Construction method and application of engineered escherichia coli for producing retronarcotine

By constructing a complete biosynthetic pathway in Escherichia coli and introducing key enzyme genes using gene recombination technology, the problems of raw material dependence and insufficient synthesis efficiency in humulone production have been solved, achieving efficient and low-cost humulone production.

CN122146733APending Publication Date: 2026-06-05QINGDAO UNIV OF SCI & TECH
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202610575916.2
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2026-04-28
Publication Date
2026-06-05

Smart Images

  • Figure CN122146733A_ABST
    Figure CN122146733A_ABST
Patent Text Reader

Abstract

The application discloses a construction method and application of engineering escherichia coli for producing humulone, and the pTrcHis2B-IDI plasmid and pACYDuet-1-CCL4-VPS-PT1-linker-PT2 plasmid are transferred into engineering escherichia coli Trc-low competent cells to obtain the engineering escherichia coli for producing humulone. The engineering humulone bacteria are constructed based on the Trc-low competent cell host, the pACYDuet-1-CCL4-VPS-PT1-linker-PT2 is combined with the pTrcHis2B-IDI, the side chain precursor activation function of CCL4 is matched with the IDI / DMAPP donor module, the VPS-mediated skeleton construction and the PT1 / PT2-mediated continuous isoprenylation process are further connected, the humulone target path can be more completely operated in the same host, and therefore the specificity, continuity and directional guiding ability of the product biosynthesis are improved.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of humulone technology, and more specifically to a method for constructing and applying engineered Escherichia coli for the production of humulone. Background Technology

[0002] Hops (Humulus lupulus), also known as hops, are dioecious bittering agents essential in beer brewing and have long been used in traditional medicine as a medicinal plant. Humulone is one of the important secondary metabolites in hops, possessing pharmacological effects such as antibacterial, anti-inflammatory, sedative, hypnotic, and antitumor properties.

[0003] Currently, the acquisition of humulone mainly relies on plant extraction, which still has significant limitations. First, plant extraction routes are greatly affected by the variety of hop raw materials, growing environment, and batch variations. Furthermore, bitter acids often exist as a mixture of multiple homologues, leading to difficulties in separating the target product, significant raw material fluctuations, long preparation cycles, and high organic solvent consumption, making stable supply difficult to achieve. Second, chemical synthesis routes, due to the multifunctional groups and complex substitution structures of the target molecule, often require long reaction steps and high purification costs, limiting both economic efficiency and scale-up. Third, existing biosynthetic research mostly focuses on upstream precursor construction and total β-acid pathway synthesis, but yields are extremely low. Specialized systems are still lacking for the targeted synthesis of humulone, a specific target molecule. In particular, its formation process requires effective matching and synergy between CCL4, VPS, PT1 / PT2, and isoprene-based donor modules. Insufficient chassis design or pathway organization can easily lead to pathway interruption, precursor accumulation, or low final product formation efficiency, thus failing to meet the needs of targeted preparation and engineering applications of humulone. Summary of the Invention

[0004] The purpose of this invention is to provide a method for constructing engineered Escherichia coli for the production of humulone and its application, aiming to solve the problems of strong dependence on raw materials, unstable supply, incomplete pathways and insufficient synthesis efficiency in the existing chemical methods for extracting humulone from hops.

[0005] This invention provides a method for constructing engineered Escherichia coli for the production of humulone. The method includes transforming the pTrcHis2B-IDI plasmid and the pACYDuet-1-CCL4-VPS-PT1-linker-PT2 plasmid into Trc-low competent cells to obtain engineered Escherichia coli for the production of humulone.

[0006] The present invention describes a method for constructing engineered Escherichia coli for the production of humulone. Starting with an existing engineered Escherichia coli strain Trc-low, the method utilizes gene recombination technology to construct the evolved isoprene pyrophosphate isomerase gene (IDI) from Escherichia coli itself and the evolved isoprene transferase gene (PT1) from hop trichomes into the vector plasmid pTrcHis2B. Furthermore, the evolved phloroglucinol synthase gene (VPS), the evolved cytoplasmic coenzyme A ligase gene (CCL4), and another evolved isoprene transferase gene (PT2) from hop trichomes are constructed into the vector plasmid pACYCDuet-1. Finally, the two plasmids are transferred into the existing engineered Escherichia coli strain, thereby constructing a complete biosynthetic pathway for humulone in the target strain. Compared with other expression systems (such as yeast, protozoan cells, etc.), Escherichia coli has many advantages, such as: clear genetic background, simple culture method, fast reproduction speed, strong resistance to contamination and high expression level of target gene. Moreover, this method is short in process, low in cost, not limited by raw materials, and easy to operate, whether for culture preparation or isolation and purification.

[0007] In some embodiments of the present invention, Trc-low competent cells are thawed on ice, pACYDuet-1-CCL4-VPS-PT1-linker-PT2 plasmid and pTrcHis2B-IDI plasmid are added, mixed well, and then incubated on ice for 20-30 min; heat-shocked at 42℃ for 45-75 s, then transferred to ice and incubated for 3-5 min; 900 μL of LB liquid medium is added, and the cells are revived and cultured at 37℃ and 220 rpm for 1 h; after revival, 50-100 μL of bacterial culture is spread on LB solid medium plates containing ampicillin and chloramphenicol, and inverted in a 37℃ incubator for 12-16 h.

[0008] In some embodiments of the present invention, the LB liquid culture medium is prepared as follows: Take a 250 mL Erlenmeyer flask, add 1.0 g sodium chloride, 1.0 g tryptone, and 0.5 g yeast extract in sequence, and then add 100 mL RO water to dissolve it completely; seal the flask mouth with sealing film and rubber band, place it in an autoclave, add RO water to the high water level mark, and set the autoclave to 121℃ for 25 min for sterilization.

[0009] In some embodiments of the present invention, the LB solid culture medium is prepared as follows: Take a 250 mL Erlenmeyer flask, add 1.0 g sodium chloride, 1.0 g tryptone, 0.5 g yeast extract and 1.5 g agar in sequence, and then add 100 mL RO water to dissolve it completely; seal the mouth of the flask with sealing film and rubber band and place it in an autoclave, add RO water to the high water level mark in the autoclave, and set it to sterilize at 121 ℃ for 25 min.

[0010] In some embodiments of the present invention, the method for preparing the Trc-low competent cells includes: activation of the host strain: taking out the Trc-low Escherichia coli stored at -80℃ in glycerol and thawing it in an ice box; under aseptic conditions, taking the bacterial solution and streaking it on an LB solid medium plate for separation, and inverting it in a 37℃ constant temperature incubator for 12-16 hours to obtain single colonies; Preparation of competent cells: Take two 50 mL centrifuge tubes and add 25 mL of LB liquid medium to each; pick two suitable single colonies from the medium plate and inoculate them into the two centrifuge tubes respectively. Incubate at 37℃ and 220 rpm with shaking until the bacterial culture OD... 600 Stop culturing when the cell growth reaches 0.35-0.50; aliquot the culture medium into pre-chilled centrifuge tubes, centrifuge at 4℃ and 4000rpm for 5 min, and discard the supernatant; add pre-chilled competent cell preparation solution A to the cell pellet, gently resuspend by pipetting, and centrifuge again at 4℃ and 4000rpm for 5 min, and discard the supernatant; add pre-chilled resuspended cell solution B, aliquot and store at -80℃ to obtain Trc-low competent cells.

[0011] This invention provides an engineered Escherichia coli for producing humulone, wherein the engineered Escherichia coli for producing humulone is obtained by the method described above.

[0012] The engineered Escherichia coli used in the production of humulone of the present invention can be directly used to synthesize humulone, thus providing a novel synthetic method for the synthesis of humulone. This is a biosynthetic method that avoids the limitations of hop raw materials, achieves the preservation of biological activity that is difficult to achieve through chemical synthesis, and has higher selectivity and higher synthesis efficiency than the natural product method for synthesizing humulone using engineered strains.

[0013] This invention provides an application of engineered Escherichia coli in the biosynthesis of humulone, comprising the following steps: taking the engineered Escherichia coli obtained by the method for constructing engineered Escherichia coli for the production of humulone and performing shake-flask fermentation.

[0014] This invention starts with existing engineered strains in the laboratory and utilizes metabolic engineering technology to introduce the key enzyme genes of the humulone synthesis pathway into an engineered Escherichia coli strain via a vector, constructing a fermentation strain capable of fully biosynthesizing humulone. The resulting engineered E. coli synthesizes humulone through fermentation, representing a novel method for humulone synthesis. This method is simple to operate, has a short process, low cost, eliminates dependence on hops as a raw material, enables large-scale production, has high synthesis efficiency, avoids excessive solvent consumption, fully preserves the bioactivity of humulone, and exhibits high selectivity.

[0015] In some embodiments of the present invention, shake-flask fermentation includes the following steps: The primary seed culture was prepared using 10 mL of LB liquid medium, with 9 μL of chloramphenicol and 9 μL of ampicillin added respectively. Then, single colonies of engineered Escherichia coli that had been verified by PCR were picked and added to the primary seed culture for 12 h. The secondary seed culture was prepared using 100 mL of LB liquid medium, with 90 μL of chloramphenicol and 90 μL of ampicillin added respectively. It was cultured at 37℃ and 220 rpm, and then 5 mL of the primary seed culture was added and cultured for 12 h. The secondary seed culture was transferred into the fermentation medium at an inoculation volume of 10 mL, and 400 μL of magnesium sulfate, 180 μL of chloramphenicol, 180 μL of ampicillin and 200 μL of trace elements were added at the same time. The culture was carried out at 37 ℃ and 220 rpm. After culturing for 12 h, 100 μL of IPTG was added for induction, followed by 1 mL of isobutyric acid, 1 mL of mevalonic acid supplement, and 1 mL of yeast extract supplement. The mixture was then cultured with shaking. Subsequently, at 24 h and 36 h of fermentation, 1 mL of isobutyric acid supplement, 1 mL of mevalonic acid supplement, and 1 mL of yeast extract supplement were added again, respectively; glucose supplement was added 5 mL every 24 h, for a total of 2 times; OD was measured every 12 h during fermentation. 600 And pH, and adjust the pH to near neutral; When OD 600 Fermentation was terminated when the temperature dropped twice in a row. The fermentation broth was centrifuged at 10,000 rpm for 15 min at 4°C, and the cells were collected. After washing, hummus was obtained.

[0016] Compared with the prior art, the advantages and positive effects of the present invention are: This invention utilizes a Trc-low competent cell host and constructs a humulone-synthetic engineered bacterium using pACYDuet-1-CCL4-VPS-PT1-linker-PT2 and pTrcHis2B-IDI. By coordinating the CCL4 side-chain precursor activation function with the IDI / DMAPP donor module and further linking the VPS-mediated backbone construction and the PT1 / PT2-mediated continuous isoprene ylation process, the humulone target pathway can operate relatively completely within the same host, thereby improving the specificity, continuity, and targeted nature of the product's biosynthesis. Furthermore, this invention establishes a humulone-synthetic engineered supply platform that can replace natural trace-level isolation, and also provides a strain basis for subsequent activity studies, structural modifications, and the development of related derivatives. Attached Figure Description

[0017] Figure 1 This is a liquid chromatography-mass spectrometry (LC-MS) image of isovaleryl phloroglucinol, the intermediate of humulone synthesized in this invention. Figure 2 This is a liquid chromatography-mass spectrometry (LC-MS) image of deoxyhumexin, the precursor of humulone in this invention. Figure 3 This is a liquid chromatography-mass spectrometry (LC-MS) image of the hummus synthesized in this invention. Detailed Implementation

[0018] To make the objectives, technical solutions, and advantages of this invention clearer, the invention will be further described in detail below with reference to the accompanying drawings and embodiments. Those skilled in the art should understand that the specific description below is illustrative rather than restrictive and should not be construed as limiting the scope of protection of this invention.

[0019] The method for constructing engineered Escherichia coli for producing hummus according to the present invention includes the following steps: The pTrcHis2B-IDI plasmid and pACYDuet-1-CCL4-VPS-PT1-linker-PT2 plasmid were transformed into Trc-low competent cells to obtain engineered Escherichia coli for the production of humulone.

[0020] This invention utilizes a Trc-low competent cell host and constructs a humulone-synthetic engineered bacterium using pACYDuet-1-CCL4-VPS-PT1-linker-PT2 and pTrcHis2B-IDI. By coordinating the CCL4 side-chain precursor activation function with the IDI / DMAPP donor module and further linking the VPS-mediated backbone construction and the PT1 / PT2-mediated continuous isoprene ylation process, the humulone target pathway can operate relatively completely within the same host, thereby improving the specificity, continuity, and targeted nature of the product's biosynthesis. Furthermore, this invention establishes a humulone-synthetic engineered supply platform that can replace natural trace-level isolation, and also provides a strain basis for subsequent activity studies, structural modifications, and the development of related derivatives.

[0021] This invention uses engineered Escherichia coli Trc-low as the chassis, CCL4 as the side chain introduction enzyme, and constructs a dual plasmid co-expression system of pACYDuet-1-CCL4-VPS-PT1-linker-PT2 and pTrcHis2B-IDI to reconstruct a specific heterologous synthetic route for hummus synthesis in Trc-low.

[0022] The core idea of ​​this invention is to use CCL4 to enable the engineered bacteria to have the side-chain directing ability towards humulone, while retaining VPS, PT1 / PT2 and IDI as common core modules, thereby realizing the specific biosynthesis of humulone in Escherichia coli.

[0023] In this invention, CCL4 is responsible for activating the corresponding side-chain precursor of humulone into acyl-CoA; VPS is responsible for constructing the acyl-phloroglucinol backbone; PT1 / PT2 is responsible for continuous isoprene ylation; and IDI is responsible for increasing the availability of dimethylallyl pyrophosphate. CCL4 has high activity for longer branched fatty acids, and is particularly suitable for the introduction of humulone side-chain precursors; CCL4 is an important short-chain acyl-CoA in the picric acid pathway, and the difference in substrate recognition of upstream side-chain precursors is one of the keys to the formation of different β-acid homologues.

[0024] This invention employs a dual-plasmid co-expression scheme: the first expression vector is pACYDuet-1-CCL4-VPS-PT1-linker-PT2, and the second expression vector is pTrcHis2B-IDI. The first expression vector undertakes the main reaction portion of the humulone target pathway, while the second expression vector undertakes the isoprene group supply regulation portion. When both are co-introduced into Trc-low, a continuous biocatalytic reaction is formed: CCL4 activates the humulone side-chain precursor into acyl-CoA; VPS uses this acyl-CoA to construct an aromatic intermediate with malonyl-CoA; PT1 / PT2 completes continuous aromatic isoprene ylation; and IDI enhances the supply of dimethylallyl pyrophosphate (DMAPP), cooperating with the host mevalonate module to promote the formation of the final product.

[0025] Specifically, the method for constructing engineered Escherichia coli for producing hummus according to the present invention includes the following steps: 1) Take Trc-low competent cells and thaw them on ice. Add pACYDuet-1-CCL4-VPS-PT1-linker-PT2 plasmid and pTrcHis2B-IDI plasmid, mix well and let stand on ice for 20-30 minutes. 2) Heat shock at 42℃ for 45-75 seconds, then transfer to ice and let stand for 3-5 minutes; 3) Add 900 μL of LB liquid medium and revive the culture at 37°C and 220 rpm for 1 h; 4) After resuscitation, take 50-100 μL of bacterial culture and spread it on LB double-antibiotic solid medium plates containing ampicillin and chloramphenicol, and invert them in a 37℃ incubator for 12-16 h.

[0026] In this invention, the method for preparing Trc-low competent cells includes: Activation of host strain: Take out the Trc-low Escherichia coli stored at -80℃ in glycerol and thaw it in an ice box; under aseptic conditions, take the bacterial culture and streak it on LB solid medium plates for isolation, and incubate it upside down in a 37℃ constant temperature incubator for 12-16 hours to obtain single colonies; Preparation of competent cells: Take a 50 mL centrifuge tube and add 25 mL of LB liquid medium; pick two suitable single colonies from the medium plate and inoculate them into centrifuge tubes respectively, and incubate with shaking at 37℃ and 220 rpm until the bacterial culture OD... 600Stop culturing when the cell growth reaches 0.35-0.50; aliquot the culture medium into pre-chilled centrifuge tubes, centrifuge at 4℃ and 4000rpm for 5 min, and discard the supernatant; add pre-chilled competent cell preparation solution A to the cell pellet, gently resuspend by pipetting, and centrifuge again at 4℃ and 4000rpm for 5 min, and discard the supernatant; add pre-chilled resuspended cell solution B, aliquot and store at -80℃ to obtain Trc-low competent cells.

[0027] The nucleotide sequence of CCL4 is shown in SEQ ID NO:1, the nucleotide sequence of VPS is shown in SEQ ID NO:2, the nucleotide sequence of Pt1linkerPt2 is shown in SEQ ID NO:3, the nucleotide sequence of IDI is shown in SEQ ID NO:4, the nucleotide sequence of PT1 is shown in SEQ ID NO:5, the nucleotide sequence of PT2 is shown in SEQ ID NO:6, and the nucleotide sequence of Linker is shown in SEQ ID NO:7.

[0028] The present invention discloses an engineered Escherichia coli for producing humulone, wherein the engineered Escherichia coli for producing humulone is obtained according to the construction method of the engineered Escherichia coli for producing humulone described above.

[0029] The present invention relates to the application of engineered Escherichia coli in the biosynthesis of humulone, comprising the following steps: taking engineered Escherichia coli obtained by the above-described method for constructing engineered Escherichia coli for the production of humulone and performing shake-flask fermentation.

[0030] Shake-flask fermentation includes the following steps: The primary seed culture was prepared using 10 mL of LB liquid medium, with 9 μL of chloramphenicol and 9 μL of ampicillin added respectively. Then, single colonies of engineered Escherichia coli that had been verified by PCR were picked and added to the primary seed culture for 12 h. The secondary seed culture was prepared using 100 mL of LB liquid medium, with 90 μL of chloramphenicol and 90 μL of ampicillin added respectively. It was cultured at 37℃ and 220 rpm, and then 5 mL of the primary seed culture was added and cultured for 12 h. The secondary seed culture was transferred into the fermentation medium at an inoculation volume of 10 mL, and 0.00984 g magnesium sulfate, 180 μL chloramphenicol, 180 μL ampicillin and 200 μL trace elements were added at the same time. The culture was carried out at 37 ℃ and 220 rpm.

[0031] After culturing for 12 h, 100 μL of IPTG was added for induction, followed by 1 mL of isobutyric acid, 1 mL of mevalonic acid supplement, and 1 mL of yeast extract supplement. The mixture was then cultured with shaking. Subsequently, at 24 h and 36 h of fermentation, 1 mL of isobutyric acid supplement, 1 mL of mevalonic acid supplement, and 1 mL of yeast extract supplement were added again, respectively; glucose supplement was added 5 mL every 24 h, for a total of 2 times; OD was measured every 12 h during fermentation. 600 And pH, and adjust the pH to near neutral.

[0032] When OD 600 Fermentation was terminated when the temperature dropped twice in a row. The fermentation broth was centrifuged at 10,000 rpm for 15 min at 4°C, and the cells were collected. After washing, hummus was obtained.

[0033] The trace elements include 0.0037 g / L ammonium molybdate tetrahydrate, 0.0025 g / L copper sulfate pentahydrate, 0.0029 g / L zinc sulfate heptahydrate, 0.0158 g / L manganese chloride tetrahydrate, and 0.0247 g / L boric acid.

[0034] The following is a schematic diagram of the reaction process for constructing engineered Escherichia coli for the production of humulone, and a schematic diagram of the reaction process for the application of engineered Escherichia coli in the biological synthesis of humulone.

[0035]

[0036] Example 1 The method for constructing engineered Escherichia coli for producing hummus in Example 1 includes the following steps: 1) Activation of host strain Trc-low Escherichia coli stored at -80 ℃ in glycerol was removed and thawed in an ice box; under aseptic conditions, the bacterial culture was streaked onto LB solid medium plates for separation, and then incubated upside down in a 37 ℃ constant temperature incubator for 12-16 h to obtain single colonies.

[0037] 2) Preparation of Trc-low competent cells Take a 50 mL centrifuge tube and add 25 mL of LB liquid medium; pick two suitable single colonies from the medium plate and inoculate them into separate centrifuge tubes, then incubate with shaking at 37°C and 220 rpm until the bacterial growth rate (OD) is low. 600 Stop culturing when the cell growth reaches 0.35-0.50; aliquot the culture medium into pre-chilled centrifuge tubes, centrifuge at 4℃ and 4000rpm for 5 min, and discard the supernatant; add pre-chilled competent cell preparation solution A to the cell pellet, gently resuspend by pipetting, and centrifuge again at 4℃ and 4000rpm for 5 min, and discard the supernatant; add pre-chilled resuspended cell solution B, aliquot and store at -80℃ to obtain Trc-low competent cells.

[0038] 3) Two-plasmid transformation Take Trc-low competent cells and thaw them on ice. Add 3 μL of pACYDuet-1-CCL4-VPS-PT1-linker-PT2 plasmid and 3 μL of pTrcHis2B-IDI plasmid, respectively, mix gently, and incubate on ice for 20-30 min. Then heat shock at 42 ℃ for 45-75 s, and immediately transfer to ice and incubate for 3-5 min. Add 900 μL of LB liquid medium and resuscitate at 37 ℃ and 220 rpm for 1 h. After resuscitation, spread 50-100 μL of bacterial culture onto LB agar plates containing ampicillin and chloramphenicol, invert the plates, and incubate at 37 ℃ for 12-16 h to obtain double-resistant transformants.

[0039] 4) PCR verification of positive transformants Single colonies were picked from LB solid agar plates and inoculated into LB liquid medium containing ampicillin and chloramphenicol. After incubation at 37 °C and 220 rpm for 4-5 h with shaking, the bacterial culture was used as a template for colony PCR verification. Preferably, specific primers designed for pACYDuet-1-CCL4-VPS-PT1-linker-PT2 and pTrcHis2B-IDI were used for amplification to simultaneously verify that both expression vectors had been introduced into the host bacteria. Positive clones detected by PCR amplification were considered successfully constructed engineered *E. coli* for the production of humulone.

[0040] The primers used for the hummus route are: CCL4-VPS-PT1-linker-PT2-F:GTTGTATAGCCACGAAGCAGTGC; CCL4-VPS-PT1-linker-PT2-R:CTTTGATGAGACCAAGCCGTAAG; pTrcHis2B-IDI-F:GAGCGTGACACCACGATGC; pTrcHis2B-IDI-R:GCGTGGCGCTTTCTCATAG.

[0041] Positive clone verification: Primers were designed based on the plasmid map to perform PCR amplification and verification of positive strains.

[0042] PCR conditions can be as follows: 95 ℃ pre-denaturation for 3 min; 95 ℃ for 16 s, 59 ℃ for 16 s, 72 ℃ for 30 s, for a total of 32 cycles. Loop; final extension at 72 ℃ for 5 min. Agarose gel electrophoresis showed that the bacterium culture sample containing hummus could amplify a band consistent with the plasmid positive control, and normal growth of transformants could be observed on LB solid medium plates, indicating that the strain was successfully constructed.

[0043] LB liquid medium: Take a 250 mL Erlenmeyer flask and add 1.0 g sodium chloride, 1.0 g tryptone, and 0.5 g yeast extract in sequence. Then add 100 mL RO water to dissolve them completely. Seal the flask with sealing film and rubber band and place it in an autoclave. Add RO water to the high water level mark and set the autoclave to 121 °C for 25 min.

[0044] LB liquid medium contains 0.09 g / L ampicillin and 0.031 g / L chloramphenicol.

[0045] LB solid medium: Take a 250 mL Erlenmeyer flask and add 1.0 g sodium chloride, 1.0 g tryptone, 0.5 g yeast extract, and 1.5 g agar in that order. Then add 100 mL RO water to dissolve the contents completely. Seal the flask with sealing film and a rubber band, place it in an autoclave, add RO water to the high water level mark, and set the autoclave to 121 °C for 25 min.

[0046] LB solid medium contains 0.09 g / L ampicillin and 0.031 g / L chloramphenicol. Example 2

[0047] The application of engineered Escherichia coli in the biosynthesis of hummus according to the present invention includes the following steps: The recombinant strain that tested positive for both antibiotics and PCR was identified as the humulone-based engineered strain. The obtained positive engineered strain was used for shake-flask fermentation. First, primary and secondary seed cultures were prepared: the primary seed culture consisted of 10 mL LB broth with 9 μL chloramphenicol and 9 μL ampicillin added, respectively. Single colonies validated by PCR were then added to the primary seed culture and cultured for 12 h. The secondary seed culture consisted of 100 mL LB broth with 90 μL chloramphenicol and 90 μL ampicillin added, cultured at 37 ℃ and 220 rpm, and then 5 mL of the primary seed culture was added and cultured for 12 h. Subsequently, the secondary seed culture was transferred to the fermentation medium at an inoculum volume of 10 mL, along with 0.00984 g magnesium sulfate, 180 μL chloramphenicol, 180 μL ampicillin, and 200 μL trace elements, and cultured at 37 ℃ and 220 rpm.

[0048] After 12 h of culture, 100 μL of IPTG was added for induction, followed by 1 mL of 4-methylvaleric acid, 1 mL of mevalonic acid supplement, and 1 mL of yeast extract supplement, and the culture was continued with shaking. 4-Methylvaleric acid served as a precursor to the humulone side chain. Subsequently, at 24 h and 36 h of fermentation, 1 mL of 4-methylvaleric acid, 1 mL of mevalonic acid supplement, and 1 mL of yeast extract supplement were added again, respectively; glucose supplement was added twice, 5 mL every 24 h. OD600 and pH were monitored every 12 h during fermentation, and the pH was adjusted to near neutral.

[0049] Fermentation was terminated when the OD600 decreased twice consecutively. The fermentation broth was centrifuged at 10,000 rpm for 15 min at 4 ℃, and the cells were collected. After washing, the cells were extracted and analyzed, thus enabling the biosynthesis of humulone.

[0050] Product detection and application effects of humulone: ​​In a 200 mL shake flask system, after optimized feeding, the weight of crude humulone increased from the initial 0.141 g / L to 0.434 g / L; LC-MS detected the molecular signals of humulone intermediates, precursors, and products. The deprotonated ion [MH] signal corresponding to humulone is consistent with the theoretical molecular weight of 427.2854 g / mol. These results indicate that the engineered *E. coli* strain constructed in this invention possesses the ability to biosynthesize humulone and can be used as a strain for humulone preparation. However, since there is currently no commercially available standard for humulone, accurate quantification is not possible at this stage.

[0051] Figure 1 Isoben intermediate for synthesizing hummus Man Liquid chromatography-mass spectrometry (LC-MS) signal of pyrogallol. Figure 2 This is a liquid chromatography-mass spectrometry (LC-MS) image of deoxyhumulone, a precursor of humulone. Figure 3 The liquid chromatography-mass spectrometry (LC-MS) signal for hummus; by Figure 1 , Figure 2 , Figure 3 It can be seen that the corresponding liquid chromatography-mass spectrometry signals of isobutyryl phloroglucinol, deoxyhumulone, and humulone were detected in the fermentation sample, indicating that the engineered Escherichia coli constructed in this invention has the ability to biosynthesize humulone, and the key intermediates, precursors, and final products in the target pathway can be continuously detected; among them, the [M−H] signal corresponding to humulone is consistent with the theoretical molecular weight, indicating that the obtained product has good consistency with the target compound.

[0052] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, and not to limit them; although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art should understand that modifications can still be made to the technical solutions described in the foregoing embodiments, or equivalent substitutions can be made to some of the technical features; and these modifications or substitutions do not cause the essence of the corresponding technical solutions to deviate from the spirit and scope of the technical solutions of the embodiments of the present invention.

Claims

1. A method for constructing engineered Escherichia coli for the production of hummus, characterized in that, The method includes: Take Trc-low competent cells and thaw them on ice. Add pACYDuet-1-CCL4-VPS-PT1-linker-PT2 plasmid and pTrcHis2B-IDI plasmid, mix well and let stand on ice for 20-30 minutes. Heat shock at 42℃ for 45-75 seconds, then transfer to ice and let stand for 3-5 minutes; Add 900 μL of LB liquid medium and revive the culture at 37°C and 220 rpm for 1 h. After resuscitation, take 50-100 μL of bacterial culture and spread it on LB solid medium plates containing ampicillin and chloramphenicol, then invert the plates and incubate them at 37°C for 12-16 hours.

2. The method for constructing engineered Escherichia coli for hummus production according to claim 1, characterized in that, The LB liquid culture medium is prepared by adding sodium chloride, tryptone, yeast extract, and RO water to a bottle and dissolving them thoroughly. The bottle opening is then sealed with sealing film and rubber bands and placed in an autoclave. RO water is added to the autoclave up to the high water level mark, and the autoclave is set to 121°C for 25 minutes for sterilization.

3. The method for constructing engineered Escherichia coli for hummus production according to claim 2, characterized in that, The concentrations of sodium chloride, tryptone, and yeast extract were 1% g / mL and 0.5% g / mL, respectively.

4. The method for constructing engineered Escherichia coli for hummus production according to claim 1, characterized in that, The LB solid culture medium is prepared by adding sodium chloride, tryptone, yeast extract, agar, and RO water to a bottle and dissolving them thoroughly. The bottle opening is then sealed with sealing film and rubber bands and placed in an autoclave. RO water is added to the autoclave up to the high water level mark, and the autoclave is set to 121°C for 25 minutes for sterilization.

5. The method for constructing engineered Escherichia coli for hummus production according to claim 4, characterized in that, The concentrations of sodium chloride, tryptone, yeast extract, and agar were 1.5% g / mL.

6. The method for constructing engineered Escherichia coli for producing hummus according to claim 1, characterized in that, The method for preparing the Trc-low competent cells includes: Activation of host strain: Take out the Trc-low Escherichia coli stored at -80℃ in glycerol and thaw it in an ice box; under aseptic conditions, take the bacterial culture and streak it on LB solid medium plates for isolation, and incubate it upside down in a 37℃ constant temperature incubator for 12-16 hours to obtain single colonies; Preparation of competent cells: Take a 50 mL centrifuge tube and add 25 mL of LB liquid medium; pick a suitable single colony from an LB solid medium plate and inoculate it into a centrifuge tube, then incubate with shaking at 37℃ and 220 rpm until the bacterial culture OD... 600 Stop culturing when the cell growth reaches 0.35-0.50; aliquot the culture medium into pre-chilled centrifuge tubes, centrifuge at 4℃ and 4000rpm for 5 min, and discard the supernatant; add pre-chilled competent cell preparation solution A to the cell pellet, gently resuspend by pipetting, and centrifuge again at 4℃ and 4000rpm for 5 min, and discard the supernatant; add pre-chilled resuspended cell solution B, aliquot and store at -80℃ to obtain Trc-low competent cells.

7. An engineered Escherichia coli for the production of hummus, characterized in that, The engineered Escherichia coli used for producing hummus is the engineered Escherichia coli obtained by the construction method of the engineered Escherichia coli used for producing hummus according to any one of claims 1-6.

8. The application of an engineered Escherichia coli in the biological synthesis of hummus, characterized in that, The engineered Escherichia coli obtained by the method for constructing engineered Escherichia coli for producing hummus according to claim 1 was subjected to shake-flask fermentation.

9. The application of the engineered Escherichia coli according to claim 8 in the biological synthesis of hummus, characterized in that, Shake-flask fermentation includes the following steps: The primary seed culture was prepared by adding 9 μL of chloramphenicol and 9 μL of ampicillin to 10 mL of LB liquid medium. Then, single colonies of engineered Escherichia coli that had been verified by PCR were picked and added to the primary seed culture for 12 h. The secondary seed culture was prepared using 100 mL of LB liquid medium, with 90 μL of chloramphenicol and 90 μL of ampicillin added respectively. It was cultured at 37℃ and 220 rpm, and then 5 mL of the primary seed culture was added and cultured for 12 h. The secondary seed culture was transferred into the fermentation medium at an inoculation volume of 10 mL, and 0.00984 g magnesium sulfate, 180 μL chloramphenicol, 180 μL ampicillin and 200 μL trace elements were added at the same time. The culture was carried out at 37 ℃ and 220 rpm. After culturing for 12 h, 100 μL of IPTG was added for induction, followed by 1 mL of isobutyric acid, 1 mL of mevalonic acid supplement, and 1 mL of yeast extract supplement. The mixture was then cultured with shaking. Subsequently, at 24 h and 36 h of fermentation, 1 mL of isobutyric acid supplement, 1 mL of mevalonic acid supplement, and 1 mL of yeast extract supplement were added again, respectively; glucose supplement was added 5 mL every 24 h, for a total of 2 times; OD was measured every 12 h during fermentation. 600 And pH, and adjust the pH to near neutral; When OD 600 Fermentation was terminated when the temperature dropped twice in a row. The fermentation broth was centrifuged at 10,000 rpm for 15 min at 4°C, and the cells were collected. After washing, hummus was obtained.

10. The application of the engineered Escherichia coli according to claim 9 in the biosynthesis of prehumulone, characterized in that, The trace elements include 0.0037 g / L ammonium molybdate tetrahydrate, 0.0025 g / L copper sulfate pentahydrate, 0.0029 g / L zinc sulfate heptahydrate, 0.0158 g / L manganese chloride tetrahydrate, and 0.0247 g / L boric acid.