicon, kanamycin resistance, ISFba1 enzyme, λ-Red recombinase, SacB system addgene:#226820 pISFba1reRNA-Apr Replace the target sequence with: AAGAGCCTTCAGAAGGAAGG addgene:#226822 pDonorGFP p15A replicon, LE / RE element, GFP gene, Cm resistance addgene:#175578 PtrpDonor-VerA p15A replicon, LE / RE element, terminator sequence, Cm resistance This study pUC57-Ter terminator gene, Amp resistance addgene:#170634 pDonor-GDH LE / RE element, Amp resistance addgene:#140629 pET24a-alaD pBR322 replicon, Kan resistance, alaD gene GenBank: EF154460 ptr-alaD p15A replicon, LE / RE element, alaD gene, Cm resistance This study pVch-alaD LE / RE components, alaD, Amp resistance This study PT1PtetQT5array ColA replicon, ptet, ptTns, ptCas, 5-target array, Kana resistance Universal synthesis pQCasTns(Ptr)-array8 ColA replicon, ptet, ptTns, ptCas, targeted 8-target array, Kana resistance addgene:#175580 VchpQCas8array ColA replicon, ptet, ptTns, ptCas, targeted 8-target array, Str resistance Universal synthesis

[0081] Some of the PCR primers used in the examples are listed in Table 2.

[0082] Table 2. Some PCR primers used in the examples

[0083] Primer name Sequence (5'-3') ldhA-F AAACAGTACGACAAGAAGTACCTGC ldhA-LHR-R ATACATAGTAAAGCCGGTCAGACCTTC Apr-ldhA-F AAGGTCTGACCGGCTTTACTATGTATgcatgacggcaagtggacg Apr-ldhA-R CACCGAGTTCCAGCGCCGCTGCACTTGttcccggcgatcctctgg ldhA-aE-RHR-F CAAGTGCAGCGGCGCTGGAA ldhA-aE-RHR-R GGTTTCGCCTTTTTCCAGATTGCTT ldhA-EF AAGGTCTGACCGGCTTTACTATGTATaccttttaacgccaaaaaaaaaag ldhA-ER CACCGAGTTCCAGCGCCGCTGCACTTGccgtggggaaaattatgtgtctatgtt ldhA-CK-F gcagcgtcaacggcacaagaataat ldhA-CK-R taccgtttacgctttccagcacaaa GFPOVPtRe-F CGGGAATTCATGGTCGAC GFPOVPtLE-R TGCATGTCGACCATGGAATTCCCGgtgagtcaaccatttaaccatttgg PtDonorOVP15A-F ggaagtgtaaggtggcatagtc PtDonorOVP15A-R tgcgtccggcgtagaggatccaccccaatgttgtttgaagtataagttgg alaE48S-F cgaacgtctttttattccagattggtatcgattccggtgaacatcttaatt alaE48S-R attaagatgttcaccggaatcgataccaatctggaataaaagactgttcg alaE149-F ccgttaccagcaggtaaaagactgacccttctttcgcgac alaE149-R gtcgcgaaaagaagggtcagtctttacctgctggtaacgg ackA(P5)-F2 gttacatagaagtggctggtg ackA(P5)-R2 actggttctgaactgcggtag adhE(P5)-F tggctgttactaatgtcgctg adhE(P5)-R cgcgaggatcaggttgatgtc pflB(P5)-F agttagccacagcctgggaag pflB(P5)-R cagagaagtgaactgtgccag frd(P5)-F tgcgtagccataccgttgctg frd(P5)-R cagcggaacgccgtggcttag mgsA(P5)-F actggctgacccacaaacgcg mgsA(P5)-R tcggggatcagaatatcgacc ptr-ldhA-F tattaaccaaatggttaaatggttgactcacatcaggtgttaggcagcatgac Pldh(ala)-R cttcatcactttttcctccttttcgacgttattgaaaccggcacag wingD-F ggaaaaaggaaaaagtgatgaagatcggcattccaaaag ptr-ter-R tctaactttaaaataataaggaaaaataaccggatatagttcctcctttcag dif8site1-R cggcataaactacagctggca dif8site1-F tatggggctgcatgtttgc dif8site2-R ttacataacgcgctggaaaaggc dif8site2-F cgaacgtcgccgtgagaaac dif8site3-R tacgcgctggtggatctct dif8site3-F gggtcgtgaagacgcgactga difsite4-R cgcggctatgaatccagtaa difsite4-F tctgaccaccttgcaggac difsite5-R tgcggttcgctaactttggt difsite5-F atcagcaaggtgttcagcaact difsite6-R acgtacttaaggtgcgtccg difsite6-F tctggaactggcaccagaacgta diffsite7-R caacctgtgtgcgttagcaagc Difsite7-F ttcatgcgcttacgcatcatga difsite8-R ctatcggaccgatgaagcacgc difsite8-F cacgggtaaagtggggtggtt

[0084] Note: The suffix "-F" in primer names indicates forward direction; "-R" indicates reverse direction.

[0085] Example 1: Construction of a high-yield L-alanine strain using ATCC8739

[0086] 1.1 Knockout of the ldhA gene with simultaneous ectopic integration of alaE (A48S / A149D)

[0087] 1.1.1 Using the genome of ATCC8739 strain (purchased from ATCC) as a template, PCR amplification was performed using ldhA-F / ldhA-LHR-R to obtain fragment 1, approximately 400 bp. PCR amplification was then performed using ldhA-aE-RHR-F / ldhA-aE-RHR-R to obtain fragment 2, approximately 440 bp. Using the pMDIAI (addgene:#51655) plasmid as a template, the Apr fragment was amplified using primers Apr-ldhA-F / Apr-ldhA-R and labeled as fragment 3. Using fragments 1, 2, and 3 as templates, they were overlapped using primers ldhA-F / ldhA-aE-RHR-R to obtain fragment 4 (up-Apr-down).

[0088] Using the ATCC8739 genome as a template, fragment 3 (approximately 850 kbp) was amplified using ldhA-EF / alaE48S-R, and fragment 4 (approximately 650 kbp) was amplified using alaE48S-F and ldhA-ER. Subsequently, using fragments 3 and 4 as templates, ldhA-EF and ldhA-ER were used for amplification, yielding fragment 5 (approximately 1.4 kbp). Using fragment 5 as a template, ldhA-EF and alaE149-R were used for amplification, yielding fragment 6 (approximately 1.1 kbp), and alaE149-F and ldhA-ER were used for amplification, yielding fragment 7 (approximately 300 kbp). Subsequently, using fragments 6 and 7 as templates, ldhA-EF and ldhA-ER were used for amplification, yielding fragment 8 (approximately 1.4 kbp). Finally, using fragments 1, 2, and 8 as templates, overlap PCR was performed using ldhA-F and ldhA-aE-RHR-R, yielding fragment 8 (approximately 2.2 kbp). The homologous fragment of bp's alaE (A48S / A149D);

[0089] 1.1.2 Electroporation of pISFba1 (addgene:#226820) plasmid into ATCC8739 competent cells, followed by 1 hour of recovery and plating on kanamycin plates to screen for successfully transfected ATCC8739 / pISFba1 cells.

[0090] 1.1.3 ATCC8739 / pISFba1 strain was picked and cultured overnight in kanamycin-resistant LB medium. Then, 1% was transferred to LB liquid medium containing 10 mM L-arabinose and kanamycin resistance. The culture was carried out at 37°C until the OD reached 0.5. The culture was washed twice with 10% glycerol, and the up-Apr-down fragment was electroporated. After recovery at 37°C for 1 h, the fragment was plated on kanamycin and apramycin plates.

[0091] 1.1.4 Use primers ldhA-CK-F and ldhA-CK-R to verify whether up-Apr-down integrates into the ldhA site. A length of 2.3 kbp is considered positive, and the negative control length is 1 kbp. The result is ATCC8739ΔldhA::Apr / pISFba1.

[0092] 1.1.5 ATCC8739ΔldhA::Apr / pISFba1 strain was picked and cultured overnight in kanamycin-resistant LB medium. Then, 1% was transferred to LB liquid medium containing 10 mM L-arabinose and kanamycin and cultured at 37°C until the OD reached 0.5. The culture was washed twice with 10% glycerol, and the alaE (A48S / A149D) fragment and pISFba1reRNA-Apr (addgene:#226822) plasmid were electroporated. After recovery at 37°C for 1 h, the plasmids were plated on kanamycin and spectinomycin plates.

[0093] 1.1.6 Use primers ldhA-CK-F and ldhA-CK-R to verify whether alaE (A48S / A149D) is ectopically integrated into the ldhA site. A length of 2.2 kbp is considered positive, and the negative control length is 1 kbp.

[0094] 1.1.7 Single clones that successfully integrated alaE (A48S / A149D) at the ldhA site were deplasmidized. The single clones were picked and induced overnight in LB liquid medium with kanamycin and 10 mM rhamnose. Then, 1% were transferred to LB antibiotic-free medium for overnight expansion. Finally, they were streaked onto SacB plates to deplasmidize.

[0095] 1.2 Five target sites competing for L-alanine synthesis

[0096] 1.2.1 Using pUC57-Ter (addgene:#170634) as a template, PCR amplification was performed using GFPOVPtRe-F and GFPOVPtLE-R to obtain a terminator fragment of approximately 600 bp; using pDonorGFP (addgene:#175578) as a template, PCR amplification was performed using PtDonorOVP15A-F and PtREOVGFP-R to obtain a p15ABack fragment of approximately 3.3 kbp;

[0097] 1.2.2 The terminator and p15ABack fragments were assembled using Gibson, and then heat-shocked and transformed into Top10 competent cells. After thawing for 1 hour, the cells were plated on chloramphenicol-resistant plates and cultured overnight at 37°C to obtain the PtrpDonor-VerA plasmid.

[0098] 1.2.3 Starting from ATCC8739(ΔldhA::alaE(A48S / A149D)), the PtrpDonor-VerA plasmid was electroporated, and after 1 hour of recovery, it was plated on chloramphenicol plates and incubated overnight.

[0099] 1.2.4 Competent cells were prepared from ATCC8739(ΔldhA::alaE(A48S / A149D)) / PtrpDonor-VerA, and the PT1PtetQT5array plasmid (synthesized by General Biotechnology (Anhui) Co., Ltd.) was electroporated. After being thawed at 37°C for 1 h, the plasmid was plated on a plate containing chloramphenicol and kanamycin and cultured overnight.

[0100] 1.2.5 After the single clones have grown, use a pipette tip to pick up 5-15 single clones, mix them in 100 μl of sterile LB liquid medium, and then spread them on chloramphenicol and kanamycin resistance plates with 100 ng / μl of dehydrated tetracycline as an inducer. Incubate overnight for low-concentration induction.

[0101] 1.2.6 After single clones have grown, bacterial cells are transferred from the plate to the colony and streaked onto chloramphenicol and kanamycin resistant plates supplemented with 1000 ng / μl tetracycline as an inducer. The plates are then incubated overnight for high-concentration induction.

[0102] 1.2.7 The isolated single clone strains were subjected to PCR verification of the insertion at five sites using ackA(P5)-F2 and ackA(P5)-R2, adhE(P5)-F and adhE(P5)-R, pflB(P5)-F and pflB(P5)-R, frd(P5)-F and frd(P5)-R, and mgsA(P5)-F and mgsA(P5)-R, respectively. The negative control length was 500 bp, and the positive control length was about 2 kbp. The strain ATCC8739 (ΔldhA::alaE(A48S / A149D),Δ5) was obtained.

[0103] 1.3 Integration of multi-copy alaD gene using PtrCAST

[0104] 1.3.1 Using the ATCC8739 genome as a template and ptr-ldhA-F / Pldh(ala)-R as primers, Pldh (approximately 800 bp) was amplified by PCR; using the pET24a-alaD plasmid (GenBank: EF154460) as a template and alaD-F / ptr-ter-R as primers, the alaD fragment was amplified by PCR; using Pldh and alaD fragments as templates and ptr-ldhA-F / ptr-ter-R as primers, the ldhA-alaD fragment (approximately 2.2 kb) was amplified by overlap PCR.

[0105] 1.3.2 Using pDonorGFP (addgene:#175578) as a template, the ptrBack fragment was amplified by PtrRE-R and PtrLE-F. The ldhA-alaD fragment and the ptrBack fragment were assembled by Gibson, and then heat-shocked and transformed into Top10 competent cells. After thawing for 1 hour, the cells were plated on chloramphenicol-resistant plates and cultured overnight to obtain the ptr-alaD plasmid.

[0106] 1.3.3 Starting from ATCC8739(ΔldhA::alaE(A48S / A149D), Δ5), the ptr-alaD plasmid was electroporated, and after recovery at 37℃ for 1 h, it was plated on chloramphenicol plates and incubated overnight.

[0107] 1.3.4 The monoclonal ATCC8739(ΔldhA::alaE(A48S / A149D),Δ5) / ptr-alaD was electroporated into the pQCasTns(Ptr)-array8 plasmid (addgene:#175580), recovered at 37℃ for 1 h, and then plated on a plate containing chloramphenicol and kanamycin, and cultured overnight.

[0108] 1.3.5 Pick 5-10 single clones and dilute them in sterile LB medium. Then take 150 μl and spread it on a plate containing chloramphenicol, kanamycin and 100 ng / μl of dehydrated tetracycline. Incubate overnight.

[0109] 1.3.6 Scrape colonies and streak them onto plates containing chloramphenicol, streptomycin, and 1000 ng / μl of dehydrated tetracycline. Incubate overnight.

[0110] 1.3.7 Take the isolated single clone strains and perform PCR verification of the insertion at 8 sites using dif8site1-F and dif8site1-R, dif8site2-F and dif8site2-R, dif8site3-F and dif8site3-R, dif8site4-F and dif8site4-R, dif8site5-F and dif8site5-R, dif8site6-F and dif8site6-R, dif8site7-F and dif8site7-R, and dif8site8-F and dif8site8-R, respectively. The negative control length is 500 bp, and the positive control length is approximately 3 kbp.

[0111] The strain ATCC8739 (ΔldhA::alaE(A48S / A149D), Δ5, alaD×1-3,5) was obtained, abbreviated as ATCC8739 reconstructed strain.

[0112] 1.4 Integration of multi-copy alaD gene using VchCAST

[0113] 1.4.1 Using the ATCC8739 genome as a template and ptr-ldhA-F / Pldh(ala)-R as primers, Pldh (approximately 800 bp) was amplified by PCR; using pET24a-alaD plasmid as a template and alaD-F / ptr-ter-R as primers, the alaD fragment was amplified by PCR; using Pldh and alaD fragments as templates and ptr-ldhA-F / ptr-ter-R as primers, the ldhA-alaD fragment (approximately 2.2 kb) was amplified by overlap PCR.

[0114] 1.4.2 Using pDonor-GDH (addgene:#140629) as a template, the pVchBack fragment was amplified by VchalaD-F and VchDonorLE-F. The ldhA-alaD fragment and the pVchBack fragment were assembled by Gibson. Then, the fragment was heat-shocked and transformed into Top10 competent cells. After thawing for 1 hour, the cells were plated on ampicillin-resistant plates and cultured overnight to obtain the pVch-alaD plasmid.

[0115] 1.4.3 Starting from ATCC8739(ΔldhA::alaE(A48S / A149D, Δ5, 3alaD), the pVch-alaD plasmid was electroporated, and after being recovered at 37℃ for 1 h, it was plated on ampicillin plates and incubated overnight.

[0116] 1.4.4 Transplant single clones, then electroporate the VchpQCas8array plasmid (synthesized by General Biotechnology (Anhui) Co., Ltd.), thaw at 37°C for 1 h, plate on ampicillin and streptomycin-containing plates, and incubate overnight;

[0117] 1.4.5 Pick 5-10 single clones and dilute them in sterile LB broth. Then take 150 μL and spread it on a plate containing ampicillin, streptomycin and 100 ng / μL of dehydrated tetracycline. Incubate overnight for low-concentration induction.

[0118] 1.4.6 Scrape colonies and streak them onto plates containing chloramphenicol, streptomycin, and 1000 ng / μl of dehydrated tetracycline. Incubate overnight for high-concentration induction.

[0119] 1.4.7 The isolated monoclonal strains were subjected to PCR verification of the insertion at 8 sites using Vchsite1-F and Vchsite1-R, Vchsite2-F and Vchsite2-R, Vchsite3-F and Vchsite3-R, Vchsite4-F and Vchsite4-R, Vchsite5-F and Vchsite5-R, Vchsite6-F and Vchsite6-R, Vchsite7-F and Vchsite7-R, and Vchsite8-F and Vchsite8-R, respectively. The negative control length was 500 bp, and the positive control length was approximately 3 kbp.

[0120] The strain ATCC8739(ΔldhA::alaE(A48S / A149D, Δ5, alaD×7, 8, 10, 11) was obtained, abbreviated as ATCC8739 reconstructed strain.

[0121] Example 2: Construction of a high-yield L-alanine strain using BL21

[0122] 2.1 Knockout of the ldhA gene with simultaneous ectopic integration of alaE (A48S / A149D)

[0123] 2.1.1 Using the BL21 strain genome (purchased from Novage) as a template, PCR amplification was performed using ldhA-F / ldhA-LHR-R to obtain fragment 1, approximately 400 bp. PCR amplification was then performed using ldhA-aE-RHR-F / ldhA-aE-RHR-R to obtain fragment 2, approximately 440 bp. Using the pMDIAI plasmid as a template, the Apr fragment was amplified using primers Apr-ldhA-F / Apr-ldhA-R and labeled as fragment 3. Using fragments 1, 2, and 3 as templates, they were overlapped using primers ldhA-F / ldhA-aE-RHR-R to obtain fragment 4 (up-Apr-down).

[0124] Using the BL21 strain genome as a template, fragment 3 (approximately 850 kbp) was amplified using ldhA-EF / alaE48S-R, and fragment 4 (approximately 650 kbp) was amplified using alaE48S-F and ldhA-ER. Subsequently, using fragments 3 and 4 as templates, ldhA-EF and ldhA-ER were used for amplification, yielding fragment 5 (approximately 1.4 kbp). Using fragment 5 as a template, ldhA-EF and alaE149-R were used for amplification, yielding fragment 6 (approximately 1.1 kbp), and alaE149-F and ldhA-ER were used for amplification, yielding fragment 7 (approximately 300 kbp). Subsequently, using fragments 6 and 7 as templates, ldhA-EF and ldhA-ER were used for amplification, yielding fragment 8 (approximately 1.4 kbp). Finally, using fragments 1, 2, and 8 as templates, overlap PCR was performed using ldhA-F and ldhA-aE-RHR-R, yielding fragment 8 (approximately 2.2 kbp). 2.1.2 Electroporation of pISFba1 plasmid into BL21 competent cells, followed by 1 hour of recovery and plating on kanamycin plates to screen for successfully transfected BL21 / pISFba1 cells.

[0125] 2.1.3 BL21 / pISFba1 strain was picked and cultured overnight in kanamycin-resistant LB medium. Then, 1% was transferred to LB liquid medium containing 10 mM L-arabinose and kanamycin resistance. The culture was incubated at 37°C until the OD reached 0.5. The culture was then washed twice with 10% glycerol, and the up-Apr-down fragment was electroporated. After recovery at 37°C for 1 hour, the fragment was plated on kanamycin and apramycin plates. 2.1.4 Primers ldhA-CK-F and ldhA-CK-R were used to verify whether the up-Apr-down fragment integrated into the ldhA site. A length of 2.3 kbp was considered positive, and the negative control length was 1 kbp, yielding BL21ΔldhA::Apr / pISFba1.

[0126] 2.1.5 BL21ΔldhA::Apr / pISFba1 strain was picked and cultured overnight in kanamycin-resistant LB medium. Then, 1% was transferred to LB liquid medium containing 10 mM L-arabinose and kanamycin and cultured at 37°C until the OD reached 0.5. The culture was washed twice with 10% glycerol. At the same time, the alaE (A48S / A149D) fragment and pISFba1 reRNA-Apr plasmid were electroporated. After recovery at 37°C for 1 h, the plasmids were plated on kanamycin and spectinomycin plates.

[0127] 2.1.6 Use primers ldhA-CK-F and ldhA-CK-R to verify whether alaE (A48S / A149D) is ectopically integrated into the ldhA site. A length of 2.2 kbp is considered positive, and the negative control length is 1 kbp.

[0128] 2.1.7 Single clones that successfully integrated alaE (A48S / A149D) at the ldhA site were deplasmidized. The single clones were picked and induced overnight in LB liquid medium with kanamycin and 10 mM rhamnose. Then, 1% were transferred to LB antibiotic-free medium for overnight expansion. Finally, they were streaked onto SacB plates to deplasmidize.

[0129] 2.2 Five Targets Competing to Disrupt L-Alanine Synthesis

[0130] 2.2.1 Using pUC57-Ter as a template, PCR amplification was performed using GFPOVPtRe-F and GFPOVPtLE-R to obtain a terminator fragment of approximately 600 bp; using pDonorGFP as a template, PCR amplification was performed using PtDonorOVP15A-F and PtREOVGFP-R to obtain a p15ABack fragment of approximately 3.3 kbp.

[0131] 2.2.2 The terminator and p15ABack fragments were assembled using Gibson, then transformed into Top10 competent cells. After 1 hour of recovery, the cells were plated on chloramphenicol-resistant plates and cultured overnight at 37°C to obtain the PtrpDonor-VerA plasmid.

[0132] 2.2.3 Starting from BL21(ΔldhA::alaE(A48S / A149D)), the PtrpDonor-VerA plasmid was electroporated, and after 1 hour of recovery, it was plated on chloramphenicol plates and incubated overnight.

[0133] 2.2.4 Competent cells were prepared from BL21(ΔldhA::alaE(A48S / A149D)) / PtrpDonor-VerA, electroporated with PT1PtetQT5array plasmid, and after recovery at 37℃ for 1 h, they were plated on a double antibiotic plate containing chloramphenicol and kanamycin and cultured overnight.

[0134] 2.2.5 After the single clones have grown, use a pipette tip to pick up 5-15 single clones, mix them in 100 μl of sterile LB liquid medium, and then spread them on chloramphenicol and kanamycin resistance plates with 100 ng / μl of dehydrated tetracycline as an inducer. Incubate overnight for low-concentration induction.

[0135] 2.2.6 After single clones have grown, bacterial cells are transferred from the plate to the colony and streaked onto chloramphenicol and kanamycin resistant plates supplemented with 1000 ng / μl adehydrotetracycline as an inducer. The plates are then incubated overnight for high-concentration induction.

[0136] 2.2.7 The isolated single-clonal strains were subjected to PCR verification of the insertion at five sites using ackA(P5)-F2 and ackA(P5)-R2, adhE(P5)-F and adhE(P5)-R, pflB(P5)-F and pflB(P5)-R, frd(P5)-F and frd(P5)-R, and mgsA(P5)-F and mgsA(P5)-R, respectively. The negative control length was 500 bp, and the positive control length was about 2 kbp. The strain BL21 (ΔldhA::alaE(A48S / A149D), Δ5) was obtained.

[0137] 2.3 Integration of multi-copy alaD gene using VchCAST

[0138] 2.3.1 Using the BL21 genome as a template and ptr-ldhA-F / Pldh(ala)-R as primers, Pldh (approximately 800 bp) was amplified by PCR; using pET24a-alaD plasmid as a template and alaD-F / ptr-ter-R as primers, the alaD fragment was amplified by PCR; using Pldh and alaD fragments as templates and ptr-ldhA-F / ptr-ter-R as primers, the ldhA-alaD fragment (approximately 2.2 kb) was amplified by overlap PCR.

[0139] 2.3.2 Using pDonor-GDH as a template, the pVchBack fragment was amplified by VchalaD-F and VchDonorLE-F. The ldhA-alaD fragment and the pVchBack fragment were assembled by Gibson and then transformed into Top10 competent cells. After thawing for 1 hour, the cells were plated on ampicillin-resistant plates and cultured overnight to obtain the pVch-alaD plasmid.

[0140] 2.3.3 Starting from BL21(ΔldhA::alaE(A48S / A149D), Δ5), the pVch-alaD plasmid was electroporated, and after being recovered at 37℃ for 1 h, it was plated on ampicillin plates and cultured overnight.

[0141] 2.3.4 Transplant single clones, then electroporate the VchpQCas8array plasmid (synthesized by General Biotechnology (Anhui) Co., Ltd.), thaw at 37°C for 1 h, plate on ampicillin and streptomycin-containing plates, and incubate overnight;

[0142] 2.3.5 Pick 5-10 single clones and dilute them in sterile LB broth. Then take 150 μl and spread it on a plate containing ampicillin, streptomycin and 100 ng / μl of dehydrated tetracycline. Incubate overnight for low-concentration induction.

[0143] 2.3.6 Scrape colonies and streak them onto plates containing chloramphenicol, streptomycin, and 1000 ng / μl of dehydrated tetracycline. Incubate overnight for high-concentration induction.

[0144] 2.3.7 The isolated monoclonal strains were subjected to PCR verification of the insertion at eight sites using Vchsite1-F and Vchsite1-R, Vchsite2-F and Vchsite2-R, Vchsite3-F and Vchsite3-R, Vchsite4-F and Vchsite4-R, Vchsite5-F and Vchsite5-R, Vchsite6-F and Vchsite6-R, Vchsite7-F and Vchsite7-R, and Vchsite8-F and Vchsite8-R. The negative control length was 500 bp, and the positive control length was approximately 3 kbp.

[0145] The reconstructed strain BL21 (ΔldhA::alaE(A48S / A149D), Δ5, alaD×7-8) was obtained, abbreviated as BL21 reconstructed strain.

[0146] 2.4 Simultaneous integration of 5 copies of alaD at 5 competing targets for interrupting L-alanine synthesis

[0147] 2.4.1 Using the BL21 genome as a template and ptr-ldhA-F / Pldh(ala)-R as primers, Pldh (approximately 800 bp) was amplified by PCR; using pET24a-alaD plasmid as a template and alaD-F / ptr-ter-R as primers, the alaD fragment was amplified by PCR; using Pldh and alaD fragments as templates and ptr-ldhA-F / ptr-ter-R as primers, the ldhA-alaD fragment (approximately 2.2 kb) was amplified by overlap PCR.

[0148] 2.4.2 Using ptP15ADonor as a template, the ptrBack fragment was amplified by PtrRE-R and PtrLE-F. The ldhA-alaD fragment and the ptrBack fragment were assembled by Gibson and then transformed into Top10 competent cells. After thawing for 1 hour, the cells were plated on chloramphenicol-resistant plates and cultured overnight to obtain the ptr-alaD plasmid.

[0149] 2.4.3 Starting from BL21(ΔldhA::alaE(A48S / A149D)), the ptr-alaD plasmid was electroporated, and after recovery at 37℃ for 1 h, it was plated on chloramphenicol plates and incubated overnight.

[0150] 2.4.4 Transform the single clone BL21(ΔldhA::alaE(A48S / A149D)) / ptr-alaD, then electroporate the Ptr1PQTVal5array plasmid, recover at 37℃ for 1 h, plate on a plate containing chloramphenicol and kanamycin, and incubate overnight;

[0151] 2.4.5 Pick 5-10 single clones and dilute them in sterile LB medium. Then take 150 μl and spread it on a plate containing chloramphenicol, kanamycin and 100 ng / μl of dehydrated tetracycline. Incubate overnight.

[0152] 2.4.6 Scrape colonies and streak them onto plates containing chloramphenicol, streptomycin, and 1000 ng / μl of dehydrated tetracycline. Incubate overnight.

[0153] 2.4.7 Take the isolated single-clone strain and electroporate the Ptr1PQTVal5array plasmid colonies. Use PCR to verify the insertion of the five sites using ackA(P5)-F2 and ackA(P5)-R2, adhE(P5)-F and adhE(P5)-R, pflB(P5)-F and pflB(P5)-R, frd(P5)-F and frd(P5)-R, and mgsA(P5)-F and mgsA(P5)-R. The negative control length is 500 bp, and the positive control length is about 3 kbp.

[0154] The strain BL21(ΔldhA::alaE(A48S / A149D), Δ5, 5alaD) was obtained, abbreviated as BL21 reconstructed strain.

[0155] Example 3: Construction of a high-yield L-alanine strain using MG1655

[0156] 3.1 Knockout of the ldhA gene with simultaneous ectopic integration of alaE (A48S / A149D)

[0157] 3.1.1 Using the genome of strain MG1655 (purchased from CGSC) as a template, PCR amplification was performed using ldhA-F / ldhA-LHR-R to obtain fragment 1 of approximately 400 bp. PCR amplification was then performed using ldhA-aE-RHR-F / ldhA-aE-RHR-R to obtain fragment 2 of approximately 440 bp. Using pMDIAI plasmid as a template, the Apr fragment was amplified using primers Apr-ldhA-F / Apr-ldhA-R and labeled as fragment 3. Using fragment 1, fragment 2, and fragment 3 as templates, overlap was performed using primers ldhA-F / ldhA-aE-RHR-R to obtain fragment 4 (up-Apr-down).

[0158] Using the MG1655 strain genome as a template, fragment 3 (approximately 850 kbp) was amplified using ldhA-EF / alaE48S-R, and fragment 4 (approximately 650 kbp) was amplified using alaE48S-F and ldhA-ER. Subsequently, using fragments 3 and 4 as templates, ldhA-EF and ldhA-ER were used for amplification, yielding fragment 5 (approximately 1.4 kbp). Using fragment 5 as a template, ldhA-EF and alaE149-R were used for amplification, yielding fragment 6 (approximately 1.1 kbp), and alaE149-F and ldhA-ER were used for amplification, yielding fragment 7 (approximately 300 kbp). Subsequently, using fragments 6 and 7 as templates, ldhA-EF and ldhA-ER were used for amplification, yielding fragment 8 (approximately 1.4 kbp). Finally, using fragments 1, 2, and 8 as templates, overlap PCR was performed using ldhA-F and ldhA-aE-RHR-R, yielding fragment 8 (approximately 2.2 kbp). The homologous fragment of bp's alaE (A48S / A149D);

[0159] 3.1.2 The pISFba1 plasmid was electroporated into MG1655 competent cells. After thawing for 1 hour, the cells were plated on kanamycin plates to screen for successfully transfected MG1655 / pISFba1 cells. 3.1.3 MG1655 / pISFba1 strains were picked and cultured overnight in kanamycin-resistant LB medium. Then, 1% of the cells were transferred to LB liquid medium containing 10 mM L-arabinose and kanamycin resistance. The cells were cultured at 37°C until the OD reached 0.5. The cells were washed twice with 10% glycerol, and the up-Apr-down fragment was electroporated. After thawing at 37°C for 1 hour, the cells were plated on kanamycin and apramycin plates.

[0160] 3.1.4 Use primers ldhA-CK-F and ldhA-CK-R to verify whether up-Apr-down integrates into the ldhA site. A length of 2.3 kbp is considered positive, and the negative control length is 1 kbp, to obtain MG1655ΔldhA::Apr / pISFba1;

[0161] 3.1.5 MG1655ΔldhA::Apr / pISFba1 strain was picked and cultured overnight in kanamycin-resistant LB medium. Then, 1% was transferred to LB liquid medium containing 10 mM L-arabinose and kanamycin and cultured at 37°C until the OD reached 0.5. The culture was washed twice with 10% glycerol, and the alaE (A48S / A149D) fragment and pISFba1 reRNA-Apr plasmid were electroporated. After recovery at 37°C for 1 h, the plasmids were plated on kanamycin and spectinomycin plates.

[0162] 3.1.6 Use primers ldhA-CK-F and ldhA-CK-R to verify whether alaE (A48S / A149D) is ectopically integrated into the ldhA site. A length of 2.2 kbp is considered positive, and the negative control length is 1 kbp.

[0163] 3.1.7 For single clones that successfully integrated alaE (A48S / A149D) at the ldhA site, the plasmids were removed. The single clones were picked and induced overnight in LB liquid medium with kanamycin and 10 mM rhamnose. Then, 1% were transferred to LB antibiotic-free medium for overnight expansion. Finally, the plasmids were removed by streaking on SacB plates.

[0164] 3.2 Five Targets that Compete to Disrupt L-Alanine Synthesis

[0165] 3.2.1 Using pUC57-Ter as a template, PCR amplification was performed using GFPOVPtRe-F and GFPOVPtLE-R to obtain a terminator fragment of approximately 600 bp; using pDonorGFP as a template, PCR amplification was performed using PtDonorOVP15A-F and PtREOVGFP-R to obtain a p15ABack fragment of approximately 3.3 kbp.

[0166] 3.2.2 The terminator and p15ABack fragments were assembled using Gibson, and then heat-shocked and transformed into Top10 competent cells. After 1 hour of recovery, the cells were plated on chloramphenicol-resistant plates and cultured overnight at 37°C to obtain the PtrpDonor-VerA plasmid.

[0167] 3.2.3 Starting from MG1655(ΔldhA::alaE(A48S / A149D)), the PtrpDonor-VerA plasmid was electroporated, and after 1 hour of recovery, it was plated on chloramphenicol plates and incubated overnight.

[0168] 3.2.4 Competent cells were prepared from MG1655(ΔldhA::alaE(A48S / A149D)) / PtrpDonor-VerA, electroporated with PT1PtetQT5array plasmid, and after recovery at 37℃ for 1 h, they were plated on a double antibiotic plate containing chloramphenicol and kanamycin and cultured overnight.

[0169] 3.2.5 After the single clones have grown, use a pipette tip to pick up 5-15 single clones, mix them in 100 μl of sterile LB liquid medium, and then spread them on chloramphenicol and kanamycin resistance plates with 100 ng / μl of dehydrated tetracycline as an inducer. Incubate overnight for low-concentration induction.

[0170] 3.2.6 After single clones have grown, bacterial cells are transferred from the plate to the colony and streaked onto chloramphenicol and kanamycin resistant plates supplemented with 1000 ng / μl adehydrotetracycline as an inducer. The plates are then incubated overnight for high-concentration induction.

[0171] 3.2.7 The isolated single clone strains were subjected to PCR verification of the insertion at five sites using ackA(P5)-F2 and ackA(P5)-R2, adhE(P5)-F and adhE(P5)-R, pflB(P5)-F and pflB(P5)-R, frd(P5)-F and frd(P5)-R, and mgsA(P5)-F and mgsA(P5)-R, respectively. The negative control length was 500 bp, and the positive control length was about 2 kbp, resulting in MG1655(ΔldhA::alaE(A48S / A149D), Δ5).

[0172] 3.3 Integration of multi-copy alaD gene using VchCAST

[0173] 3.3.1 Using the MG1655 genome as a template and ptr-ldhA-F / Pldh(ala)-R as primers, Pldh (approximately 800 bp) was amplified by PCR; using pET24a-alaD plasmid as a template and alaD-F / ptr-ter-R as primers, the alaD fragment was amplified by PCR; using Pldh and alaD fragments as templates and ptr-ldhA-F / ptr-ter-R as primers, the ldhA-alaD fragment (approximately 2.2 kb) was amplified by overlap PCR.

[0174] 3.3.2 Using pDonor-GDH as a template, the pVchBack fragment was amplified by VchalaD-F and VchDonorLE-F. The ldhA-alaD fragment and the pVchBack fragment were assembled by Gibson. Then, the fragments were heat-shocked and transformed into Top10 competent cells. After thawing for 1 hour, the cells were plated on ampicillin-resistant plates and cultured overnight to obtain the pVch-alaD plasmid.

[0175] 3.3.3 Starting from MG1655(ΔldhA::alaE(A48S / A149D), Δ5), the pVch-alaD plasmid was electroporated, and after being recovered at 37℃ for 1 h, it was plated on ampicillin plates and incubated overnight.

[0176] 3.3.4 Transplant single clones, then electroporate the VchpQCas8array plasmid, thaw at 37°C for 1 h, plate on ampicillin and streptomycin-containing plates, and incubate overnight;

[0177] 3.3.5 Pick 5-10 single clones and dilute them in sterile LB medium. Then take 150 μl and spread it on a plate containing ampicillin, streptomycin and 100 ng / μl of dehydrated tetracycline. Incubate overnight for low-concentration induction.

[0178] 3.3.6 Scrape colonies and streak them onto plates containing chloramphenicol, streptomycin, and 1000 ng / μl of dehydrated tetracycline. Incubate overnight for high-concentration induction.

[0179] 3.3.7 The isolated monoclonal strains were subjected to PCR verification of the insertion of 8 sites using Vchsite1-F and Vchsite1-R, Vchsite2-F and Vchsite2-R, Vchsite3-F and Vchsite3-R, Vchsite4-F and Vchsite4-R, Vchsite5-F and Vchsite5-R, Vchsite6-F and Vchsite6-R, Vchsite7-F and Vchsite7-R, and Vchsite8-F and Vchsite8-R. The negative control length was 500 bp, and the positive control length was about 3 kbp. Monoclonal strains that successfully integrated 8 alads were screened out.

[0180] The strain MG1655(ΔldhA::alaE(A48S / A149D), Δ5, alaD×8) was obtained, abbreviated as MG1655 reconstructed strain.

[0181] Example 4: Validation of L-alanine fermentation yield from different chassis Escherichia coli reconstructed strains

[0182] 4.1 Anaerobic fermentation test

[0183] 4.1.1 The glycerol strains of the reconstructed ATCC8739, MG1655, and BL21 bacteria were inoculated into 5 ml LB tubes and cultured at 37°C and 250 rpm for 24 h on a shaker.

[0184] 4.1.2 Transfer the culture from the test tube to an anaerobic acclimatization bottle containing AMIG80 medium at a rate of 1% v / v. The fermentation volume is 100 ml. The seed culture is carried out at 37℃ in the acclimatization bottle, with the pH controlled at 7.0 using 15% ammonia. Culture for 24 hours, then collect samples and measure the OD of the bacterial solution. 600 Values, glucose concentration, and L-alanine content, etc.

[0185] In this study, AMIG80 medium was used for L-alanine fermentation. The medium formula was: 80 g / L glucose, 2.63 g / L diammonium hydrogen phosphate, 0.87 g / L diammonium dihydrogen phosphate, 0.15 g / L potassium chloride, 1.5 mg / L magnesium sulfate heptahydrate, 1 mM betaine, 2.4 mg / L ferric chloride hexahydrate, 0.3 mg / L cobalt chloride hexahydrate, 0.15 mg / L copper chloride dihydrate, 0.3 mg / L zinc chloride, 0.3 mg / L sodium molybdate dihydrate, 0.075 mg / L boric acid, and 0.5 mg / L manganese chloride tetrahydrate.

[0186] 4.1.3 Subsequently, the seed culture was inoculated at a rate of 10% v / v, and 10 ml of seed culture was transferred to 100 ml of AMIG80 fermentation medium for acclimatization bottle fermentation test, with the pH controlled at 7.0; after 24 h of fermentation, the inoculum was harvested, samples were taken, and the OD of the inoculum was measured. 600 Values, glucose concentration, and L-alanine content, etc.

[0187] 4.2 Sample Determination Methods

[0188] 4.2.1 Escherichia coli biomass was determined by absorbance at 600 nm (OD600) using a UV spectrophotometer. Glucose concentration was determined using an SBA-40C biosensor (Shandong Academy of Sciences, China).

[0189] 4.2.2 Determination of L-alanine: Multiple amino acids were analyzed using pre-column OPA derivatization with LC. L-alanine was derivatized with phthalaldehyde, and its concentration was determined by high-performance liquid chromatography (HPLC). Mobile phase A was 10 mM Na₂HPO₄ + 10 mM NaB₄O₇ solution, pH adjusted to 8.2; mobile phase B was ACN:MeOH:H₂O = 45:45:10, flow rate was 1 mL / min, column temperature was 40℃, and UV detection wavelength was 360 nm.

[0190] 4.3 L-alanine yield from anaerobic fermentation

[0191] Based on the fermentation protocol in step 4.1 and the determination method in step 4.2, the L-alanine fermentation yield of the first completed ATCC8739 reconstructed strain was compared. Three parallel experiments were performed for each strain, and the results are shown in Table 3.

[0192] Table 3. L-alanine yield after ATCC8739 integration with different aladins

[0193]

[0194] As can be seen from the data in Table 3, the production of L-alanine increases with the increase of alaD copy number, until the production of L-alanine reaches its highest level when alaD reaches 5 copies.

[0195] Subsequently, we selected the intersection of three chassis bacteria integrating alaD copies, i.e., the reconstructed strains with 8 copies of alaD, for parallel fermentation tests, and the results are shown in Table 4.

[0196] Table 4. L-alanine yield after integration of 8 alads by ATCC8739, BL21 and MG1655

[0197]

[0198] As can be seen from the data in Table 4, after integrating the same copy of alaD into the three chassis, the L-alanine production ranked as ATCC8739 > MG1655 > BL21, that is, the recombinant E. coli constructed with E. coli ATCC8739 as the chassis bacteria has a higher alanine fermentation capacity.

[0199] The specific embodiments of the present invention have been described above, but the scope of protection of the present invention is not limited to the specific embodiments described above. Those skilled in the art can make various changes or modifications within the scope of the claims, which do not affect the substantive content of the present invention.

Claims

1. A modified bacterium for producing L-alanine, characterized in that, Compared to unmodified bacteria, its genome integrates the gene encoding heterologous pyruvate dehydrogenase (alaD).

2. The modified bacteria as described in claim 1, characterized in that, The bacteria are Corynebacterium, preferably Escherichia coli, more preferably Escherichia coli ATCC8739, Escherichia coli BL21 or Escherichia coli MG1655.

3. The modified bacteria as described in claim 1, characterized in that, The pyruvate dehydrogenase is derived from *Geobacillus stearothermophilus* or a mutant with enhanced enzyme activity. Preferably, the pyruvate dehydrogenase is alaD, version 2007, GeneBank number: EF154460.

1. More preferably, the coding gene is a polynucleotide with a nucleotide sequence as shown in SEQ ID NO: 2, or the coding gene is a polynucleotide with a nucleotide sequence having 70% or more, preferably 80% or more, preferably 85% or more, preferably 90% or more, preferably 95% or more homology to SEQ ID NO:

2.

4. The modified bacteria according to any one of claims 1 to 3, characterized in that, Its genome integrates one or more copies, preferably 3-11 copies, and more preferably five or more copies of the alaD coding gene from Geobacillus stearothermophilus.

5. The modified bacteria as described in claim 4, characterized in that, Its genome further integrates the alaE mutant encoding gene, which has enhanced function compared to the wild-type alanine export protein alaE.

6. The modified bacteria as described in claim 5, characterized in that, The wild-type alanine efflux protein alaE is the alaE version with GeneBank number AAC75717.1 from 2025 for Escherichia coli MG1655; the alaE version with GeneBank number QNG33491.1 from 2020 for Escherichia coli BL21; and the alaE version with GeneBank number UZF39531.1 from 2022 for Escherichia coli ATCC8739. Preferably, the mutant is alaE(A48S / A149D). Accordingly, the coding gene of the mutant alaE(A48S / A149D) is a polynucleotide with a nucleotide sequence as shown in SEQ ID NO: 1, or the coding gene of the mutant alaE(A48S / A149D) is a polynucleotide with a nucleotide sequence having more than 70%, preferably more than 80%, preferably more than 85%, preferably more than 90%, preferably more than 95% homology to SEQ ID NO:

1.

7. The modified bacteria as described in claim 6, characterized in that, Its genome contains any one, two, three, four, five, or six genes selected from the following: genes whose expression is downregulated, inactivated, functionally weakened, or knocked out. ldhA (MG1655 in 2025 GeneBank version: AAC74462.1; BL21 in 2020 GeneBank version: QNG32383.1; ATCC8739 in 2022 GeneBank version: UZF39994.1). mgsA (MG1655 in GeneBank version AAC74049.2 in 2025; BL21 in GeneBank version QNG31997.1 in 2020; ATCC8739 in GeneBank version UZF41072.1 in 2022). pflB (MG1655 in 2025 GeneBank version: AAC73989.1; BL21 in 2020 GeneBank version: QNG31937.1; ATCC8739 in 2022 GeneBank version: UZF39092.1), adhE (MG1655 in 2025 GeneBank version: AAC74323.1; BL21 in 2020 GeneBank version: QNG32244.1; ATCC8739 in 2021 GeneBank version: QRM73733.1). ackA (MG1655, GeneBank version AAC75356.1, 2025; BL21, GeneBank version QNG33187.1, 2020; ATCC8739, GeneBank version UZF39846.1, 2022), and frdB (MG1655 in 2025 GeneBank version: AAC77113.1; BL21 in 2020 GeneBank version: QNG34975.1; ATCC8739 in 2022 GeneBank version: UZF42248.1).

8. A method for constructing the modified bacteria as described in claim 7, namely, L-alanine-producing bacteria, characterized in that, Includes the following steps: (1) Using Escherichia coli as the substrate bacteria, downregulate, inactivate, weaken, or knock out any one, two, three, four, five, or six of the following genes in its genome: ldhA (MG1655 in 2025 GeneBank version: AAC74462.1; BL21 in 2020 GeneBank version: QNG32383.1; ATCC8739 in 2022 GeneBank version: UZF39994.1). mgsA (MG1655 in GeneBank version AAC74049.2 in 2025; BL21 in GeneBank version QNG31997.1 in 2020; ATCC8739 in GeneBank version UZF41072.1 in 2022). pflB (MG1655 in 2025 GeneBank version: AAC73989.1; BL21 in 2020 GeneBank version: QNG31937.1; ATCC8739 in 2022 GeneBank version: UZF39092.1), adhE (MG1655 in 2025 GeneBank version: AAC74323.1; BL21 in 2020 GeneBank version: QNG32244.1; ATCC8739 in 2021 GeneBank version: QRM73733.1). ackA (MG1655, GeneBank version AAC75356.1, 2025; BL21, GeneBank version QNG33187.1, 2020; ATCC8739, GeneBank version UZF39846.1, 2022), and frdB (MG1655, GeneBank version AAC77113.1, 2025; BL21, GeneBank version QNG34975.1, 2020; ATCC8739, GeneBank version UZF42248.1, 2022); and (2) Cause the strain to overexpress the following genes: The coding gene of the mutant alaE (A48S / A149D) of the alanine efflux protein alaE (MG1655, GeneBank version AAC75717.1, 2025; BL21, GeneBank version QNG33491.1, 2020; ATCC8739, GeneBank version UZF39531.1, 2022), preferably with the nucleotide sequence shown in SEQ ID NO:

1. The L-alanine-producing bacterium was obtained by selecting for resistance and verifying the nucleotide sequence of the pyruvate dehydrogenase alaD (GeneBank version EF154460.1 in 2007) from *Geobacillus stearothermophilus*, preferably with one or more copies, preferably 3-11 copies, and more preferably 5 or more copies, with the nucleotide sequence of the encoded gene as shown in SEQ ID NO:

2.

9. The method according to claim 8, characterized in that, Includes the following steps: A. Using Escherichia coli as the substrate bacteria, the expression, inactivation, weakening, or knockout of the ldhA gene in the genome was downregulated; the mutant alaE(A48S / A149D) gene was integrated into the genome, and strain A was obtained through resistance screening and genotype verification. B. The expression, inactivation, weakening or knockout of genes mgsA, pflB, adhE, ackA and frdB in the genome of strain A were downregulated, and strain B was obtained through resistance screening and genotype verification. C. Integrate one or more copies, preferably 3-11 copies, and more preferably 5 or more copies of the gene alaD from Geobacillus stearothermophilus into the genome of strain B, and obtain an L-alanine-producing strain through resistance screening and genotype verification.

10. Use of the modified bacteria according to any one of claims 1-7 in the fermentation production of L-alanine.

Images