Candidatus liberibacter asiaticum and a method for detecting the same
By providing a novel maltosyltransferase CoGlgE, precise glycosylation modification of arbutin was achieved, solving the problem of poor modification effect of arbutin in existing technologies and improving its application effect in whitening skin care products.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- NANJING AGRICULTURAL UNIVERSITY
- Filing Date
- 2026-04-10
- Publication Date
- 2026-06-05
AI Technical Summary
Existing maltosyltransferases have difficulty achieving efficient modification at specific sites in the glycosylation of natural products, especially in the modification of arbutin, which affects its application effect in whitening skin care products.
A novel maltosyltransferase CoGlgE and its encoding gene are provided. By using maltose-1-phosphate or maltodextrin as glycosyl donors, precise glycosylation modification of α/β-arbutin is achieved, thereby enhancing its inhibitory effect on tyrosinase.
This enhances the whitening and skincare effects of arbutin by improving its ability to inhibit tyrosinase through precise glycosylation modification, thereby increasing the application value of arbutin in cosmetics.
Smart Images

Figure CN122146646A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the fields of genetic engineering and enzyme engineering, specifically to a novel maltosyltransferase CoGlgE derived from the myxobacterium Corallococcus sp. EGB and its encoding gene, as well as the application of this enzyme in catalyzing the synthesis of malt oligosaccharides and modifying arbutin. Background Technology
[0002] Maltosyltransferase GlgE (EC 2.4.99.16), also known as α-1,4-glucan:maltose-1-phosphate maltosyltransferase, belongs to the GH13 family of glycoside hydrolases. It is a transferase that acts on maltose-1-phosphate (M1P) and malt oligosaccharides. GlgE catalyzes the transfer of maltose groups from M1P to the non-reducing end of linear α-1,4-glucan, elongating the straight or branched chain and releasing inorganic phosphate in the linear α-glucan biosynthesis pathway. Furthermore, it can disproportionate malt oligosaccharides with a degree of polymerization (DP) X to products with a DP of X ± 2n (X ≥ 3). Another maltosyltransferase in the GH13 family, α-maltosyltransferase (EC 2.4.1.- , MTase), cannot utilize maltose-1-phosphate as a donor.
[0003] Maltosyltransferases can enhance the structural complexity and diversity of natural products through glycosylation modification. By transferring maltose residues to receptor molecules, they can improve the druggability of natural products to some extent, providing new ideas for the development of new drugs based on natural products. Due to their complex and diverse structures, chemical glycosylation modification of natural products has always been a difficult problem to solve, as it is difficult to achieve glycosylation modification at specific sites. In contrast, enzymatic glycosylation modification, characterized by high selectivity, high reaction efficiency, and mild conditions, has significant advantages in improving druggability factors such as solubility, stability, and bioactivity of natural products.
[0004] Arbutin effectively inhibits the activity of tyrosinase in human melanocytes, blocking melanin formation. Therefore, it can be added to cosmetics as a whitening and skin-care functional factor, and clinically, it is also effective in treating melasma and melanoma. To further improve stability and transdermal absorption, various glycosylation-modified products have been developed, such as arbutin glucoside and arbutin maltodextrin. These act as "precursors," slowly releasing arbutin into the skin, prolonging the duration of action and reducing irritation. Currently, reported maltodextrin glycosylation modifications of natural products are limited to MTase; the discovery of novel maltodextrin glycosides provides a new method for the preparation of arbutin maltodextrin. Summary of the Invention
[0005] The purpose of this invention is to address the aforementioned shortcomings of the prior art by providing a maltodextrinsic transferase.
[0006] Another object of the present invention is to provide the encoding gene of the maltosyltransferase.
[0007] Another object of the present invention is to provide the application of maltodextrin and its gene.
[0008] The objective of this invention can be achieved through the following technical solutions:
[0009] A maltodextrin transferase, selected from any of the following:
[0010] (1) A protein with an amino acid sequence as shown in SEQ ID NO.1;
[0011] (2) A variant protein having at least 80%, 90%, 95% or 99% similarity to the amino acid sequence shown in SEQ ID NO. 1 and having maltodyltransferase activity.
[0012] The gene encoding the maltosyltransferase.
[0013] Preferably, the nucleotide sequence of the encoding gene is as shown in SEQ ID NO.2, or a sequence that is complementary to the sequence shown in SEQ ID NO.2 under strict conditions.
[0014] This invention provides upstream and downstream primers for cloning the maltosyltransferase gene of myxobacteria, the sequences of which are shown in SEQ ID NO.3 and SEQ ID NO.4.
[0015] A recombinant expression vector for the aforementioned maltosyltransferase contains the gene encoding the aforementioned maltosyltransferase.
[0016] A transgenic recombinant bacterium that produces the aforementioned maltosyltransferase contains the encoding gene for the aforementioned maltosyltransferase or the aforementioned recombinant expression vector.
[0017] A method for producing the aforementioned maltosyltransferase CoGlgE involves culturing the transgenic recombinant bacteria and expressing the maltosyltransferase CoGlgE.
[0018] A method for modifying arbutin, comprising catalyzing a transglycosylation reaction in an enzymatic reaction system using the aforementioned myxobacterial maltosyltransferase.
[0019] Preferably, the enzyme activation reaction system contains α / β-arbutin and maltodextrin.
[0020] The application of the described myxobacterial maltosyltransferase in disproportionating malt oligosaccharides with a degree of polymerization of X to products with a degree of polymerization of X ± 2n.
[0021] The beneficial effects of this invention are:
[0022] This invention provides a novel maltosyltransferase, CoGlgE, which uses maltose-1-phosphate or maltodextrin as a glycosyl donor, transferring one maltose unit at a time to achieve precise addition of disaccharide units. This lays an important foundation for constructing a heterogeneous maltosyltransferase toolkit. Furthermore, the maltosyltransferase CoGlgE provided by this invention can be glycosylated with α-arbutin and β-arbutin as substrates, resulting in enhanced inhibitory effects of both arbutin glycosylation products on tyrosinase, thus improving the application value of arbutin as an additive in skin whitening products. Attached Figure Description
[0023] Figure 1 Agarose gel electrophoresis images of the gene clone and vector construction of coglgE. Lane M is the marker; lane 1 in the left image is the PCR product of the coglgE gene, lane 1 in the right image is the pET-29a(+)- coglgE recombinant plasmid; lane 2 is the pET-29a(+) empty vector plasmid.
[0024] Figure 2 This is an SDS-PAGE image of the recombinase CoGlgE. Lane M is the protein marker; lane 1 is the supernatant of the empty vector strain E. coli BL21-(pET-29a); lane 2 is the supernatant of the recombinase CoGlgE expressing strain; lane 3 is the flow-through sample of the supernatant passing through the column; lanes 4-8 are the eluted samples with 0 mM, 50 mM, 100 mM, 200 mM, and 300 mM imidazole buffers, respectively.
[0025] Figure 3 The enzymatic properties of the recombinant enzyme CoGlgE transferase are: (a) optimal temperature; (b) temperature stability; (c) optimal pH; and (d) pH stability.
[0026] Figure 4 The effect of metal ions on CoGlgE transferase activity.
[0027] Figure 5 This is a TLC chromatogram of the reaction products using glucose and maltobiose-heptaose as substrates. Lane M is the sugar marker; lanes 1-7 correspond to glucose and maltobiose-heptaose, respectively.
[0028] Figure 6 This is a TLC chromatogram of CoGlgE on the α / β-arbutin modified products. Lane M is the sugar marker; lanes 1-2 correspond to the control group and the treatment group, respectively.
[0029] Figure 7 This is an HRMS identification image of the arbutin glycosylation modified product.
[0030] Figure 8 This is a graph showing the inhibitory effects of α / β-arbutin and its modified products on tyrosinase activity. Columns 1-3 correspond to the α-arbutin treatment group, the α-arbutin modified product treatment group, and the blank control group, respectively; columns 4-6 correspond to the β-arbutin treatment group, the β-arbutin modified product treatment group, and the blank control group, respectively. Detailed Implementation
[0031] The technical solutions in the embodiments of the present invention are described in full below. The described embodiments are only some embodiments of the present invention, and not all embodiments. The scope of protection of the present invention is not limited thereto.
[0032] Example 1 Cloning of the coglgE gene
[0033] The pET-29a(+)-coglgE expression vector was obtained using homologous recombination. Primer sequences were designed as shown in SEQ ID NO. 3 and SEQ ID NO. 4. Using the genome of *E. myxobacterium* (CCTCC NO: M2012528, disclosed in CN103103152B) (Genbank No.: CP079946) as a template, the CoGlgE gene fragment was cloned using Hieff CanaceR Plus PCR Master Mix high-fidelity enzyme (total PCR reaction volume: 50 μL: 25 μL 2×Hieff CanaceR Plus PCR Master Mix, 1 μL template, 2 μL each of forward and reverse primers, 20 μL ddH2O). The PCR reaction program was: 98℃ pre-denaturation for 3 min; 98℃ denaturation for 10 s, 60℃ annealing for 20 s, 72℃ extension for 1 min, 32 cycles; final extension at 72℃ for 5 min; storage at 4℃.
[0034] PCR products were detected using 1% agarose gel electrophoresis. The amplified target gene fragment was recovered according to the instructions of the gel extraction kit, and the results were detected by gel electrophoresis as follows: Figure 1 As shown, the target gene was successfully amplified.
[0035] Example 2: Construction of the expression vector pET-29a(+)-coglgE
[0036] The target gene was constructed into the pET-29a(+) vector using the ClonExpress II One Step Cloning Kit. The restriction enzyme sites were Nde I and Xho I. According to the instructions, the optimal molar ratio of cloning vector to insert fragment in this reaction system was 1:2. The optimal amount was calculated using the following formula:
[0037] Optimal cloning vector usage = [0.02 × number of base pairs in cloning vector] ng (0.03 pmol) Optimal insert usage = [0.04 × number of base pairs in insert] ng (0.06 pmol)
[0038] The calculated system composition for this reaction is shown in Table 1.
[0039] Table 1 Composition of the homologous recombination reaction system
[0040] System components Volume (μL) Linearization of pET-29a(+) 3 gene fragment coglgE 1 5×CEII Buffer 2 Exnase II 1 <![CDATA[ddH2O]]> 3 total 10
[0041] Add 10 μL of the recombinant product to 100 μL of competent cells, mix gently, incubate on ice for 30 min, then heat shock at 42℃ for 90 s, followed by an ice incubation for 2 min. Add 600 μL of LB liquid medium to a centrifuge tube and incubate at 37℃ for 30-40 min. After incubation, collect the cells by instantaneous centrifugation at 12000 rpm. Spread 100 μL of the resuspended bacterial culture onto LB solid medium containing Kan resistance (50 μg / mL) and incubate upside down at 37℃ for 14 h. Pick a single colony from the plate and transfer it to an LB liquid tube containing 50 μg / mL Kan, and incubate at 37℃ with shaking for 8 h. Extract plasmids and determine their size by nucleic acid electrophoresis. Figure 1 The sample was then sent to a sequencing company for sequencing to obtain the recombinant plasmid pET-29a(+)-coglgE.
[0042] Example 3: Induction and purification of recombinant CoGlgE
[0043] The recombinant plasmid pET-29a(+)-coglgE was transformed into E. coli BL21 (DE3) competent cells to obtain the expression strain E. coli BL21(DE3) [pET-29a(+)-coglgE]. The constructed expression strain was transferred to LB liquid medium containing 50 μg / mL Kan at a 1% inoculum and cultured at 37℃ with shaking at 180 rpm for 2-4 h until the OD600 reached approximately 0.6. Then, IPTG inducer was added to a final concentration of 0.2 mM and induced at 16℃ for 20 h. The bacterial cells were then collected by centrifugation at 4℃ and 12000 rpm for 2 min. The bacterial cells were then resuspended in 20 mM Tris-HCl (pH=7) and sonicated on ice with the following parameters: φ6, power 40%, 1 s disruption followed by a 2 s interval, centrifuged at 12000 rpm for 20 min at 4°C, and the supernatant was collected. The supernatant was added to a equilibrated Ni-IMAC column, and the eluent was collected. Impurities were washed away with 10 mL of 20 mM Tris-HCl (elution buffer), followed by a gradient elution with 20 mM Tris-HCl buffers containing 50 mM, 100 mM, 200 mM, and 300 mM imidazole, and the eluent was collected. The collected samples were analyzed by SDS-PAGE electrophoresis. The eluents with higher purity were combined and dialyzed overnight at 4°C in 20 mM Tris-HCl (pH 7.0) using a dialysis bag with a molecular weight cutoff of 7 kDa to remove imidazole. The purified enzyme CoGlgE was concentrated by ultrafiltration using an ultrafiltration tube with a molecular weight cutoff of 30 kDa. The results are as follows: Figure 2 As shown, CoGlgE has a distinct protein band around 75 kDa, which is close to the predicted theoretical molecular weight of 75.81 kDa.
[0044] Example 4: Determination of the transmaltose activity of the recombinase CoGlgE
[0045] The maltosyltransferase activity of CoGlgE was determined by measuring phosphate release using the malachite green assay. One unit of transtransferase activity (1 U) is defined as the amount of enzyme required to release 1 nmol of phosphate per minute by converting M1P. The transglycosylation reaction was performed using M1P as the glycosyl donor and maltotetraose as the glycosyl acceptor. Using 0.4 mM M1P and 4.5 mM maltotetraose as substrates, 2 μg of protein was added to a total volume of 20 μL. The reaction was carried out at 40°C for 1 h. Phosphate release was measured according to the instructions of the malachite green phosphate assay kit, with boil-inactivated enzyme as a blank control. The specific activity of maltosyltransferase CoGlgE was determined to be 114.23 U / mg.
[0046] The optimal pH for CoGlgE was determined at 40 °C using the following 50 mM buffer solutions: citrate-sodium citrate buffer (pH 3.0-6.0); PBS buffer (pH 6.0-8.0); Tris-HCl buffer (pH 7.0-9.0); and Gly-NaOH buffer (pH 9.0-12.0). The optimal temperature was determined at pH 7.0, within the range of 0-60 °C. The effect of metal ions on enzyme activity was investigated using a final concentration of 1 mM K+. + Na + Ca 2+ Ba 2+ Mn 2+ Ni 2+ Mg 2+ Cu 2+ Zn 2+ Fe 2+ Co 3+ Fe 3+ and Cr 3+ Enzymatic properties indicate that the optimal reaction temperature for CoGlgE is 40℃ (e.g., ...). Figure 3 (as shown in (a)), it has good thermal stability at 30℃-40℃ (e.g. Figure 3 (b) shows); the optimal pH for this enzyme is 7.0 Tris-HCl (as shown in [example]). Figure 3 (c) shows that the enzyme activity with transfer activity is low in PBS buffer systems with pH 6.0–8.0, and the stability is best in Tris-HCl buffer at pH 7.0 (as shown in (c)). Figure 3 (d) shown); Cu 2+ Fe 2+ Fe 3+ Cr 3+ Zn has a significant inhibitory effect on enzyme transfer activity. 2+ Co 3+ It has a weak inhibitory effect on transfer activity, Ba 2+ and Mn 2+ It has a certain activating effect on transfer activity (e.g.) Figure 4 (as shown)
[0047] Example 5: Functional verification of the recombinase CoGlgE dismutation reaction
[0048] The disproportionation products of CoGlgE were detected by TLC. Using 0.5% maltotriose-maltoheptaose (M3-M7) as substrate, the reaction was carried out under optimal conditions for 3 h and 6 h, followed by boiling for 5 min to terminate the reaction. The mixture was centrifuged at 12000 rpm for 1 min, and 5 μL of the supernatant was spotted onto a silica gel plate. Chromatography was performed for 1.5 h–3 h using n-butanol:acetic acid:water = 2:1:1 (v / v / v). Once the developing solvent reached the top of the plate, the plate was removed, dried, and sprayed with a colorimetric reagent of concentrated sulfuric acid:methanol = 1:1 (v / v). The plate was then baked in a 90℃ oven for 10 min for color development. The results are shown below. Figure 5 As shown, the recombinase CoGlgE can disproportionate maltodextrin with a degree of polymerization (DP) X into a product with a DP of X ± 2n (X ≥ 3).
[0049] Example 6: Glycosylation Modification of Arbutin by Recombinant Enzyme CoGlgE and Its Identification
[0050] Glycosylation modification of arbutin by recombinase CoGlgE
[0051] Arbutin at a concentration of 50 mg / mL was prepared using deionized water. Maltodextrin (5 mM) was used as the maltodextrin donor in a 20 μL reaction system with a donor-acceptor molar ratio of 1:2. 5 μg of recombinase CoGlgE was added, and the reaction was carried out in a 37°C water bath for 6 h, followed by boiling for 5 min to terminate the reaction. TLC analysis of the product components (refer to Example 5) yielded the following results: Figure 6 As shown, CoGlgE has a modifying effect on both α-arbutin and β-arbutin, and the configuration of arbutin does not affect the glycosylation modification of arbutin by the recombinase CoGlgE.
[0052] Mass spectrometric identification of arbutin transglycosylation modification products
[0053] The arbutin-modified product was identified by mass spectrometry using a Thermo Scientific Q Exactive quadrupole Orbitrap mass spectrometer. Pneumatic-assisted electrospray ionization was used, with sample cyclic injection (2 μL), a mobile phase of methanol / acetonitrile, a flow rate of 200 μL / min, and a scan range of m / z 100–1100. The Q Exactive HESI source was operated in positive mode in full MS mode, with a mass resolution adjusted to 140,000 FWHM at m / z 200. The spray voltage was set to 3.50 kV / 3.00 kV, and the sheath gas flow rate and auxiliary gas flow rate were 45 and 15 units, respectively. The capillary tube temperature was maintained at 250 °C, the S-Lens RF level was set to 50 V, and data acquisition and processing were performed using Xcalbur software. The detection results are as follows: Figure 7As shown, a new substance is generated at m / z 619.18193, which is consistent with the predicted molecular weight of the modified product α-D-maltose-(1→4)-arbutin, 619.183046. This indicates that CoGlgE can modify the natural product arbutin through transmaltose conversion.
[0054] Example 7: Determination of the bioactivity of arbutin glycosylation-modified products
[0055] Tyrosinase derived from *Burkholderia thailandensis* was used as the experimental subject. The inhibitory effects of arbutin and its glycosylated modification product on tyrosinase were compared by measuring its enzyme activity. The activity assay system consisted of a 1 mL reaction mixture: 400 μL 1 mg / mL 3,4-dihydroxyphenol (DOPA), 100 μL 0.3 mg / mL tyrosinase, 478 μL 20 mM Tris-HCl, 2 μL 0.1 M copper ions, and 20 μL arbutin or its glycosylated modification product. The absorbance was measured at 475 nm after reacting at room temperature for 1 h. The untreated group served as the negative control, and the group treated with 20 μL 10 mg / mL arbutin served as the positive control. The results are as follows: Figure 8 As shown, tyrosinase catalyzes the formation of orange dopa from tyrosine. The addition of arbutin and its modified products both reduce tyrosinase activity and lighten the orange-red color. Furthermore, the inhibitory effect of the arbutin glycosylation modified product is more significant. Therefore, it is indicated that the arbutin glycosylation modified product generated after modification with recombinant enzyme CoGlgE has enhanced biological activity.
[0056] The amino acid sequence of CoGlgE:
[0057] SEQ ID NO.1
[0058] TERLGSVFIENVQPELDAGRYAIKRVAGESLTVRADIFKEGHDVLVAVARWRQVTPASQKTDWAEVPLTFKNNDAWEGSIPLARNGRYEYTIEAWPDLFRTWAHELKRKVDAGRDVKSELLEGAALLEGAAARARGRSAEDHRMLAEAGARLRTPPTPDHLLVALSPELADAASRHPDRSLARAYDKVLEVFVDREKARNAAWYEFFPRSARRDGKTHGTFKDAQAWLPYIQRLGFDTVYLPPIHPIGRTARKGKNNSLRAEAGDVGSPWAIGAAEGGHKAVHPELGTLQDFRAFVDAAKAHGIEVALDLAFQCSPDHPYVKEHPEWFQHRPDGTIKTAENPPKRYEDIVNFDWMGPARDSLWKELKSVVLHWVDNGVRTFRVDNPHTKPIQFWHWLIREVQDQHPDVLFLSEAFTRPKVMKALAKVGFTQSYTYFTWRLFKQELQDYLEEITSPPVADYFRGNLWPNTPDILPENLQNAGPGAFRLRVALAATLSSVWGMYSGYELCEGRPVPGKEEYLDSEKYQLVAWDWDRPGNISEWIAKLNAVRKAHPALQQYQGLRFFDSDNDRVLFYGKRSPDGLSTVLVAVSLDPYTPQEALLRVPMEWLGVNAEETYQVHELMADQRSLWQGPDVQVRLTPEQPAAIWAVYRYRRTEHAFDYFE
[0059] Nucleotide sequence of CoGlgE:
[0060] SEQ ID NO.2
[0061]
[0062] coglgE-F:
[0063] SEQ ID NO.3
[0064] TAAGAGGAGATATACATATGACCGAACGACTCGGAAGC
[0065] coglgE-R:
[0066] SEQ ID NO.4
[0067] GTGGTGGTGGTGGTGCTCGAGCTCGAAGTAGTCGAACGC
Claims
1. A myxobacterial maltosyltransferase, characterized in that, Choose from any of the following: (1) A protein with an amino acid sequence as shown in SEQ ID NO.1; (2) A variant protein having at least 80%, 90%, 95% or 99% similarity to the amino acid sequence shown in SEQ ID NO. 1 and having maltodyltransferase activity.
2. The gene encoding the myxobacterial maltosyltransferase as described in claim 1.
3. The encoding gene according to claim 2, characterized in that, Its sequence is a nucleotide sequence encoding an amino acid sequence as shown in SEQ ID NO.1, or a sequence that is completely complementary to a nucleotide sequence encoding an amino acid sequence as shown in SEQ ID NO.
1.
4. A recombinant expression vector, characterized in that, It contains the coding gene as described in claim 2 or 3.
5. A transgenic recombinant strain expressing the myxobacterial maltosyltransferase of claim 1, characterized in that, Contains the coding gene as described in claim 2 or 3 or the recombinant expression vector as described in claim 4.
6. The application of the myxobacterial maltosyltransferase of claim 1 or the encoding gene of claim 2 or 3 in transglycosylation reaction and arbutin modification, preferably in arbutin glycosylation modification and malt oligosaccharide disproportionation reaction.
7. The application of the recombinant expression vector of claim 4 or the recombinant strain of claim 5 in transglycosylation reaction and α / β-arbutin modification, preferably in arbutin glycosylation modification and malt oligosaccharide disproportionation reaction.
8. A method for modifying arbutin, characterized in that, The method comprises using the myxobacterial maltosyltransferase of claim 1 to catalyze a transglycosylation reaction in an enzymatic reaction system to glycosylate α / β-arbutin.
9. The method according to claim 8, characterized in that, The enzyme activation reaction system contains α / β-arbutin and maltodextrin.
10. The use of the myxobacterial maltosyltransferase of claim 1 in disproportionating malt oligosaccharides with a degree of polymerization of X to products with a degree of polymerization of X ± 2n.
Citation Information
Patent Citations
Corallococcus coralloides and application thereof
CN103103152B